ANTISENSE & NUCLEIC ACID DRUG DEVELOPMENT 10:297–310 (2000)Mary Ann Liebert, Inc.

Review

Heterocyclic Modifications of Oligonucleotides and Antisense Technology

PIET HERDEWIJN

ABSTRACT

Modification of the heterocyclic moiety of oligonucleotides has led to the discovery of potent antisense com-pounds. This review describes the physicochemical factors that are responsible for duplex stabilizationthrough base modification. A summary is given of the different heterocyclic modifications that can be used tobeneficially influence this duplex stability. The biologic activity of base-modified oligonucleotides is described,and the different factors that are important for obtaining in vivo antisense activity with heterocyclic-modifiedoligonucleotides are summarized.

INTRODUCTION

ACOMPREHENSIVE REVIEW dealing with the hybridizationproperties of base-modified oligonucleotides within the

double and triple helix motif (Luyten and Herdewijn, 1998) andsecond review describing the recognition of mixed sequencesby triple helix formation were published recently (Gowers andFox, 1999). Therefore, this review is restricted to analysis ofheterocyclic modifications of oligonucleotides that increase du-plex stability and have potential to be used in nucleic acid-based therapeutics. This short review emphasizes antisense ap-plications and not gene-specific inhibitors by triplex formation.An overwhelm ing number of modified pyrimidine and purinenucleosides have been synthesized with the expectation thatthey will beneficially influence duplex stability based on rein-forcing hydrogen bond formation, electrostatic interactions, hy-drophobicity, or p – p overlapping interactions of planar bases.Few of them have been shown to be useful for this purpose,however, and a very minor portion has undergone cellular stud-ies. This pioneering work on the understanding of the physico-chemical and biologic factors that influence hybridization prop-erties and in vivo activity of base-modified oligonucleotides hasbrought more potent antisense compounds into development.The remaining barriers for using these molecules as translation-controlling drugs for medical treatment will slowly fade awayin the coming years.

CHEMISTRY

The most attractive sites for substituting the nucleoside basesare those positions that are exposed to solvents in the majorgroove (i.e., the 4-position and 5-position of pyrimidines andthe 6-position and 7-position of purines) (Fig. 1). Substitutionsat these positions are expected neither to interfere with basepairing nor to induce steric hindrance and influence the generalgeometry of the double helix.

Modifications at the base-pairing site may be beneficial forduplex stability when the number of hydrogen bonds betweencomplementar y bases is increased. 2,6-Diaminop urine is a nat-urally occurring base (Kirnos et al., 1977; Khudyakov et al.,1978). Substitution of 2 9 -deoxyadenosine by 2-amino-2 9 -de-oxyadenosine stabilizes hybrids formed with both DNA andRNA because of stronger base pairing without disturbing theglobal or local conformation of the duplex (Chollet et al., 1988;Chazin et al., 1991). Incorporation of 2,6-diaminopuri ne intoDNA oligomers increases the thermal stability of the duplex by0°C–2°C per 2,6-diaminopuri ne:thym ine base pair (Gryaznovand Schultz, 1994). The increase in thermal stability of du-plexes by introducing 2,6-diaminopuri ne is larger in the ribo-series than in the deoxy-series (Sproat et al., 1991; Tanaka etal., 1986). The 2-amino group creates an additional hydrogenbond. However, the 2,6-diaminopurin e:uracil base pair staysless stable than the guanine:cytosine pair (Chollet et al., 1986,

Rega Institute for Medical Research, K. U. Leuven, Laboratory for Medicinal Chemistry, 3000 Leuven, Belgium.

297

1988; Gryaznov and Schultz, 1994). This may be due to a dif-ference in base stacking pattern or the geometry of the hydro-gen bonds (Meisenheime r et al., 1996; Muraoka et al., 1991).2,6-Diam inopurine imparts other structural features, such as analtered groove width and disruption of the normal spine of hy-dration in the minor groove (Chollet et al., 1988). Indeed, the 2-amino group of 2,6-diaminopurin e base points toward the mi-nor groove in DNA, and adenine R diaminopurine substitutionaffects the minor groove width of DNA. The net effect ofadding an NH2 group to the C-2 carbon of the adenine base is torender the minor groove more hydrophilic. The C-2 carbon be-comes inaccessible to solvent (Bailly and Waring, 1998). In thedeoxy-series, the stabilizing contribution arising from the for-mation of a third hydrogen bond is opposed by a destabilizationdue to the disruption of the spine of hydration in the minorgroove of B-DNA (Howard et al., 1984). Modified nucleosides,such as 2,6-diaminopurin e (Fig. 2), bind more tightly than ade-nine to uracil and less tightly than adenine to guanine, thus in-creasing the selectivity for an A:U R A:G mismatch (Monia etal., 1992). Diaminopurine base may facilitate B R Z transitionin the DNA structure (Chollet et al., 1988; Vorlícková et al.,1988). Substitution with a central diaminopurine:t hymine(uracil) pair in the sequence CGU(T)ACG is consistent with Z-DNA formation. With the Z-DNA form, the continuous spineof water molecules in the minor groove crevice is not disrupted(Coll et al., 1986; Schneider et al., 1992; Kagawa et al., 1993).Overall and dependent on the sequence, the diaminopurine:uracil(thymine) base pair may be more stable than, as stable as,or occasionally less stable than the adenine:uracil(thy mine)base pair.

Other modifications at the base-pairing site may increase du-plex stability when the modified nucleoside is introduced at an

unpaired site (Bischofberger and Matteucci, 1989), which wasdemonstrated using pyrimido-pyrim idinone and naphtimidazo-pyrim idinone nucleosides. Introduction of a substituent in the6-position of pyrimidines or the 8-position of purines stabilizessyn-conformation and leads to duplex destabilization. It might,therefore, be expected that because of steric hindrance, intro-duction of 4,5-fused pyrimidine heterocycles into an oligonu-cleotide might lead to duplex stabilization, whereas introduc-tion of 5,6-fused pyrimidine heterocycles leads to duplexdestabilization. The observation that incorporation of two 6-phenyllumazine nucleosides (Fig. 2) in positions 7 and 11 of thesequence CCAAGG7ACG11ACCTTGG raises the Tm by 5°Cis apparently in contrast with this hypothesis. Double substitu-tion with 7-(4-biphenyl)lum azine (Fig. 3) gives a 10°C increasein Tm (Rösler and Pfleiderer, 1997). The stabilization effect isstrongly dependent on the site of the modified nucleobase in thechain. It can be expected, however, that these nucleosideanalogs behave as covalently attached intercalators and thatthey do not take part in base pairing. Binding of intercalators tothe 5-position of pyrimidine nucleosides (Fig. 3) is known toenhance duplex stability (Ozaki et al., 1998). Stacking interac-tions of the aromatic p -systems are indeed more important forduplex stabilization than hydrogen bond formation. The hydro-gen bonds deliver additional stabilization and are involved inthe specificity of the interactions. In this way, incorporation ofvarious condensed areno[g]lumazin e derivatives stabilizes thehelical structure by improved stacking effects (Rösler and Pflei-derer, 1997).

When considering the introduction of a substituent in the 5-position of pyrimidine nucleosides, several factors have to beenvisaged. The introduced substituents may increase thestrength of base pairing, providing beneficial interactions with

HERDEWIJN298

FIG. 1. Preferred sites for nucleoside substitutions.

FIG. 2. Examples of nucleoside modifications leading to increased duplex stability by different mechanisms.

neighboring bases. Hydrophobic interactions and stacking in-teractions may stabilize the duplex structure. Stacking is a com-plex process, and electrostatics, polarizability, hydrophobicity,and surface area are factors influencing p -stacking interactionsin aqueous solutions (Ren et al., 1996). This makes the outcomeof the effect of incorporating a modified nucleoside into anoligonucleotide, sequence dependent and unpredictable. Theproperty of the 5-substituent that can be accommodated is re-stricted by several factors. Steric interactions of the C-5 sub-stituent with H-6 or O4 of the uracil ring are destabilizing be-cause of loss of coplanarity with the pyrim idine ring (Gutierrezet al., 1994). Steric interactions of the 5-substituent with H-2 9and H-3 9 of the sugar of the adjacent base pair may lead to localconformational changes and an unfavorable effect on duplexstability (Gutierrez and Froehler, 1996). Hydrogen bond forma-tion between the C-5 substituent and the O4 (uracil) or 4-NH2

(cytidine) group may result in weaker Watson-Crick base-pair-ing system s. The substituent should not hamper efficient solva-tion of the duplex because of its hydrophobicity and bulkiness,which is the case for higher alkyl groups introduced into the 5-position of pyrimidine bases (Hayakawa et al., 1988; Sagi et al.,1986). The substituent should not lower the pKa of the pyrimi-dine base too drastically. In the case of fluorouracil, for exam-ple, the pKa of the N3-H ionization range is 7.5–8.2 (Kremer etal., 1987). The fraction of the ionized form will be dependenton the sequence and, likewise, the influence of the 5-fluo-rouracil base on the hybridization properties (Watson-Crickbase pairing, electrostatic interactions, and stacking interactionsare dependent on the ionization state of the nucleobase). For an-tisense purposes, the substituent should not be a source of un-controllable reactivity. The 5-brom ouracil, 5-iodouracil, and 5-iodocytosine bases are known to enhance photosensitivity withrespect to RNA or DNA-protein photocross-linkin g and DNAdamage (Sugiyama et al., 1990; Meisenheim er et al., 1996).

