alpha-synuclein antisense oligonucleotides as a disease ... · the approach through...
TRANSCRIPT
Alpha-synuclein antisense oligonucleotides as a disease-modifying therapy for
Parkinson’s disease
Tracy A. Cole1*, Hien Zhao1, Timothy J. Collier2, Ivette Sandoval2, Caryl E. Sortwell2, Kathy
Steece-Collier2, Brian F. Daley2, Alix Booms2, Jack Lipton2, Mackenzie Welch3, Melissa
Berman3, Luke Jandreski3, Danielle Graham3, Andreas Weihofen3, Stephanie Celano2, Emily
Schulz2, Allyson Cole-Strauss2, Esteban Luna4, Duc Quach1, Apoorva Mohan1, C. Frank
Bennett1, Eric E. Swayze1, Holly B. Kordasiewicz1, Kelvin C. Luk4, Katrina L. Paumier2
1Ionis Pharmaceuticals, Inc., Carlsbad, California, USA.
2Michigan State University, Grand Rapids, Michigan, USA.
3Biogen, Cambridge, Massachusetts, USA.
4Department of Pathology and Laboratory Medicine, University of Pennsylvania Perelman
School of Medicine, Philadelphia, Pennsylvania, USA.
*Correspondence should be addressed to T.A.C. Ionis Pharmaceuticals, 2855 Gazelle Court,
Carlsbad CA 92008, USA. Email: [email protected]. Phone: 760-603-3806
Summary
Antisense oligonucleotides designed against SNCA, which are progressing to the clinic, have the
potential to be a disease modifying therapeutic for Parkinson’s disease patients.
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
2
Abstract
Parkinson’s disease (PD) is a prevalent neurodegenerative disease with no approved disease-
modifying therapies. Multiplications, mutations, and single nucleotide polymorphisms in the
SNCA gene, encoding alpha-synuclein protein (aSyn), either cause or increase risk for PD.
Intracellular accumulations of aSyn are pathological hallmarks of PD. Taken together, reduction
of aSyn production may provide a disease-modifying therapy for PD. We show that antisense
oligonucleotides (ASOs) reduce production of aSyn in rodent pre-formed fibril (PFF) models of
PD. Reduced aSyn production leads to prevention and removal of established aSyn pathology
and prevents dopaminergic cell dysfunction. In addition, we address the translational potential of
the approach through characterization of human SNCA targeting ASOs that efficiently suppress
the human SNCA transcript in vivo. We demonstrate broad activity and distribution of the human
SNCA ASOs throughout the non-human primate brain and a corresponding decrease in aSyn
cerebral spinal fluid (CSF) levels. Taken together, these data suggest that by inhibiting
production of aSyn it may be possible to reverse established pathology and thus supports the
development of SNCA ASOs as a potentially disease modifying therapy for PD and related
synucleinopathies.
Introduction
There is strong genetic evidence implicating the role of aSyn (alpha-synuclein protein) in the
pathogenesis of Parkinson’s disease (PD) (Chartier-Harlin et al., 2004; Devine et al., 2011;
Farrer et al., 2004; Fuchs et al., 2007; Fuchs et al., 2008; Ibanez et al., 2009; Kruger et al., 1998;
Mata et al., 2010; Mutez et al., 2011; Ross et al., 2008; Satake et al., 2009; Simon-Sanchez et al.,
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
3
2009; Singleton et al., 2003; Soldner et al., 2016; Spillantini et al., 1997). Intracellular aSyn
aggregates are a pathological hallmark of PD that increase in number and spread through the
brain as symptoms worsen in PD patients (Goedert, 2015; Goedert et al., 2013). Duplication,
triplication or genetic mutations in the SNCA gene (produces aSyn protein) (A53T, A30P, E46K,
G51D, etc.) are linked to autosomal dominant forms of the disease (Chartier-Harlin et al., 2004;
Farrer et al., 2004; Fuchs et al., 2007; Miller et al., 2004; Ross et al., 2008; Singleton et al.,
2003). Moreover, polymorphisms that occur within specific regions of the SNCA gene increase
the overall risk of PD by either increasing the production or slowing the clearance of aSyn
(Cronin et al., 2009; Fuchs et al., 2008; Mata et al., 2010; Nalls et al., 2014; Simon-Sanchez et
al., 2009; Soldner et al., 2016). A toxic gain of function of aSyn is also established in other
synucleinopathies including multiple systems atrophy (MSA) (Spillantini et al., 1998), Diffuse
Lewy body disease (DLBD) (Nishioka et al., 2010), and Gaucher disease (GD) (Aflaki et al.,
2017), which collectively affects about 1% of people over 60 years of age. Clinically diagnosed
Dementia with Lewy bodies (DLB) (Spillantini et al., 1998) and pure autonomic failure (PAF)
(Arai et al., 2000; Isonaka et al., 2017) also exhibit Lewy pathology, suggesting a toxic gain of
function of aSyn in DLB and PAF.