The most common way to stabilize an oligonucleotide du-plex is by replacement of the hydrogen atom in the 5-position ofthe pyrimidine bases by a methyl group. The 5-methylcytosinebase participates (Fig. 4) in the control of gene expression inhigher organisms. One organism (Xanthomonas oryzae , bacte-riophage XP-12) has all of its cytosine replaced by 5-methylcy-tosine, which results in thermally very stable DNA (Ehrlich etal., 1975). Although this substitution is minor, its effect on du-plex stability may be more complex than expected. Other ef-

fects (besides duplex stabilization) that have been observed byintroduction of 5-methylpyrimi dines are a reduction of the co-operativity of the melting process (Uesugi et al., 1986), an al-teration of the duplex conformation (Uesugi et al., 1986;Richardson et al., 1989), and no alteration of duplex stability(Boudou et al., 1999).

Unsaturation of the 5-substituent of pyrimidine nucleosideshas a pronounced influence on duplex stabilization. The triplebond influences stacking interactions in a beneficial way, andincorporation of 5-propynyl-2 9 -deoxyuridine and 5-propynyl-2 9 -deoxycytidine (Fig. 4) for the nucleosides thymidine and 2 9 -deoxycytidine into DNA increases the stability of DNA-RNAhybrids (Wagner et al., 1993; Froehler et al., 1992). The propy-nyl group is preferred over prolonged alkynyl substituents. 5-Alkynyl substituents also increase the resistance of the oligonu-cleotide to enzymatic hydrolysis. A 5-propynyl substituentrenders the oligonucleotide 10 times more stable than a methylgroup (Ötvös et al., 1999). Likewise, small heteroaryl sub-stituents that are coplanar with the pyrimidine ring may in-crease base-stacking interactions with adjacent base pairs of aDNA-RNA duplex (Gutierrez et al., 1994). The effect of a thia-zolyl substituent is similar to that of a propynyl group (Gutier-rez et al., 1994), whereas a 5-methylthiazol ring (Fig. 5) furtherincreases the affinity of the oligonucleotide for its RNA com-plement (Gutierrez and Froehler, 1996). The methyl substituentfurther increases the hydrophobic interactions.

Similar effects may be obtained by substituting the 7-posi-tion of the purine base. Removal of the 7-nitrogen atom of gua-nine, giving 7-deaza-2 9 -deoxyguanosine, reduces duplex stabil-ity of a poly GC sequence (Seela and Driller, 1985) and of apalindromic sequence (Seela and Driller, 1986). This is ex-plained by a helix distortion due to an altered overlap of the p -electron system of the modified base pair, by increasing the hy-drophobicity of the major groove, and by an increase in the pKaof the amido group. Increase in pKa causes less efficient hydro-gen donor capacities of the N3-H function and destabilization ofthe Watson-Crick base pair (Seela and Driller, 1985). Likewise,deoxytubercidine (7-deaza-2 9 -deoxyadenosine) has an alteredproton acceptor site as well as an altered p -electron system, andthe hydrogen bonds with thymine have a reduced stability. Anadditional factor to explain this phenomenon is by steric hin-drance (Ono et al., 1983, 1984). The proton at position 7 of thepurine base could force the exoamino group out of the plane of

BASE MODIFICATIONS AND ANTISENSE ACTIVITY 299

FIG. 3. Duplex-stabiliz ing modifications.

the aromatic system and weaken the H-bond formation capaci-ties. Also, the formation of bifurcated hydrogen bonds betweenthe 6-amino group and O4 of the adjacent thymine base may beaffected by the displacement of deoxyadenosine by deoxytuber-cidine. At high salt concentrations, 7-deazaadenine gives du-plex stabilization when replacing adenine in an alternating d(A-T)6 sequence. At low salt concentrations, destabilization isobserved. The d(A-T) sequence has a polymorphic structurethat adopts different conformations depending on the environ-ment (Seela and Thomas, 1995; Grein et al., 1994). Generally,replacement of deoxyadenosine by deoxytubercidine results ina decrease in duplex stability (Seela and Kehne, 1985; Seela etal., 1989). Incorporation of a methyl group in position 7 of 7-deazaguanine, giving 7-deaza-7-methy lguanine, stabilizes theB-DNA duplex of a poly GC sequence compared with 7-deaza-guanine, coming close to the values of the parent purineoligonucleotides (Seela and Chen, 1997). 7-Iodo-7-deaza-2 9 -deoxyguanosine (Fig. 6) and 7-bromo-7-diaza -2 9 -deoxyguano-sine may be slightly stabilizing or slightly destabilizing depend-ing on the sequence (Seela et al., 1995; Ramzaeva and Seela,1996). These 7-substituted-7-de azaguanines have a stabilizingeffect when incorporated in self-compleme ntary homoduplexeswhere the 7-substituent is located in the major groove of B-DNA (Ramzaeva and Seela, 1996). In heteroduplexes, intro-duction of these modified nucleosides causes duplex destabi-lization. However, 7-iodo-7-deaza-2 9 -deoxyguanosine in-creases the stability of DNA-RNA duplexes, which indicates itsusefulness for the stabilization of A-DNA forms (Ramzaevaand Seela, 1996). 7-(1-Propynyl)- 7-deaza-2 9 -deoxyguanosine(Fig. 6) increases duplex stability relative to the 7-unsubstituteddeazapurine (Buhr et al., 1996). The 7-(hex-1-ynyl)-su bstituted7-deazaguanine-co ntaining oligom ers exhibit similar Tm valuesas the G-C oligomers. A single incorporation of 7-iodo-, 7-propynyl-, or 7-cyano-7-deaza-2 -amino-2 9 -deoxyadenosine re-

sults in a global increase in Tm by 3–4°C (Balow et al., 1998).The effect is not additive when more of these modified basesare introduced. The incorporation of short alkynyl residues atposition 7 of 7-deaza-2 9 -deoxyadenosine- containing oligonu-cleotide duplexes enhances their stability if the side chain is notmuch longer than the depth of the major groove (Seela and Zu-lauf, 1999b). 7-(1-Propynyl)-7 -deaza-2 9 -deoxyadenosine and7-(1-ethynyl)-7-de aza-2 9 -deoxyadenosine are more stabilizingthan deoxytubercidin (Buhr et al., 1996; Seela and Zulauf,1999b). Likewise, the introduction of bromine, chlorine, ormethyl substituents in the 7-position of 7-deazaadenine in-creases duplex stability compared with adenine (Seela andThomas, 1995). Incorporation of a 7-substituted 7-deaza-8-aza-purine residue may further enhance the stability of DNA-RNAduplexes (Seela and Zulauf, 1999a). Examples are given ofbromine, iodine, and alkynyl substituents. The stabilizing effectis stronger than with 7-substituted 7-deazaadenines. The stabi-lization of the 7-substituent is due to favorable reaction en-thalpy (Seela and Thomas, 1995). For example, the stabilizationeffect of an iodine substituent has been declared by (1) increasein hydrophobicity of the major groove, (2) increased stackinginteractions of modified bases, and (3) better proton donorproperties of N1-H and stronger H-bonding within the base pair.

Another method to obtain duplex stabilization is by position-ing of a positively charged functional group in the major or mi-nor groove that is able to interact with the phosphate groups, re-sulting in net charge reduction of the double-stranded nucleicacids and a decreased electrostatic repulsion between the an-ionic strands. The magnitude of the stabilization is dependenton the location of the cationic charge and whether salt forma-tion occurs with a phosphate group on the complementarystrand or on its own strand. Covalent binding of sperm ine at theN2 of guanine (Fig. 7) increases duplex stability considerably(Schmid and Behr, 1995). The stability of the duplex becomes

HERDEWIJN300

FIG. 4. 5-modified pyrimidines.

FIG. 5. Thiazolyl-substit uted deoxyuridines.

less dependent on the ionic strength of the solution. The loss ofcounterions after denaturation is less for these duplexes whencompared with a natural duplex (Hashimoto et al., 1993). Thestabilization effect is most pronounced when the aminoalkylgroup is fixed in the right position. A 5-aminopropyl group, forexample, is destabilizing (Heystek and Gold, 1998). For pyrimi-dine nucleosides, an amido linker might be used between basemoiety and the neutralizing group (Ono et al., 1994). The stabi-lizing effect is accompanied by an increase in resistance againstnuclease hydrolysis (Ueno et al., 1998; Haginoya et al., 1997)and a slowdown effect of RNase H cleavage of the target RNA(Ueno et al., 1997). The 5-amido group also lowers the pKa ofthe modified base, which may contribute to complex formation.The 5-(N-aminohexyl)amido group (Fig. 7) increases duplex sta-bility by 2°C per modification (Haginoya et al., 1997). Abranched triaminoalkylamido substituent increases the stability

of a DNA-RNA duplex by 2.5–3°C per modification (Ueno et al.,1998). A 5-(3-aminopropynyl)-substituted uracil stabilizes DNAduplexes because of an enhanced base stacking of the ethynylgroup and the formation of a salt bridge with the nonbridging ma-jor groove oxygen on the phosphate of the 5 9 -nucleotide(Heystek and Gold, 1998). The increase in duplex stability ex-ceeds that observed with the neutral propynyl side chain by 1°Cper residue. Substitution of the 7-position of 7-deaza-2 9 -de-oxyadenosine with a 3-aminoprop-1-ynyl or a 5-aminopent-1-ynyl residue (Fig. 7) stabilizes duplexes considerably, particu-larly at low counterion concentrations (though not inhomooligomers) (Seela and Zulauf, 1999b). However, the influ-ence of the aminoalkyl group on duplex stability is not as simpleas generally proposed. Asymmetric neutralization of phosphatecharges of DNA may, for example, induce bending and influencethe shape and stability of nucleic acids in an unexpected way.

BASE MODIFICATIONS AND ANTISENSE ACTIVITY 301

FIG. 6. 7-substituted purines.

Bicyclic and tricyclic heterocycles may stabilize duplexstructures. Indeed, stacking interactions and, thus, the stabilityof duplexes may be increased by extending the heteroaromaticsystem of the pyrim idine base at the 4,5 bond (Matteucci andvon Krosigk, 1996; Lin et al., 1995). Preferentially, the secondring is a six-membered ring. This is deduced not only from thelower Tm of carbazole-contain ing duplexes (in comparison withphenoxazine and phenothiazine-sub stituting oligonucleotides)(Matteucci and von Krosigk, 1996; Lin et al., 1995) but alsofrom studies with pyrrolopyrim idinone nucleosides (Woo et al.,1996). In the latter case, the third hydrogen bond between gua-nine and pyrrolopyrimidi none is very weak due to suboptimalorientation of the N-H group of the pyrrolo ring (Woo et al.,1996). The pyridopyrimidine nucleoside (Fig. 8) forms threeWatson-Crick hydrogen bonds with the guanine base and in-

creases stacking interactions with neighboring bases (Inoue etal., 1985). As a result, the pyridopyrimidin e:guanine base pairis more stabilizing than the natural guanine:cytidine base pair.Phenoxazine, phenothiazine, and carbazole nucleosides, like-wise, increase duplex stability, and this effect is most pro-nounced when the modified nucleosides are clustered (Mat-teucci and von Krosigk, 1996; Lin et al., 1995; Kurchavov andSverdlov, 1997). The D Tm/modification is 2°C for separate po-sitioning of phenothiazine and phenoxazine nucleosides and5°C when clustered (Lin et al., 1995). In the latter case, the tri-cyclic ring could stack with the nearest neighbor tricycle. Thisis explained by dipole-induced dipole interactions resulting inexcellent p – p overlap between the second ring of the heterocy-cle and the third ring of the adjacent tricycle (Lin et al., 1995).These tricyclic nucleosides all selectively pair with the guanine

HERDEWIJN302

FIG. 8. Duplex-stabiliz ing bicyclic and tricyclic heterocyclic bases.

FIG. 7. Stabilizing duplexes with positively charged functional groups.

base. As the third ring is a hydrophobic benzene ring, replacingthis ring by a more polarizable heterocyclic ring might be moreadvantageous for major groove hydration (Lin et al., 1995). Atetracyclic adenosine analog has been found to pair with thethymine base (Buhr et al., 1999). Multiple adjacent tetracyclicadenine incorporation is needed to have a positive cumulativeeffect and a significant increase in Tm.

In cytosine, one of the hydrogen atoms of the 4-amino groupis involved in base pairing, whereas the other protrudes in themajor groove. It could be expected that the latter hydrogen atomcould be replaced by other substituents without sterically affect-ing Watson-Crick base pairing and without a major influence onthe thermal stability of the duplex. However, substituting thishydrogen atom will indirectly influence base pairing by its elec-tronic effects. Moreover, hybridization kinetics of the oligonu-cleotides may be affected with some of the tethers (Dahlén et al.,1994), and the N4-substituent may influence conformationaltransitions within the double-stranded nucleic acids (Butkus etal., 1987). In addition, in a Watson-Crick base-pairing duplex,the N4-substituent should adopt the thermodynamically less sta-ble antirotamer about the C4-N4 bond. As a result, N4-substitu-tion generally leads to duplex destabilization (MacMillan andVerdine, 1990, 1991). Somewhat surprisingly, an N4-aminoalkyl substituent also has a destabilizing effect on duplexstability (Allerson et al., 1997; Prakash et al., 1994; Barawkar etal., 1994), and the desired effect of counteracting the electrosta-tic repulsion between the negatively charged oligonucleotides(by introducing this N4-substituent) was not observed. The rea-son for this might be that the protonated aminoalkyl group is in-volved in stabilizing the single-stranded oligonucleotide by in-ternal electrostatic effects (Allerson et al., 1997).

Substitution of the base moiety may influence the sugar con-formation. For antisense purposes, a preorganization of the fura-nose sugar in the 3 9 -endo conformation leads to duplex stabiliza-tion due to increased interstrand stacking. This effect can begenerated using 2-thiopyrimidine nucleosides. Sulfur is bulkier,it is more polarizable, and it is a weaker hydrogen bond acceptorthan oxygen. As a result, 2-thiopyrimidine nucleosides preferen-tially adopt a 3 9 -endo sugar pucker and beneficially influencestacking interactions. In addition, a stronger hydrogen bondingeffect (increased acidity) of the N-3 imino proton is expected(Connolly and Newman, 1989; Newman et al., 1990). Incorpo-ration of 2-thiothymidine or 2 9 -deoxy-2-thiouridine gives stabi-lization of the duplex structure (Connolly and Newman, 1989;Newman et al., 1990). This effect, however, is dependent on se-quence and on the incorporation site of the 2-thiopyrimidine nu-cleoside (Kuimelis and Nambiar, 1994). To be accommodated,the sterically bulky sulfur atom may demand a widening of theminor groove (Kuimelis and Nambiar, 1994). The thiocarbonylgroup may be involved as well in interstrand interactions as inintrastrand interactions. It is clear that the 2-thiopyrimidine basemay influence local geometry and the cooperativity of the melt-ing process. Although the principle of increasing duplex stabil-ity by introducing a substituent in the 2-position of the pyrimi-dine base so that the sugar becomes preorganized in its 3 9 -endoconformation is very attractive, the effect of incorporating a 2-thiopyrimidine base on duplex stability is unpredictable.

Although stable base pairs are formed between 2-thiothymi-dine and adenine, no such base pairing occurs between 2-thio-thymidine and 2,6-diam inopurine (Kutyavin et al., 1996). This

is due to a steric clash between the 2-thio group of the pyrimi-dine base and the 2-amino group of the purine base, leading to atilt of the bases relative to each other (Kutyavin et al., 1996).The 2,6-diaminopurin e:thymine base pair is very stable. Thissystem has been used to create the so-called selectivity bindingcomplementary oligonucleotides (SBC) (Fig. 9). These SBC in-vade the ends of homologous duplexes and form stable three-arm junctions (Kutyavin et al., 1996). A similar approach usesthe hypoxanthine-pyr rolopyrim idinone tandem (Fig. 9). Hypo-xanthine does not form stable base pairs with pyrrolopyrimidi -none nucleosides, whereas hypoxanthine:cytid ine and pyrrolo-pyrim idinone:guanine are stable base pairs. The modified basesform one hydrogen bond when paired with each other but twohydrogen bonds when paired with the natural bases. Therefore,self-compleme ntary oligonucleotides consisting of hypoxan-thine and pyrrolopyrim idinone nucleosides are able to invadethe end of natural nucleic acids duplexes because more stablebase pairs are generated during the hybridization process (Wooet al., 1996). Complementary oligonucleotides can be selec-tively targeted in this way, increasing the number of accessiblenucleic acids structures for antisense purposes (Woo et al.,1996).

Covalent bond formation via major groove or minor groovecross-linking (Fig. 10) should theoretically improve the effec-tiveness of the antisense oligonucleotide. The introduction of asingle cross-link changes the molecularity of the duplex frombimolecular to monomolecular, and a large increase in thermalstability could be expected (Wolfe and Verdine, 1993). Experi-mentally, cross-linking has been shown to confer a large degreeof stabilization of DNA duplexes. The cross-linking approach ismore often studied in a triple-helix structure, where the incor-poration of reactive groups may lead to oxidation of the de-oxyribose backbone, electrophilic modification of the base, orhydrolysis of a phosphodiester bond. Correct orientation andgeometry of the reactive tether are critical for activity. A disul-fide cross-link was extensively explored, and a 3-carbon linkbetween the disulfide bound and the pyrimidine base moiety iswell accommodated and gives a relaxed duplex structure(Wolfe and Verdine, 1993). Cross-linking using a guanine-modified disulfide bond is efficient with a dithiobis(propane )link (Erlanson et al., 1993). Also here, the disulfide cross-linkis well accomm odated in the major groove without perturbing

the DNA structure (Ferentz et al., 1993b). With N6-derivatizedadenine bases, the dithiobis(ethane) link is optimal (Ferentz et al., 1993a). The chemical groups most often used for irre-versible inactivation of the complementar y nucleic acids are N-chloroethyl (Khalimskaya et al., 1994), haloacetyl (Colemanand Kesicki, 1995), and N4,N4-ethanocytosine (Webb and Mat-teucci, 1986a). For example, an o-phenylenediam ino tether toappend an a -bromoacetam ido function was used to cross-linkthe pyrimidine base with a guanine base via N7 alkylation(Coleman and Kesicki, 1995). The reaction is sequence depen-dent and high yielding (Coleman and Pires, 1997). The twomain problem s with this approach are the potential for aspecificalkylation and the kinetics of the cross-linking reaction. Mostly,the cross-linking formation is too slow to be used for inhibitionof mRNA function (Webb and Matteucci, 1986b).