To date, there are multiple therapeutic strategies being investigated, including antibodies
and small molecule approaches targeting different forms and conformational states of aSyn,
however, the toxic species of aSyn has not yet been confirmed, potentially limiting therapeutic
benefit of these approaches (Dehay et al., 2015; Kingwell, 2017). In addition, antibodies and
small molecules often only target extracellular pools of the protein. However, antisense
oligonucleotide (ASO) therapy can potentially overcome the limitations of these approaches
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
4
since they inhibit the production of aSyn by targeting RNA intracellularly, thereby reducing all
forms of the aSyn protein (Bennett and Swayze, 2010).
To determine the efficacy of ASOs in synucleiopathies, we use rat and mouse aSyn pre-
formed fibril (PFF) transmission models, which replicate aspects of human PD progression
including seeding and aggregate deposition of endogenous aSyn, reduced striatal dopamine,
dopaminergic cell dysfunction (tyrosine hydroxylase (TH) loss) in the substantia nigra, and
motor dysfunction (Luk et al., 2012; Paumier et al., 2015). We hypothesize that these
pathological changes can be prevented or reversed by inhibiting the production of aSyn using
ASOs targeted to the Snca gene. Though aSyn pathology has been shown to be reversible with
complete genetic ablation in adult mice in overexpression and toxin models (Hayashita-Kinoh et
al., 2006; Lim et al., 2011; Masliah et al., 2005; Tran et al., 2014; Uehara et al., 2019; Zharikov
et al., 2015) and with suppression in cells (Luna et al., 2018), we aimed to determine if partial
transient and/or sustained suppression of endogenous aSyn with a therapeutically relevant
approach in vivo could lead to reversal of established pathology and prevention of TH loss. We
also aimed to improve cellular function, of which some aspects have been shown to be
dysfunctional in iPSC-derived PD patient neurons, PD patient tissue, as well as in animal models
of PD (Di Maio et al., 2016; Ludtmann et al., 2018; Martin et al., 2006; Muller et al., 2013;
Tapias et al., 2017). Remarkably, we found a robust clearance of aSyn pathology when
production of aSyn is inhibited, which results in improvement in cell function as measured by
double strand DNA breaks. With human SNCA targeting ASOs, we demonstrate widespread
target engagement in the brain of transgenic mice expressing human SNCA and in all of the PD
relevant brain regions in NHPs, thus demonstrating the therapeutic potential of ASOs for PD and
other synucleinopathies.
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
5
Results
Reduction of Snca improves cellular function in cells and prevents pathogenic aSyn
aggregate deposition in an in vivo PFF model of PD
Two 2’-O-methoxyethyl/DNA gapmer ASOs targeting Snca were used for in vitro and in vivo
experimentation in addition to a control ASO (Table 1A). In previous work, ASO suppression of
Snca in a primary cortical culture PFF system inhibited Snca mRNA and reversed pSer129+
pathology and cellular dysfunction (Luna et al., 2018). To examine the capability of ASOs to
improve cellular function we utilized this same ASO (ASO1) and system. As cellular function is
impaired in PD we sought to characterize DNA double strand breaks, an increase in which
indicates dysfunctional DNA repair, to determine whether a Snca ASO could mitigate
dysfunction. As expected, application of PFFs resulted in production of pSer129+ aggregates in
primary mouse cortical cultures and this led to double strand breaks (γH2AX Ser139) (Fig. 1A
and B). Remarkably, pSer129+ pathology was prevented and double strand breaks (γH2AX
Ser139) were normalized to control levels with application of Snca ASO1, but not a control ASO
(Fig. 1A and B).