Duplex stabilization can be obtained using substitutions onthe nucleobases that overspan the major or minor groove(clamp technique) (Fig. 11). N2-imidazolylpropy lguanine and

BASE MODIFICATIONS AND ANTISENSE ACTIVITY 303

N2-imidazolylprop yl-2-am inoadenine stabilize DNA-DNA du-plexes more than DNA-RNA duplexes (Ramasamy et al.,1994). The propylimidazole group protrudes into the minorgroove that is broader in the latter duplex than in the former. Byincorporation of deoxyguanosine tethered through the exo-cyclic nitrogen via a 3-carbon chain to the 4-position of imida-zole, the stability of duplexes with ribonucleotides is increasedand the stability of duplexes with oligodeoxynucleo tides is de-creased (Heeb and Benner, 1994). The imidazole group formsan H bond with a 2 9 -OH group of a ribonucleoside on a com-plementary strand. The guanine base forms three hydrogenbonds with the cytosine base. The guanine base, however, con-tains two unused hydrogen bond acceptors in the major grooveat O6 and N7 of the Hoogsteen binding face (Lin and Matteucci,1998). A G-clamp simultaneously recognizes both the Watson-Crick and Hoogsteen faces of a complementar y guanine withina helix. The ammonium group on the G-clamp has hydrogenbond interactions with O6 of the guanine base at the Hoogsteenface. The G-clamp binds with enhanced affinity and specificity(relative to 5-MeC) (Lin and Matteucci, 1998).

An approach that may further broaden the available targetsfor antisense oligonucleotides is targeting secondary RNAstructures. At the DNA level, the usefulness of this approach

was demonstrated using oligonucleotides conjugated with adiphenylether (Fig. 12) at the branch point of a DNA stem-flankdomain (Ali and Pedersen, 1998). By incorporating a 5-methyl-N4-(1-pyrenylmeth yl)cytosine base (Fig. 12) into an oligonu-cleotide at a location facing a three-way junction, an increase inTm of 9°C was obtained relative to the wild-type DNA. Whentargeting RNA, the results are more ambiguous. Likewise, 5-methyl-(1-pyren ylmethyl)cytosin e was inserted into the junc-tion region of an oligonucleotide targeted at a three-way junc-tion, resulting in a similar stabilization effect (Abdel-Rahm an etal., 1996). This research opens the possibility of targeting largeinternal loops with multistem junctions, as observed in humanimmunodeficiency virus (HIV) RRE.

BIOLOGY

As mentioned in the Introduction, the number of base-m odi-fied oligonucleotides that have been investigated in vivo is low.However, the existing data allow us to analyze the potential ofthis approach. Several reports on the biologic outcome of test-ing of these compounds have been published in recent years,mainly by the research group of M. Matteucci. These results

HERDEWIJN304

FIG. 9. Bases for duplex-invading oligonucleotides. SBC, selectively binding complementar y oligonucleotides.

FIG. 10. Structure of 2-thiouracil and of 4-thiouracil derivatized with a cross-linking agent.

give a clear view of the requirements of base-modified oligonu-cleotides to exert an antisense effect in a cellular system.

It is of prime importance that the antisense mechanism of ac-tion be proven when evaluating base-modified oligonucleotides,which can perform biologic activity by a nonantisense mechanismof action. Poly(1-methyl-6-thioguanylic acid), poly(1-methyl-6-thioinosinic acid), and related poly(triazolopurine nucleic acids)are potent inhibitors of HIV and human cytomegalovirus(HCMV) replication and cytopathogenicity (Broom et al., 1995;Tutonda and Broom, 1998). It is hypothesized that the ability ofthe oligomers to form a highly ordered, nonhydrogen-bonded ar-ray in solution and the amphipathic character of these moleculesare the prerequisites for antiviral activity.

A 21-mer C-5 propynyl phosphorothioate oligonucleotide(UGUUCCUUUGUCAUCAAUCAA) was targeted againsttwo human cell cycle proteins that are aberrantly expressed inbreast cancer: p34cdc2 kinase and cyclin B1 (Flanagan et al.,1996a). When cdc2 kinase is activated, cells progress into mito-sis. Disruption of p34cdc2 kinase inhibits cellular proliferation.The oligonucleotide was microinjected or delivered usingcationic lipids. The C-5 propynyl-modifi ed oligos show a dose-dependent and RNase H-dependent, sequence-specific andgene-specific inhibition of protein synthesis at nanomolar con-centrations in normal and breast cancer cells. The activity is atleast 10-fold increased compared with unmodified phospho-rothioates. The antisense inhibition of p34cdc2 kinase resulted in

a significant accumulation of cells in the Gap2/mitosis phase ofthe cell cycle in normal cells but caused little effect on cell cy-cle progression in breast cancer cells. Three and four 7-propyne-7-deaza-2 -amino-2 9 -deoxyadenosines were incorpo-rated into the phosphorothioate antisense sequence ATG CATTCT GCC CCC AAG GA targeting the 3 9 -UTR of murine C-raf mRNA (Balow et al., 1998) ( D Tm/modification 1 2°C). Thereduction of C-raf kinase mRNA levels was measured inmurine bEND cells, and lipofectin was used as transfectionagent. These oligonucleotides demonstate a 2–3-fold increasein potency over unmodified controls.

A 15-mer phosphorothioate oligonucleotide containing C-5propynyl pyrimidine bases (CUUCAUUUUUUUCUUC) to-gether with a plasm id that directs the expression of SV40 largeT antigen were microinjected or delivered with cell-permeabi-lizing agents to African green monkey kidney cells (CV1) or ratfibroblast cells (Wagner et al., 1993). The antisense target se-quence is located , 150 nt downstream of the TAg translationinitiation codon. The C-5 propynyl-substitu ted phosphoro-thioates elicit RNase H cleavage of the target mRNA. Thisoligonucleotide exhibits antisense activity at 0.1 m M. The anti-sense activity is dose dependent, sensitive to sequence mis-matches, and correlates with Tm and length of oligonucleotide.The C-5 propynyl group was also effective when oligonu-cleotides were targeted to the rev response element of the HIVenv transcript (Fenster et al., 1994).

BASE MODIFICATIONS AND ANTISENSE ACTIVITY 305

FIG. 11. Clamp techniques.

FIG. 12. Modified bases for targeting secondary structures in RNA or DNA.

Tumor necrosis factor- a (TNF- a ) is an inflamm atory media-tor that binds and activates cells through the TNF receptor typeI (TNFRI). Partial phosphorothioate oligonucleotides(AGAATTTTAGTGTATTACAA) containing five C-5 propy-nyl or C-5 hexynyl deoxyuridines were synthesized that are tar-geted to the 3 9 -UTR of the TNFRI mRNA, hybridizing at thepolyadenylation signal site (Ojwang et al., 1997). Therefore,the oligonucleotides should have no direct effect on translationof the protein. These oligonucleotides were tested in a cellularassay (human lung embryonic fibroblast and human newbornforeskin fibroblast), and they were shown to lower TNFRI pro-tein levels and TNF- a -mediated functions by reducing the lev-els of TNFRI mRNA. The reduction of mRNA level is due tomRNA destabilization either by an RNase H-dependent mecha-nism or by modulating natural processes that help to stabilizethe TNFRI mRNA (Ojwang et al., 1997). The gene-specific an-tisense inhibition effect occurred at submicromolar concentra-tions and in the presence of an uptake enhancer. Both thepyrim idine base modifications and the uptake enhancer are crit-ical for the antisense effect.

Six 5-(1-hexynyl)-sub stituted pyrimidine nucleosides wereincorporated in a mixed phosphodiester-ph osphorothioate 20-mer, targeted at the translation initiation codon of herpes sim-plex virus type 1 (HSV-1) immediate-ear ly gene, and testedagainst HSV-1 in Vero cells (Uhlmann et al., 1997). Thehexynyl-modifie d oligonucleotides are more potent (minimalinhibitory concentration [MIC] 2.5 m M) than the correspondingpropynyl-modifi ed oligonucleotides (MIC 10 m M), althoughthe binding affinity of the propynyl derivatives is higher thanthat of the hexynyl derivatives. This means that other parame-ters besides binding strength have to be involved when explain-ing the difference in activity (i.e., the endonuclease stability).

In a comparative study, several 5-substituted pyrimidineswere incorporated into a 15-mer phosphorothioate oligonu-cleotide (CUUCAUUUUUUCUUC), and their antisense activ-ity was determined by inhibition of SV40 T antigen expressionin CV1 cells (Gutierrez et al., 1997). The 5-butynyl compoundis 4 times less active than the 5-propynyl compound (IC50 0.25m M). The 5-thiazolyl and 5-dimethylthiazo lyl compounds are20 times less active than the 5-propynyl compound. The ob-served antisense activity is not directly correlated with the ther-mal stability of the oligonucleotide duplexes but correlatesmore with the RNase H susceptibility. The rate of RNA cleav-age by mammalian RNase H and the intracellular stability ap-pear to be two major determinants of the antisense potency. An11-mer C-5 propynyl phosphorothioate oligonucleotide target-ing luciferase in HeLa cells retained 66% of the potencydemonstrated by the parent 15-base compound (Flanagan et al.,1996a), whereas 1-base internal mismatch between antisenseand target reduces the potency of the antisense molecule by43%. Careful selection of accessible target RNA sites that canaccommodate the antisense oligonucleotide greatly influencesthe specificity of shorter oligonucleotides. The oligonucleotidewas delivered using cytofectin. Antisense inhibition wasdemonstrated 6 hours after delivery of the oligonucleotide tothe cells and maintained for 48 hours. The biologically activehalf-life of the C-5 propynyl oligos in tissue culture is 35 hours.Moreover, the potency of C-5 propynyl phosphorothioates isunaffected by changes in the expression level of the target RNA(Flanagan et al., 1996a). This means that a depot of the modi-

fied oligonucleotide is formed in the cells sufficient to targethigh expressed mRNA.

Short phosphorothioate all-pyrimidine oligonucleotides (7-mer and 8-mer) modified with a C-5 propynyl group are able toinhibit SV40 large T antigen expression at 0.3 m M concentra-tions when microinjected into African green monkey kidneycells (Wagner et al., 1996). The mechanism of inhibition isRNase H mediated. The specificity for antisense inhibition byshort oligonucleotides is achieved by targeting highly accessi-ble RNA regions. In this hypothesis, flanking and distal regionsof target RNA sequences are capable of exerting profound in-fluence on hybridization of complementary nucleic acids be-cause of secondary and tertiary structure interactions within theRNA (Wagner et al., 1996). However, C-5 propynyl-modifi edphosphorothioates have demonstrated in vivo liver toxicitiesthat have precluded their development as human therapeutics.(Flanagan et al., 1999b).

Incorporation of 4-phenoxazine bases (P) for C-5 propynyl-cytosine into a previously optimized C-5 propynyl pyrim idine-modified 7-mer phosphorothioate oligonucleotide(PPUpPPUpUp) targeting Tag expression shows a 5-fold in-crease in the relative binding affinity for its RNA target. RNaseH cleaved the Tag RNA opposite the phenoxazine dimers(Flanagan et al., 1999a). The enhanced cleavage is likely due tothe formation of a preferred RNase H binding, and catalytic siteopposite the phenoxazine heterocycles. Incubation of the P ? Up)phosphorothioate with a variety of tissue culture cells, in the ab-sence of any cationic lipid, revealed unaided cellular penetra-tion, nuclear accumulation, and subsequent antisense activity.The nuclear uptake decreased with increasing length of the phe-noxazine-substitu ted oligonucleotide. However, after microin-jection into CV1 cells, the 7-mer (P ? Up) phosphorothioateshowed diminished antisense potency (IC50 0.5 m M) comparedwith the fully propynyl 7-mer phosphorothioate (IC50 0.3 m M).This might be due to cellular factors that affect the oligo-RNAassociation and dissociation.

Finally, a single substitution of a G-clamp heterocycle into a15-mer phosphorothioate oligonucleotide (TGGCTCTCXT-GCGCC) targeting the cyclin-dependent kinase inhibitor,p27kip1, enhances antisense activity as compared with a C-5propynyl-modifi ed phosphorothioate (UGGCUCUC-CUGCGCC) when transfected into CV1 cells (Flanagan et al.,1999b). The G-clamp oligo shows antisense activity at thenanomolar level when microinjected. Although the C-5 propy-nyl oligo demonstrates a higher relative affinity for the sametarget RNA relative to the single substituted G-clamp oligo, thelatter oligonucleotide is a more potent antisense inhibitor. TheG-clamp oligo-RNA complex is a 3-fold better substrate forRNase H cleavage relative to the C-5 propynyl oligo-RNAcomplex. It is postulated that the G-clamp modification couldcause substantial stabilization of the oligo-RNA duplex intra-cellularly by rendering the helix a poor substrate for helicases(Flanagan et al., 1999b). A single nucleotide mismatch reducesthe potency of the G-clamp antisense molecule by 5-fold.

CONCLUSIONS

Investigations on heterocyclic-mo dified oligonucleotideshave revealed crucial factors that influence antisense activity in

HERDEWIJN306

cellular systems. Enhanced, sequence-specific binding to targetRNA and nuclease stability are important but not sufficient toobtain an increased antisense effect in comparison with unmod-ified phosphorothioates. The phosphorothioate oligonu-cleotides with highest in vitro binding affinity are not alwaysthe most potent antisense inhibitors. A correlation between an-tisense activity and Tm exists only in cases of quantitative andqualitative identical mechanism of action of the oligonu-cleotides. The length of the oligonucleotide is related to its se-lectivity. The study with propynyl pyrim idine oligonucleotideshas demonstrated that the length of the antisense molecule canbe drastically reduced (up to 7-mer) when the secondary struc-ture of a target RNA can provide potency and specificity. Thelength of the oligonucleotide, the selected target site, and theoligo modification need to be optimized to maximize activityand specificity. The most potent antisense oligonucleotides actthrough RNase H enzyme activity, and this mechanism is pre-ferred above a steric blockade of RNA processing and transla-tion. The RNase H activity is influenced not only by backboneand sugar modification but also by the base modification. Someheterocyclic modifications might stimulate RNase H. RNase Hrecognizes both flanks of a DNA-RNA hybrid. Modification ofthe carbohydrate moiety of an oligonucleotide leads to substan-tial duplex stabilization when the sugar moiety is locked in anN-type conform ation (Herdewijn, 1999). However, this struc-ture is not compatible with RNase H recognition and activation.Generally, it is accepted that RNase H activation properties canbe retained with sugar-modified oligonucleotides that increaseduplex stability only moderately ( D Tm/modification 1 2°C). Toobtain more stable duplexes that activate RNase H, base modi-fications are needed. Profound structure-activity relationshipstudies between RNase H activity and base modification mustbe done.

The cellular penetration of modified oligonucleotides can beincreased by using uptake enhancers. It is very difficult to de-tect significant antisense activity in cell culture with modifiedor unmodified phosphorotioate oligonucleotides in the absenceof cationic lipid delivery agents. However, the use of cationiclipids is limited by inefficient delivery in animal model sys-tems. Two important observations are (1) that short base-m odi-fied (phenoxazine/ 5-propynyl C) oligonucleotides can pene-trate cells in the absence of a delivery enhancer and (2) thatphosphorothioate oligonucleotides are more permeable in cer-tain animal tissues than in cell culture. Additionally, high nu-clease stability will increase the half-life of the oligonucleotidewithin the cell and allows installation of an intracellular depotof the antisense molecule. This intracellular accumulation ofmaterial is sufficient to inhibit even overexpressed genes, suchas those found in cancers.

Fulfillment of all these requirements, however, does notmean that the modified oligonucleotide will possess potent anti-sense activity per se. The modified base may be a reason for in-terference with other, at present, unknown cellular factors thatinfluence antisense activity. The modification might influencethe intracellular distribution so that the oligo will not reach itstarget RNA in sufficient amounts. Little is known about the in-volvement of other cellular enzymes, such as helicases, in themode of action of the modified oligonucleotide. A last concernis the potential toxicity in vivo and the manufacturing costs ofthe heterocyclic-m odified antisense molecule. It is clear that

there are some remaining hurdles before this approach finds itsway to the clinic.

ACKNOWLEDGMENTS

I thank Chantal Biernaux for excellent editorial help andK.U. Leuven (GOA 9/4) for financial support of this research.

REFERENCES

ABDEL-RAHMAN, A.A.-H., ALI, O.M., and PEDERSEN, E.B.(1996). Insertion of 5-methyl-N4-(1-pyrenylmeth yl)cytidine intoDNA. Duplex, three-way junction and triplex stabilities. Tetrahedron52, 15311–15324.

ALI, O.M., and PEDERSON, E.B. (1998). Targeting of nucleic acidjunctions: Addressing to a branch point an oligodeoxynucleoti deconjugated with an intercalator. Nucleic Acids Res. 26, 4919–4924.

ALLERSON, C.R., CHEN, S.L., and VERDINE, G.L. (1997). A chem-ical method for site-specific modification of RNA: The convertiblenucleoside approach. J. Am. Chem. Soc. 119, 7423–7433.

BAILLY, C., and WARING, M.J. (1998). The use of diaminopurine toinvestigate structural properties of nucleic acids and molecularrecognition between ligands and DNA. Nucleic Acids Res. 26,4309–4314.

BALOW, G., MOHAN, V., LESNIK, E.A., JOHNSTON, J.F., MO-NIA, B.P., and ACEVEDO, O.L. (1998). Biophysical and antisenseproperties of oligodeoxynucleoti des containing 7-propynyl-, 7-iodo-and 7-cyano-7-dea za-2-amino-2 9 -deoxyadenosines . Nucleic AcidsRes.26, 3350–3357.