To further extend this work, we assessed Snca ASOs in a rodent model of PD. Rodent
aSyn PFF intrastriatal injection models result in accumulation of phospho-S129 (pSer129+)
aggregates that propagate to interconnected regions (including from the substantia nigra (SN) to
the striatum) leading to dysfunction of the nigrostriatal system (Luk et al., 2012; Paumier et al.,
2015). A single 700µg ICV injection of Snca-targeted ASO1 reduced Snca mRNA by ~50% 70
days after ASO administration (Fig. 1, C to E), this resulted in prevention of pSer129+ aggregate
deposition in the PFF mouse model (~96% reduction, Fig 1F and G) 56 days following PFF
injection. PFF injected mice exhibit significant deficits in a wire hang motor function task, as
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
6
published previously (Luk et al., 2012). Following administration of ASO1, mice that were
injected with PFFs no longer exhibit a significant deficit in comparison to naïve mice (Fig. 1H).
ASO-mediated reduction of Snca is dose-responsive, exhibits a prolonged duration of
action, and dose-responsively prevents pathogenic aSyn aggregate deposition in an in vivo
PFF model of PD
More extensive characterization of ASO1 demonstrated dose-dependent reduction of Snca mRNA
in vivo 21 days following a single intracerebroventricular (ICV) administration in rats (Fig. 2, A
to C). Dose-dependent ASO-mediated Snca mRNA suppression with ASO1 also resulted in dose-
dependent prevention of pSer129+ aggregate deposition in comparison to the PBS group at 61
days post PFF injection (82 days post ASO ICV administration) in the SN (Fig. 2, D to F and fig.
S1, A and B). This is consistent with complete prevention of aggregates in aSyn KO mice and
attenuated aggregation in heterozygous KO mice injected with PFFs (Luk et al., 2012). There was
no evidence of dopaminergic cell dysfunction at this time point (fig. S1C) as expected (Paumier et
al., 2015) and the control ASO exhibited a profile similar to PBS administered rats, indicating the
control ASO does not alter disease (Fig. 2, E to F and fig. S1, A to C). ASO1 reduced Snca mRNA
and prevented pSer129+ aggregate deposition in the SN and across multiple brain regions,
including prefrontal cortex and motor cortex 61 days post PFF injection (fig. S1, D to G).
A second Snca targeting ASO (ASO2) was also evaluated. Snca ASO2 also reduced
pSer129+ aggregate counts, but to a lesser extent than ASO1 (fig. S1, F and G). This is
consistent with ASO2 being a less potent molecule than ASO1 with almost no Snca mRNA
suppression remaining 82 days post ASO administration (fig. S1, D and E), and more modest
Snca mRNA suppression than ASO1 at 42 days post ASO administration (fig. S1, H to J). Taken
together, these data suggest aSyn pathology is dependent on aSyn expression levels.
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
7
ASO-mediated suppression of Snca prevents dopaminergic cell dysfunction in an in vivo
PFF model of PD
PFF rodent models, like the human condition, undergo neurodegeneration in a number of CNS
regions after pathology is established (Goedert et al., 2013; Luk et al., 2012; Paumier et al.,
2015), this typically takes about 4-66 months after PFF injection. Fortunately, ASO1 exhibits a
long duration of action with significant target suppression up to 84 days in cortex, striatum and
midbrain then returning to baseline ~160 days post a single ICV administration at 1000µg (Fig.
3A). To determine if ASO-mediated suppression of aSyn production could prevent TH loss, rats
were administered a single ICV 1000µg dose of ASO1 prior to PFF injection and assessed 181
days later (Fig. 3B). ASO1 administration resulted in significant reduction of pSer129+
aggregates in comparison to PBS (~53% reduction) and control ASO (~48% reduction) treated
rats (Fig. 3C), and significantly attenuated PFF-mediated TH loss in the SN compared to PBS at
181 days post a single ASO administration (Fig. 3D). Striatal dopamine levels were also
normalized, in comparison to the respective contralateral side, with ASO1 treatment compared to
PBS or control ASO (Fig. 3E). Snca mRNA had returned to normal levels at this 181 day
timepoint (in comparison to PBS treated rats), which likely explains the modest accumulation of
aSyn aggregates when compared to almost complete ablation of pathology at the 61 day
timepoint when aSyn production was still suppressed (fig. S2, A and B in comparison to fig. S1,
B, C, D, and E).