BARAWKAR, D.A., KUMAR, V.A., and GANESH, K.N. (1994).Triplex formation at physiological pH by oligonucleotides incorpo-rating 5-Me-dC-N4-spermine). Biochem. Biophys. Res. Commun.205, 1665–1670.

BISCHOFBERGER, N., and MATTEUCI, M.D. (1989). Synthesis ofnovel polycyclic nucleoside analogues, incorporation intooligodeoxynucleoti des, and interaction with complementary se-quences. J. Am. Chem. Soc. 111, 3041–3046.

BOUDOU, V., KERREMANS, L., DE BOUVERE, B., LESCRINIER,E., SCHEPERS, G., BUSSON, R., VAN AERSCHOT, A., andHERDEWIJN, P. (1999). Base pairing of anhydrohexitol nucleo-sides with 2,6-diaminopurin e, 5-methylcytosine and uracil as basemoiety. Nucleic Acids Res. 27, 1450–1456.

BROOM, A.D., AGRAWAL, V.K., TUTONDA, M.G., FAIN, H.D.,and BUCKHEIT, R.W., Jr. (1995). Unusual single-stranded polyri-bonucleotides as potent anti-HIV agents. J. Med. Chem. 38,3253–3257.

BUHR, C.A., MATTEUCCI, M.D., and FROEHLER, B.C. (1999).Synthesis of a tetracyclic 2 9 -deoxyadenosine analog. TetrahedronLett. 40, 8969–8970.

BUHR, C.A., WAGNER, R.W., GRANT, D., and FROEHLER, B.C.(1996). Oligodeoxynucle otides containing C-7 propyne analogs of 7-deaza-2 9 -deoxyguanosine and 7-deaza-2 9 -deoxyadenosine . NucleicAcids Res. 24, 2974–2980.

BUTKUS, V., KLIMASAUSKAS, S., PETRAUSKIENE, L.,MANELIENE, Z., JANULAITIS, A., MISCHENKOVA, E.L., andSCHYOLKINA, A.K. (1987). Synthesis and physical characteriza-tion of DNA fragments containing N4-methylcyto sine and 5-methyl-cytosine. Nucleic Acids Res. 15, 8467–8478.

CHAZIN, W.J., RANCE, M., CHOLLET, A., and LEUPIN, W. (1991).Comparative NMR analysis of the decadeoxynucleot ide D-(GCAT-TAATGC)2 and an analogue containing 2-aminoadenine . NucleicAcids Res. 19, 5507–5513.

BASE MODIFICATIONS AND ANTISENSE ACTIVITY 307

CHOLLET, A., CHOLLET-DAMERIUS, A., and KAWASHIMA,E.H. (1986). Synthesis of oligodeoxyribonuc leotides containing thebase 2- aminoadenine. Chem. Scripta 26, 37–40.

CHOLLET, A., and KAWASHIMA, E. (1988). DNA containing thebase analogue 2-aminoadenine: Preparation, use as hybridizationprobes and cleavage by restriction endonucleases. Nucleic AcidsRes. 16, 305–317.

COLEMAN, R.S., and KESICKI, E.A. (1995). Template-direc tedcross-linking of oligonucleotides: Site-specific covalent modificationof dG-N7 within duplex DNA. J. Org. Chem. 60, 6252–6253.

COLEMAN, R.S., and PIRES, R.M. (1997). Covalent cross-linking ofduplex DNA using 4-thio-2 9 -deoxyuridine as a readily modifiableplatform for introduction of reactive functionality into oligonu-cleotides. Nucleic Acids Res. 25, 4771–4777.

COLL, M., WANG, A.H., VAN DER MAREL, G.A., VAN BOOM,J.H., and RICH, A.J. (1986). Crystal structure of a Z-DNA fragmentcontaining thymine/2-aminoadenine base pairs. J. Biomol. Struct.Dyn. 4, 157–172.

CONNOLLY, B.A., and NEWMAN, P.C. (1989). Synthesis and prop-erties of oligonucleotides containing 4-thiothymidine, 5-methyl-2-pyrimidinone-1 -b-D(29 -deoxyriboside) and 2-thiothymidine. NucleicAcids Res. 17, 4957–4974.

DAHLÉN, P., LIUKKONEN, L., KWIATKOWSKI, M.,HURSKAINEN, P., IITIÄ, A., SIITARI, H., YLIKOWSKI, J.,MUKKALA, V.-M., and LÖVGREN, T. (1994). Europium-labe ledoligonucleotide hybridization probes: Preparation and properties.Bioconj. Chem. 5, 268–272.

EHRLICH, M., EHRLICH, K., and MAYO, J.A. (1975). Unusual prop-erties of the DNA from Xanthomonas phage XP-12 in which 5-methylcytosine completely replaces cytosine. Biochim. Biophys.Acta 395, 109–119.

ERLANSON, D.A., CHEN, L., and VERDINE, G.L. (1993). DNAmethylation through a locally unpaired intermediate. J. Am. Chem.Soc. 115, 12583– 12584.

FENSTER, S.D., WAGNER, R.W., FROEHLER, B.C., and CHIN,D.J. (1994). Inhibition of human immunodeficien cy virus type-1 envexpression by C-5 propyne oligonucleotides specific for Rev-re-sponse element stem-loop V. Biochemistry 33, 8391–8398.

FERENTZ, A.E., KEATING, T.A., and VERDINE, G.L. (1993a). Syn-thesis and characterization of disulfide cross-linked oligonucleotides.J. Am. Chem. Soc. 115, 9006–9014.

FERENTZ, A.E., WIORKIEWICZ-KUCZERA, J., KARPLUL, M., andVERDINE, G.L., (1993b). Molecular dynamics simulations of disul-fide cross-linked DNA decamers. J. Am. Chem. Soc. 115, 7569–7583.

FLANAGAN, W.M., KOTHAVALE, A., and WAGNER, R.W.(1996a). Effects of oligonucleotide length, mismatches and mRNAlevels on C-5 propyne-modif ied antisense potency. Nucleic AcidsRes. 24, 2936–2941.

FLANAGAN, W.M., SU, L.L., and WAGNER, R.W. (1996b). Eluci-dation of gene function using C-5 propyne antisense oligonu-cleotides. Nat. Biotechnol. 14, 1139–1145.

FLANAGAN, W.M., WAGNER, R.W., GRANT, D., LIN, K.Y., andMATTEUCCI, M.D. (1999a). Cellular penetration and antisense ac-tivity by a phenoxazine-sub stituted heptanucleotide. Nat. Biotechnol.17, 48–52.

FLANAGAN, W.M., WOLF, J.J., OLSON, P., GRANT, D., LIN,K.Y., WAGNER, R.W., and MATTEUCCI, M.D. (1999b). A cyto-sine analog that confers enhanced potency to antisense oligonu-cleotides. Proc. Natl. Acad. Sci. USA 96, 3513–3518.

FROEHLER, B.C., WADWANI, S., TERHORST, T.J., and GER-RARD, S.R. (1992). Oligodeoxynucleo tides containing C-5 propyneanalogs of 2 9 -deoxyuridine and 2 9 -deoxycytidine. Tetrahedron Lett.33, 5307–5310.

GOWERS, D.M., and FOX, K.R. (1999). Towards mixed sequencerecognition by triple helix formation. Nucleic Acids Res. 27,1569–1577.

GREIN, T., LAMPE, S., MERSMANN, K., ROSEMEYER, H.,THOMAS, H., and SEELA, F. (1994). 3-Deaza- and 7-deazapurines :Duplex stability of oligonucleotides containing modified adenine orguanine bases. Bioorg. Med. Chem. Lett. 4, 971–976.

GRYAZNOV, S., and SCHULTZ, R.G. (1994). Stabilization ofDNA:DNA and DNA:RNA duplexes by substitution of 2 9 -de-oxyadenosine with 2 9 -deoxy-2-aminoadenosine. Tetrahedron Lett.35, 2489–2492.

GUTIERREZ, A.J., and FROEHLER, B.C. (1996). RNA duplex for-mation by oligodeoxynucleotid es containing C-5 alkyne and C-5 thi-azole substituted deoxyuridine analogs. Tetrahedron Lett. 37,3959–3962.

GUTIERREZ, A.J., MATTEUCCI, M.D., GRANT, D., MAT-SUMURA, S., WAGNER, R.W., and FROEHLER, B.C. (1997). An-tisense gene inhibition by C-5-substituted deoxyuridine-co ntainingoligodeoxynucleoti des. Biochemistry 36, 743–748.

GUTIERREZ, A.J., TERHORST, T.J., MATTEUCI, M.D., andFROEHLER, B.C. (1994). 5-Heteroaryl-2 9 -deoxyuridine analogs.Synthesis and incorporation into high-affinity oligonucleotides. J.Am. Chem. Soc. 116, 5540–5544.

HAGINOYA, N., ONO, A., NOMURA, Y., UENO, Y., and MAT-SUDA, A. (1997). Nucleosides and nucleotides. Synthesis ofoligodeoxyribonuc leotides containing 5-(N-aminoalkyl)carbamoy l-2 9 -deoxyuridines by new postsynthetic nuclease-resis tance proper-ties. Bioconj. Chem. 8, 271–280.

HASHIMOTO, H., NELSON, M.G., and SWITZER, C. (1993). Zwit-terionic DNA. J. Am. Chem. Soc. 115, 7128–7134.

HAYAKAWA, T., ONO, A., and UEDA, T. (1988). Effects of basesubstituents on the hydration of B- and Z-DNA: Correlations to theB- to Z-DNA transition. Nucleic Acids Res. 16, 4761–4776.

HEEB, N.V., and BENNER, S.A. (1994). Guanosine derivatives bear-ing an N2-3-imidazolepropionic acid. Tetrahedron Lett. 35,3045–3048.

HERDEWIJN, P. (1990). Conformational ly restricted carbohydrate-modified nucleic acids and antisense technology. Biochim. Biophys.Acta 1489, 167–179.

HEYSTECK, L.E., and GOLD, B. (1998). Control over the localizationof positive charge in DNA: The effect on duplex DNA and RNA sta-bility. J. Am. Chem. Soc. 120, 12165–12166.

HOWARD, F.B., CHEN, C.W., COHEN, J.S., and MILES, H.T.(1984). Poly(d2NH 2A-dT): effect of 2-amino substituent on the B toZ transition. Biochem. Biophys. Res. Commun. 118, 848–853.

INOUE, H., IMURA, A., and OHTSUKA, E. (1985). Synthesis and hy-bridization of dodecadeoxyribo nucleotides containing a fluorescentpyridopyrimidin e deoxynucleoside. Nucleic Acids Res. 13,7119–7128.

KAGAWA, T.F., HOWELL, M.L., TSENG, K., and HO, P.S. (1993).Effects of base substituents on the hydration of B- and Z-DNA: Cor-relations to the B- to Z-DNA transition. Nucleic Acids Res. 21,5978–5986.

KHALIMSKAYA, L.M., LEVINA, A.S., and ZARYTOVA, V.F.(1994). Sequence-spec ific modification of DNA fragments byoligonucleotide derivatives containing alkylating groups at the C5position of deoxyuridine. Bioorg. Med. Chem. Lett. 4, 1083–1088.

KHUDYAKOV, I.Y., KIRNOS, M.D., ALEXANDRUSHKINA, N.I.,and VANYUSHIN, B.F. (1978). Cyanophage S-2L contains DNAwith 2,6-diaminopurin e substituted for adenine. Virology 88, 8–18.

KIRNOS, M.D., KHUDYAKOV, I.Y., ALEXANDRUSHKINA, N.I.,and VANYUSHIN, B.F. (1977). 2-Aminoadenin e is an adenine sub-stituting for a base in S-2L cyanophage DNA. Nature 270, 369–370.

KREMER, A.B., MIKITA, A., and BEARDSLEY, G.P. (1987). Chem-ical consequences of incorporation of 5-fluorouracil into DNA asstudied by NMR. Biochemistry 26, 391–397.

KUIMELIS, R.G., and NAMBIAR, K.P. (1994). Synthesis ofoligodeoxynucleoti des containing 2-thiopyrimidine residues—Anew protection scheme. Nucleic Acids Res. 22, 1429–1436.

HERDEWIJN308

KURCHAVOV, N.A., and SVERDLOV, E.D. (1997). A new phospho-ramidite reagent for the incorporation of diazephenoxazino ne nucle-oside with enhanced base-pairing properties into oligodeoxynu-cleotides. Nucleosides Nucleotides 16, 1837–1846.

KUTYAVIN, I.V., RHINEHART, R.L., LUKHTANOV, E.A., GORN,V.V., MEYER, R.B., Jr., and GAMPER, H.B., Jr. (1996). Oligonu-cleotides containing 2-aminoadenine and 2-thiothymine act as selec-tively binding complementary agents. Biochemistry 35, 11170–11176.

LIN, K.-Y., JONES, R.J., and MATTEUCCI, M. (1995). Tricyclic 2 9 -deoxycytidine analogs: Syntheses and incorporation intooligodeoxynucleoti des which have enhanced binding to complemen-tary RNA. J. Am. Chem. Soc. 117, 3873–3874.

LIN, K.-Y., and MATTEUCCI, M.D. (1998). A cytosine analogue ca-pable of clamp-like binding to a guanine in helical nucleic acids. J.Am. Chem. Soc. 120, 8531–8532.

LUYTEN, I., and HERDEWIJN, P. (1998). Hybridization properties ofbase-modified oligonucleotides within the double and triple helixmotif. Eur. J. Med. Chem. 33, 515–578.

MACMILLAN, A.M., and VERDINE, G.L. (1990). Synthesis of func-tionally tethered oligodeoxynucleotid es by the convertible nucleo-side approach. J. Org. Chem. 55, 5931–5933.

MACMILLAN, A.M., and VERDINE, G.L. (1991). Engineering teth-ered DNA molecules by the convertible nucleoside approach. Tetra-hedron 47, 2603–2616.

MATTEUCCI, M.D., and VON KROSIGK, U. (1996). Hybridizationproperties of oligonucleotides bearing a tricyclic 2 9 -deoxycytidineanalog based on a carbazole ring system. Tetrahedron Lett. 37,5057–5060.

MEISENHEIMER, K.M., MEISENHEIMER, P.L., WILLIS, M.C.,and KOCH, T.H. (1996). High yield photocrosslinking of a 5-iodocytidine (IC) substituted RNA to its associated protein. NucleicAcids Res. 24, 981–982.

MONIA, B.P., JOHNSTON, J.F., and FREIER, S.M. (1992). Selectiveinhibition of mutant ha-ras mRNA expression by antisense oligonu-cleotides. J. Biol. Chem. 267, 19954– 19962.

MURAOKA, M., IIDA, A., TAKAHASHI, S., EBATA, T., and UE-SUGI, S. (1991). Synthesis and properties of 2 9 -5 9 - and 3 9 -5 9 -linkedribondinucleoside monophosphates containing 2-amino-adenos ineand uridine. Nucleosides Nucleotides 10, 1317–1332.

NEWMAN, P.C., NWOSU, V.U., WILLIAMS, D.M., COSSTICK, R.,SEELA, F., and CONNOLLY, B.A. (1990). Incorporation of a com-plete set of deoxyadenosine and thymidine analogues suitable for thestudy of protein nucleic acid interactions into oligodeoxynucleotid es.Applications to the EcoRV restriction endonuclease and modifica-tion methylase. Biochemistry 29, 9891–9901.

OJWANG, J.O., MUSTAIN, S.D., MARSHALL, H.B., RAO, T.S.,CHAUDHARY, N., WALKER, D.A., HOGAN, M.E., AKIYAMA,T., REVANKAR, G.R., PEYMAN, A., UHLMANN, E., andRANDO, R.F. (1997). Modified antisense oligonucleotides directedagainst tumor necrosis factor receptor type I inhibit tumor necrosisfactor alpha-mediated functions. Biochemistry 36, 6033–6045.

ONO, A., HAGINOYA, N., KIYOKAWA, M., MINAKAWA, N., andMATSUDA, A., (1994). Nucleosides and nucleotides. 127. A noveland convenient postsynthetic modification method for the synthesisof oligodeoxyribonuc leotides carrying amino linkers at the 5-posi-tion of 2 9 -deoxyuridine. Bioorg. Med. Chem. Lett. 4, 361–366.

ONO, A., OHTANI, Y., SATO, M., and UEDA, T. (1983).Oligodeoxynucle otides containing 7-deazaadenine : Synthesis andrecognition by restriction endonucleases. Nucleic Acids Res. 12,67–70.

ONO, A., SATO, M., OHTANI, Y., and UEDA, T. (1984). Synthesis ofdeoxyoligonucleoti des containing 7-deazaadenine: Recognition andcleavage by restriction endonuclease Bgl II and Sau 3AI (nucleosidesand nucleotides, Part 55). Nucleic Acids Res. 12, 8939–8949.

ÖTVÖS, L., SAGI, J., SAGI, G., and SZEMZO, A. (1999). Base modi-

fied oligodeoxynucleotid es. II. Increase of stability to nucleases by5-alkyl-, 5-(1-alkenyl)- and 5-(1-alkynyl)-p yrimidines. NucleosidesNucleotides 18, 1929–1933.

OZAKI, H., OGAWA, Y., MINE, M., and SAWAI, H. (1998). Effectof acridine with various linker arms attached to C5 position of 2 9 -de-oxyuridine on the stability of DNA/DNA and DNA/RNA duplexes.Nucleosides Nucleotides 17, 911–923.

PRAKASH, T.P., BARAWKAR, D.A., KUMAR, V.A., andGANESH, K.N. (1994). Synthesis of site-specific oligonucleotide-polyamine conjugates. Bioorg. Med. Chem. Lett. 4, 1733–1738.

RAMASAMY, K.S., ZOUNES, M., GONZALEZ, C., FREIER, S.M.,LESNIK, E.A., CUMMINS, L.L., GRIFFEY, R.H., MONIA, B.P.,and COOK, P.D. (1994). Remarkable enhancement of binding affin-ity of heterocycle-m odified DNA to DNA and RNA. Synthesis, char-acterization and biophysical evaluation of N2-imidazoly lpropylgua-nine and N2-imidazolyl propyl-2-amino adenine modifiedoligonucleotides. Tetrahedron Lett. 35, 315–218.