Pathogenic aSyn aggregate deposition is reversible and its amelioration reduces TH loss
To determine if ASO-mediated Snca suppression could be beneficial after established
pathology, ASO1 was administered by ICV bolus at 700µg 14 days after PFF injection in mice, a
timepoint with established pSer129+ aggregates in the SN (Fig. 4A). Snca mRNA was
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
8
significantly reduced in the striatum and midbrain 56 days after PFF injection (Fig 4, B and C).
Strikingly, ASO1 reduced the number of established aggregates (~92% reduction, Fig 4D) 56 days
post PFF injection. A trend toward improvement in a wire hang behavioral task was also found in
mice (Fig. 4E). In addition, ASO1 was administered by ICV bolus at 1000µg 21 days after PFF
injection in rats, a timepoint with established pSer129+ aggregates in the SN (Fig. 4, F and H).
Though maximal PFF deposition occurs at 60 days post injection, rats euthanized 21 days post-
PFF injection exhibit extensive aggregate deposition that was resolved by ASO administration ~40
days later (Fig 4H). Strikingly, ASO1 reduced the number of established aggregates at 60 (~90%
reduction) and 81 (~51% reduction) days post PFF injection (39 and 61 days post ASO
administration) compared to pSer129+ aggregate counts at 21 days (PFF only). mRNA reduction
was as expected (Fig. 4G). Similar reductions in pSer129+ aggregates were found in the insular
cortex confirming widespread activity of the ASO (Fig. 4I). Thus, in both mice and rats ASO1
resulted in reversal of deposition of established aggregates.
To determine if suppression of aSyn after established aggregate deposition could prevent
TH loss, rats received a single 1000µg ICV injection of ASO1 administered 21 days after PFF
injection and assessed 181 days post PFF (160 days post ASO administration) (Fig. 4J). ASO1
significantly attenuated PFF-mediated TH loss in the SN compared to PBS, while a control ASO
did not (Fig. 4K). Interestingly, ASO1 administration resulted in a significant increase (~22%) in
pSer129+ aggregates compared to PBS and control ASO administered rats at 160 days post PFF
injection (Fig. 4L), possibly due to reduced dysfunction of aggregate-bearing neurons. In this
cohort, there were no significant differences in striatal dopamine levels for any of the treatment
groups (Fig. 4M). The increase in aggregates in ASO1 administered animals relative to PBS 160
days after a single ASO administration is consistent with aSyn levels returning to normal over time
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
9
(fig. S2, D and E), and likely higher than PBS due to the prevention of TH loss in ASO1 treated
animals. Remarkably, the transient reduction in aSyn production after aggregates were established
was sufficient to preserve TH expression in dopaminergic neurons highlighting the therapeutic
value of directly targeting the underlying disease.
Sustained reduction of Snca with ASO administered after aggregates are established
reduces aggregate pathology and prevents TH loss
To evaluate a paradigm of sustained Snca reduction, mice were administered two ICV bolus
700µg administrations of ASO1 at 14 days prior to and 76 days after PFF injection, which
resulted in sustained reduction in Snca mRNA with ~50% reduction remaining 224 days after
PFF injection and 238 days after the initial ASO administration (Fig. 5, A to C). Sustained Snca
mRNA reduction resulted in sustained reduction in aSyn pathology and a prevention of TH loss
224 days after PFF injection (Fig. 5, D to F). Snca mRNA and pSer129+ aggregate reduction
were similar to the ~60 day mouse (Fig. 1 D to F) and rat studies (Fig. 2, A to G and fig. S1, B-
K) though tissues were collected 224 days post PFF injection. Thus, maintaining Snca
suppression prevented aggregates from accumulating and prevented TH loss.
To determine if prolonged ASO-mediated Snca suppression could be more beneficial than
transient reduction after established pathology, ASO1 was administered ICV at 14 and 90 days
following PFF injection with study termination at 180 days post PFF in mice (Fig. 5G). Snca
mRNA and PSer129+ aggregates were reduced in the substantia nigra (Fig. 5, H to J). TH
positive loss was also prevented with prolonged aSyn reduction post PFF administration in
comparison to PBS administered mice (Fig. 5K). This differs from single ICV dose injection
following PFF in which aggregate number was increased in ASO1 treated rats in comparison to
PBS treated rats 180 days following PFF injection when mRNA expression had returned to
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
10
baseline levels (Fig. 4L and Fig. 3A) Thus, therapeutic treatment with Snca ASOs administered
with established aggregates requires sustained reduction of Snca to prevent aggregates from
accumulating once Snca RNA levels return to baseline.
Human SNCA ASOs are potent, suppress aSyn broadly in the primate CNS and CSF aSyn
is a potential pharmacodynamic biomarker
The ASOs used thus far target the rodent Snca transcripts. To treat human patients, we designed
ASOs to suppress the human SNCA transcript, using similar designs and chemistries as ASOs
already in clinical testing (Tabrizi et al., 2019). Human sequence targeting SNCA ASOs hASO1
and hASO2 (Table 1B) suppress human SNCA mRNA in a dose- and concentration-dependent
manner (Fig. 6, A to D and fig. S3, A and B) in vitro in SH-SY5Y human cells and in vivo in the
aSyn wild type human full-length transgenic mouse (similar to (Nussbaum and Ellis, 2003). The
human SNCA ASOs also exhibit an extended duration of action lasting 10 weeks after a single
administration (fig. S3, C to E). To determine the activity and distribution of human ASOs in a
larger brain, hASO1 and hASO2 were dose intrathecally (IT) in non-human primates (NHPs,
cynomolgus). Following repeated IT delivery of hASO1 or hASO2 to the NHPs, SNCA mRNA
(RT-qPCR) and aSyn protein (ELISA) are reduced throughout the brain and spinal cord (Fig. 6,
E to H). Further analyses of NHP brain tissue by in situ hybridization (SNCA mRNA) and
immunohistochemistry (ASO and aSyn protein) support the conclusion that SNCA ASOs
distribute broadly and result in reduction of SNCA mRNA and protein throughout the brain and
spinal cord (Fig. 6I and fig. S4), including regions implicated in PD. aSyn protein in the CSF is
significantly reduced with hASO1 in comparison to vehicle (aCSF) administered NHPs (Fig. 6J).
In addition, aSyn protein reduction in the frontal cortex correlates to aSyn protein reduction in
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
11
the CSF, suggesting the use of aSyn in the CSF as a potential pharmacodynamic biomarker (Fig.
6K).
Discussion
Our study demonstrates that ASO-mediated suppression of Snca prevented and reversed
the progression of aSyn mediated pathology in rodent transmission models of PD demonstrating
the potential of SNCA ASOs as a therapy for PD patients. Long term studies with sustained
reduction of aSyn prevented and even delayed pathology and associated TH loss. Furthermore,
central delivery of human SNCA ASOs reduced expression of mRNA and protein throughout the
brains of both the humanized mouse and NHPs demonstrating that human SNCA ASOs are active
in regions of the brain susceptible to PD in a larger species. In NHPs the reduction of aSyn was
reflected in the CSF supporting further investigation of the use of aSyn protein levels in the CSF
as a target engagement biomarker to allow evaluation of efficacy of human SNCA ASOs in the
clinic.
PD and other synucleinopathies are generally characterized as toxic gain of function in
SNCA, suggesting that therapeutics designed to lower aSyn production would be beneficial to
patients (Giasson et al., 2002; Klein et al., 2002; Kruger et al., 1998; Zarranz et al., 2004). To
date, there are multiple protein-based therapeutic strategies being investigated targeting different
forms and conformational states of aSyn in clinical trials (Kingwell, 2017). However, the toxic
species of aSyn has not yet been confirmed, potentially limiting therapeutic benefit of these
approaches (Dehay et al., 2015; Kingwell, 2017). In addition, protein targeting therapies
hypothesized to clear aSyn aggregates as they are transmitted from cell to cell may not be as
effective in targeting intracellular Lewy body inclusions. An ASO therapy can potentially
overcome these limitations by targeting mRNA intracellularly and reducing all forms of aSyn
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
12
protein (Bennett and Swayze, 2010; Rigo et al., 2014). Indeed, ASO-mediated suppression of
aSyn reduced aSyn pathology in a dose dependent manner. In all cases, the levels of aSyn
pathology corresponded to the levels of endogenous aSyn production. An ASO less effective at
suppressing Snca mRNA was less effective at suppressing aSyn pathology. If the Snca mRNA
levels were allowed to return to normal levels, the aSyn pathology returned, however, this increase
was prevented with continued suppression of aSyn production. Taken together, these data
illustrate the link between production of endogenous aSyn and aSyn pathology.