RAMZAEVA, N., and SEELA, F. (1996). Duplex stability of 7-deaza-purine DNA: Oligonucleotides containing 7-bromo- or 7-iodo-7-deazaguanin. Helv. Chim. Acta 9, 1549–1558.

REN, R.X.-F., CHAUDHURI, N.C., PARIS, P.L., RUMNEY, S.I.V.,and KOOL, E.T. (1996). Naphthalene, phenanthrene, and pyrene asDNA base analogues: Synthesis, structure, and fluorescence in DNA.J. Am. Chem. Soc. 118, 7671–7678.

RICHARDSON, F.C., BOUCHERON, J.A., SKOPEK, T.R., andSWENBERG, J.A., (1989). Formation of O6-methyldeoxygua nosineat specific sites in a synthetic oligonucleotide designed to resemble aknown mutagenic hotspot. J. Biol. Chem. 264, 838–841.

RÖSLER, A., and PFLEIDERER, W. (1997). Nucleotides .54. Synthe-sis of condensed N-1-(2 9 -deoxy-beta- D-ribofuranosyl )lumazines newfluorescent building blocks in oligonucleotide synthesis. Helv. Chim.Acta 80, 1869–1881.

SAGI, J., SZABOLCS, A., SZEMZÖ, A., and ÖTVÖS, L. (1986).Modified polynucleotides. VII. Impaired integrity of a syntheticDNA containing the antiherpetic agent 5-isopropyl-2 9 -deoxyuridine.Nucleic Acids Res. 14, 3449–3462.

SCHMID, N., and BEHR, J.-P. (1995). Recognition of DNA sequencesby strand replacement with polyamino-oligon ucleotides. Tetra-hedron Lett. 36, 1447–1450.

SCHNEIDER, B., GINELL, S.L., JONES, R., GAFFNEY, B., andBERMAN, H.M. (1992). Crystal and molecular structure of a DNAfragment containing a 2-aminoadenine modification: The relation-ship between conformation, packing, and hydration in Z-DNA hexa-mers. Biochemistry 31, 9622–9628.

SEELA, F., BERG, H., and ROSEMEYER, H. (1989). Bending ofoligonucleotides containing an isosteric nucleobase: 7-deaza-2 9 -de-oxyadenosine replacing dA within d(A)6 tracts. Biochemistry 28,6193–6198.

SEELA, F., and CHEN, Y. (1997). Methylated DNA: The influence of7-deaza-7-methylguanine on the structure and stability of oligonu-cleotides. Helv. Chim. Acta 80, 1073–1086.

SEELA, F., and DRILLER, H. (1985). Solid-phase synthesis of theself-complementary hexamer d(c7GpCpc7G pCpc7GpC) via the O-3 9 -phosphoramid ite of 7-deaza-2 9 -deoxyguanosine . Nucleic AcidsRes. 13, 911–926.

SEELA, F., and DRILLER, H. (1986). Palindromic oligonucleotidescontaining 7-deaza-2 9 -deoxyguanosine : solid-phase synthesis ofd[(p)GG*AATTCC] octamers and recognition by the endodeoxyri-bonuclease EcoRI. Nucleic Acids Res. 14, 2319–2332.

SEELA, F., and KEHNE, A. (1985). Oligomers with alternating thymi-dine and 2 9 -deoxytubercidin: Duplex stabilization by a 7-deaza-purine base. Biochemistry 24, 7556–7561.

SEELA, F., RAMZAEVA, N., and CHEN, Y.M. (1995). Oligonu-cleotide duplex stability controlled by the 7-substituents of 7-deaza-guanine bases. Bioorg. Med. Chem. Lett. 5, 3049–3052.

SEELA, F., and THOMAS, H. (1995). Duplex stabilization of DNA:

BASE MODIFICATIONS AND ANTISENSE ACTIVITY 309

Oligonucleotides containing 7-substituted 7-deazaadenines . Helv.Chim. Acta 78, 94–108.

SEELA, F., and ZULAUF, M. (1999a). Synthesis of oligonucleotidescontaining pyrazolo[3,4- d]-pyrimidines: The influence of 7-substi-tuted 8-aza-7-deazaadenines on the duplex structure and stability. J.Chem. Soc. Perkin 1, 479–488.

SEELA, F., and ZULAUF, M. (1999b). Oligonucleotides containing 7-deazaadenines: The influence of the 7-substituent chain length andcharge on the duplex stability. Helv. Chim. Acta 82, 1878–1898.

SPROAT, B.S., IRIBARREN, A.M., GARCIA, R.G., and BEIJER, B.(1991). New synthetic routes to synthons suitable for 2-O-allylolig-oribonucleotide assembly. Nucleic Acids Res. 19, 733–738.

SUGIYAMA, H., TSUTSUMI, Y., and SAITO, I. (1990). Highly se-quence-selectiv e photoreaction of 5-bromouraci l containing deoxy-hexanycleotides. J. Am. Chem. Soc. 112, 6720–6721.

TANAKA, T., RAMATSUKURI, S., and IKEHARA, M. (1986). Syn-thesis and properties of phosphoramidite derivatives of modified nu-cleosides. Chem. Pharm. Bull. 34, 2044–2048.

TUTONDA, M.G., and BROOM, A.D. (1998). Antiviral oligo- andpolyribonucleotide s containing selected triazolo[2,3- a ]purines. J.Med. Chem. 41, 4958–4964.

UENO, Y., KUMAGAI, I., HAGINOYA, N., and MATSUDA, A.(1997). Effects of 5-(N-aminohexyl-carbamoy l-2 9 -deoxyuridine onendonuclease stability and the ability of oligodeoxynucleot ide to ac-tivate RNase H. Nucleic Acids Res. 25, 3777–3782.

UENO, Y., MIKAWA, M., and MATSUDA, A. (1998) Nucleosidesand nucleotides. 170. Synthesis and properties of oligodeoxynu-cleotides containing 5-[N-[2-[N,N-bis(2-aminoethyl)-amino ]ethyl]carbamoyl]-2 9 -deoxyuridine and 5-[N-[3-[N,N-bis(3-amino-propyl)amino]propyl] carbamoyl]-2 9 -deoxyuridine. Bioconj. Chem. 9,33–39.

UESUGI, S., MIYASHIRO, H., TOMITA, K.-I., and IKEHARA, M.(1986). Synthesis and properties of D(ATACGCGTAT) and its de-rivatives containing one and two 5-methylcytosin e residues effect ofthe methylation on deoxyribonucleic acid conformation. Chem.Pharm. Bull. 34, 51–60.

UHLMANN, E., HORNUNG, L., HEIN, S., AUGUSTIN, S., PEY-MAN, A., WILL, D.W., HELSBERG, M., SAGI, J., ÖTVOS, L.,OJWANG, J.O., MUSTAIN, S., and RANDO, R.F. (1997). En-

hanced biological activity of antisense oligonucleotides containing 5-(1-hexynyl)-substituted pyrimidine nucleotides. Nucleosides Nu-cleotides 16, 1717–1720.

VORLÍCKOVÁ, M., SÁGI, J., SZABOLCS, A., SZEMCÖ, A.,ÖTVÖS, L., and HYPR, J. (1988). Conformation of the syntheticDNA poly (amino dA-dT) duplex in high-salt and aqueous alcoholsolutions. Nucleic Acids Res. 16, 279–289.

WAGNER, R.W., MATTEUCCI, M.D., GRANT, D., HUANG, T., andFROEHLER, B.C. (1996). Potent and selective inhibition of gene ex-pression by an antisense heptanucleotide. Nat. Biotechnol. 14,840–844.

WAGNER, R.W., MATTEUCCI, M.D., LEWIS, J.G., GUTIERREZ,A.J., MOULDS, C., and FROEHLER, B.C. (1993). Antisense geneinhibition by oligonucleotides containing C-5 propyne pyrimidines.Science 260, 1510–1513.

WEBB, T.R., and MATTEUCCI, M.D. (1986a). Sequence-spec ificcross-linking of deoxyoligonucleotid es via hybridization-trig geredalkylation. J. Am. Chem. Soc. 108, 2764–1765.

WEBB, T.R., and MATTEUCCI, M.D. (1986b). Hybridization trig-gered cross-linking of deoxyoligonucleotid es. Nucleic Acids Res.14, 7661–7674.

WOLFE, S.A., and VERDINE, G.L. (1993). Ratcheting torsional stressin duplex DNA. J. Am. Chem. Soc. 115, 12585–12586.

WOO, J., MEYER, R.B., and GAMPER, H.B. (1996). G/C-modifiedoligodeoxynucleoti des with selective complementar ity: Synthesisand hybridization properties. Nucleic Acids Res. 24, 2470–2475.

Address reprint requests to:Prof. Dr. Piet Herdewijn

Laboratorium Voor Medicinale ChemieRega Instituut

Minderbroedsstraat 10B-3000 Leuwen

Belgium

Received March 28, 2000; accepted in revised form May 9,2000.

HERDEWIJN310