Our observation that ASO treatment was beneficial in reducing the number of pSyn
aggregates at a time when pre-existing pathology is present is particularly interesting. This is
consistent with previous work reporting reversal of deposition of soluble aSyn as well as insoluble
forms of pathology following reduction of aSyn production by tetracycline-controlled
transactivator (tTA) to prevent expression of the A53T mutant aSyn transgene (Lim et al., 2011).
In the genetic study, stopping production also reversed detrimental changes in hippocampal
synaptic markers, and hippocampal memory deficits (Lim et al., 2011). Our results replicate and
extend these findings with a therapeutically relevant modality, and in a model where we are
targeting endogenous aSyn, rather than a transgene. In both cases, stopping aSyn production had
a dramatic effect on aSyn pathology and neuronal health. This finding may suggest that de novo
production and recruitment of aSyn is required for maintaining the stability of aggregates until a
threshold is reached for irreversible cell death. This concept remains to be explored. Regardless,
these data suggest that treatment initiation after disease onset in sporadic patients has the potential
to reverse disease.
Many toxin, genetic, viral-mediated, and alpha-synuclein injection Parkinson disease
animal models have been generated to evaluate the role of aSyn in Parkinson’s disease (Jagmag et
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
13
al., 2015; Koprich et al., 2017; Recasens et al., 2014). Each model exhibits advantages and
limitations (Koprich et al., 2017). The aSyn PFF injection models, used here, exhibits advantages
in modeling sporadic PD by relying on fibril seeding and templating of normal endogenous levels
of aSyn in specific interconnected brain circuits, avoiding the global overexpression produced in
germline transgenic models and the forced local supraphysiological overexpression common in
viral vector models (Duffy et al., 2018). The evolution of aggregate formation in morphology
(diffuse punctate to compact) and important characteristics of Lewy bodies (e.g., proteinase-K
resistance, Thioflavin-S positive) progressing over time to result in DA neuron degeneration at 6
months post-PFF injection, provides a platform for analyzing the potential of neuroprotective
therapies, such as ASOs, for translation to treatment of idiopathic PD. In this regard, our findings
are promising.
Few tolerability concerns exist for lowering SNCA as evidenced by genetically engineered
Snca deficient mice (Abeliovich et al., 2000; Cabin et al., 2002; Chandra et al., 2004; Goldberg
and Lansbury, 2000; Greten-Harrison et al., 2010). There are reports of cell death in vivo using an
shRNA against Snca (Benskey et al., 2018; Collier et al., 2016), which was not found here with
ASOs or in other publications using siRNAs, shRNAs, or ASOs against Snca (Alarcon-Aris et al.,
2018; Uehara et al., 2019; Zharikov et al., 2015). The aSyn antibodies, Prasinezumab (PRX002)
and Cinpanemab (BIIB054), completed first-in-human trials in which no serious adverse events
were found with aSyn lowering (Brys et al., 2019; Schenk et al., 2017). In addition, our animal
model studies and others (Games et al., 2014; Spencer et al., 2017; Tran et al., 2014; Zharikov et
al., 2015) have shown a benefit with less than 50% reduction of Snca mRNA indicating that only
a partial reduction of SNCA will be needed for therapeutic benefit, as mentioned above.
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
14
aSyn protein exhibits a profile desirable for a pharmacodynamic biomarker as reduction in
aSyn protein in the CSF correlated with aSyn protein reduction in the frontal cortex in the NHP.
aSyn protein is measurable in human CSF, has been shown in patients to not correlate with clinical
progression, and levels are relatively stable over 24 months, thus suggesting aSyn levels in the
CSF may potentially be used in clinical trials as a pharmacodynamic marker to support
demonstration of efficacy of aSyn modulating therapies (Dolatshahi et al., 2018; Mollenhauer,
2014; Mollenhauer et al., 2017; Parnetti et al., 2016; Zhou et al., 2015). Continued evaluation and
improved methods for detecting aSyn in the CSF and other fluids are warranted, such as
electrochemiluminescense-based detection (Kruse and Mollenhauer, 2019).
ASOs represent a therapeutic approach for directly lowering SNCA production because
ASOs are sequence-specific and can reach central nervous system targets by intrathecal delivery.
The ASO platform is quickly becoming a realistic therapeutic strategy for the treatment of central
nervous system (CNS) diseases due partly to recent advances in ASO design which have improved
stability, affinity, and potency, as well as improved tolerability (Bennett and Swayze, 2010; Rigo
et al., 2014). ASOs have also been shown to distribute widely within the brain and spinal cord in
the NHP shown here and elsewhere (Kordasiewicz et al., 2012; Lagier-Tourenne et al., 2013;
Passini et al., 2011) in addition to exhibiting a long duration of effect shown here and elsewhere
(Friedrich et al., 2018; Hagemann et al., 2018; McLoughlin et al., 2018; Scoles et al., 2017; Zhao
et al., 2017). Feasibility of the approach is supported by FDA approval of Spinraza© for the
treatment of spinal muscular atrophy (Chiriboga et al., 2016; Finkel et al., 2016), the recently
completed clinical trial with an ASO for Huntingtin’s (Htt) disease (Rodrigues and Wild, 2018;
Tabrizi et al., 2019), and ongoing trials for a SOD1-targeted ASO for amyotrophic lateral sclerosis
(NCT02623699), a C9ORF72 ASO for ALS (NCT03626012), a LRRK2-targeted ASO for
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
15
Parkinson’s disease (NCT03976349), and a MAPT targeting ASO therapy for Alzheimer’s disease
(NCT03186989). To explore the translational potential of an SNCA ASO therapy, we examined
target engagement of human SNCA targeting ASOs in a human cell line, a human aSyn transgenic
mouse model and NHPs. The SNCA targeting molecules described here have sufficient potency
and duration of action for use in human patients. Thus, ASOs designed against human SNCA
have the potential to be a disease-modifying therapeutic for PD patients.
Materials and Methods
Oligonucleotide synthesis
The synthesis and purification of all lyophilized ASOs was formulated in PBS without Ca/Mg
(Gibco: 14190) as previously described and stored at -20oC (Ostergaard et al., 2013; Seth et al.,
2010). Sequences and chemistries used are listed (fig. S1A and B).
Cell culture PFF experiments
Timed-pregnant CD1 mice (Charles River Laboratories) were utilized for primary neuronal
cultures. Hippocampal neurons were prepared from embryos (E16-18) as previously described
(Volpicelli-Daley et al., 2014). All other methods including PFF generation, PFF treatment, and
ASO addition to cultures were performed as previously described (Luna et al., 2018).
PSer129+ pathology and double strand DNA breaks by γH2AX Ser139 were quantified as
previously described (Tapias et al., 2017).
Rats
Adult male Sprague Dawley rats (200-225g; Harlan Laboratory, Indianapolis, IN) were utilized in rat
experiments. Rat PFF studies were conducted at Michigan State University (MSU) and rat and mouse
studies were conducted at Ionis pharmaceuticals. Rats at MSU were housed in the Van Andel
Research Institute vivarium and mice and rats at Ionis pharmaceuticals were housed in the
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
16
vivarium. Both animal facilities are accredited by the Association for the Assessment and
Accreditation of Laboratory Animal Care and complied with all Federal animal care and use
guidelines for both institutions. The Institutional Animal Care and Use Committee approved all
protocols for both institutions.
Intrastriatal PFF injections in rats
Purification of recombinant in vitro fibril assembly was performed as previously described
(Paumier et al., 2015). Animals were monitored weekly following surgery and sacrificed at various
time points.
ICV injection in rats
Rats were injected into the right cerebroventricle (ICV) using a stereotactic device. For ICV bolus
injections the coordinates were -1.0 mm anterior/posterior and 1.5 mm to the right medial/lateral
are used. The needle is lowered -3.7mm dorsal/ventral. The proper amount of injection solution
(30 μL) was injected by hand at injection rates of approximately 1 μL/second with a 5-minute wait
following completion of injection. The incision was sutured closed using one horizontal mattress
stitch with 3-O Ethilon suture. The animals were then allowed to recover from the anesthesia in
their home cage.
Tissue processing in rats
Following in-life completion rats were euthanized by CO2 asphyxiation. 2 mm sections of spinal
cord and different brain regions were collected for mRNA analysis. Brains perfused with
physiological saline were cooled in iced saline and cut coronally in a 2 mm thick slab immediately
rostral to the hypothalamus. The section was placed onto a petri dish on ice and further dissected
into 3 pieces each for striatum and overlying cortex. For striatum: dorsal lateral striatum for HPLC,
dorsal intermediate striatum for mRNA, and dorsal medial striatum for protein. For cortex: medial
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
17
for HPLC, intermediate for mRNA, lateral for protein. Dissections were optimized for HPLC
analysis corresponding to the pattern of dopamine innervation. Each dissected region was frozen
at -80 until analysis. Immunohistochemistry/ immunofluorescence/ pSer129+ aggregate counts
(total enumeration)/stereology were performed as previously described (Paumier et al., 2015).
Immunohistochemistry in rats
Used primary mouse anti-pSyn (81a-1:10,000 (Luk et al., 2012)), mouse-anti-TH (1:8000;
Immunostar, Hudson, WI), antibodies overnight at 4C. Then, sections were incubated in
biotinylated secondary antisera against either mouse (1:400, Millipore, Temecula, CA) or rabbit
IgG (1:400, Millipore, Temecula, CA) followed by Vector ABC detection kit (Vector Labs,
Burlingame, CA). Antibody labeling was visualized by exposure to 0.5 mg/ml 3,3'
diaminobenzidine (DAB) and 0.03% H2O2 in Tris buffer. Sections were mounted on subbed slides,
dehydrated to xylene and coverslipped with Cytoseal (Richard-Allan Scientific, Waltham, MA).
Immunofluorescence in rats
For DAPI staining, an additional three-minute incubation in Tris buffer with DAPI (1:500;
Invitrogen, Carlsbad, CA) was performed. Primary antibodies used include rabbit anti-TH
(1:4000; Millipore, Temecula, CA), mouse anti-pSyn (81a-1:15,000),. Secondary antibodies used
include Alexa Fluor 568 goat anti-mouse IgG (1:500; Invitrogen, Carlsbad, CA) and Alexa Fluor
488 goat anti-rabbit IgG (1:500; Invitrogen, Carlsbad, CA).
Medial Terminal Nucleus (MTN) counts of TH neurons in the SN in rats
TH neurons from three sections of the SN, easily identified by proximity to the medial terminal
nucleus of the accessory optic tract (−5.04 mm, −5.28 mm and −5.52 mm relative to bregma), were
quantified as previously described (Gombash et al., 2014). MicroBrightfield stereological
software (MBF Bioscience, Williston, VT) was used to assess the total number of aggregates
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
18
(defined as dense, darkly stained cores of phosphorylated aSyn staining) within the SN at various
time points. Using a Nikon Eclipse 80i microscope, Retiga 4000R (QImaging, Surrey, BC,
Canada) and the Microbrightfield StereoInvestigator software (Microbrightfield Bioscience,
Burlingame, Virginia, USA), MTN neuron quantification was completed by drawing a contour
around the SN borders using a 4X objective. Virtual markers were then placed on TH+ neurons at
a 20X objective and quantified. Total TH neuron numbers in both the ipsilateral and contralateral
SN were averaged for the three medial terminal nucleus sections counted. MTN counts were used
for fig. S2, C. Differences in n’s within an experiment are due to technical reasons.
Stereology in rats
MicroBrightfield stereological software (MBF Bioscience, Williston, VT) was used to assess total
population cell counts in the substantia nigra pars compacta (SNpc). The total number of stained
neurons was calculated using optical fractionator estimations and the variability within animals
was assessed via the Gundersen Coefficient of Error (< 0.1) (Gundersen et al., 1999).
High performance liquid chromatography (HPLC) in rats
A dorsolateral striatal tissue punch was taken from both hemispheres. Frozen punches were placed
individually in vials supercooled on dry ice and stored at −80 °C until analysis. Tissue was
homogenized and analyzed as described previously (Koprich et al., 2003a; Koprich et al., 2003b).
The Pierce BCA Protein Kit (Rockford, IL) was utilized for protein determination. Samples were
separated on a Microsorb MV C-18 column (5 Am, 4.6–250 mm, Varian, Palo Alto, CA) and
simultaneously examined for norepinephrine, serotonin, dopamine, 3,4-dihydroxyphenylacetic
acid (DOPAC) and homovanillic acid (HVA). Compounds were detected using a 12-channel
coulometric array detector (CoulArray 5200, ESA, Chelmsford, MA) attached to a Waters 2695
Solvent Delivery System (Waters, Milford, MA) under the following conditions: flow rate of 1
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
19
ml/min; detection potentials of 50, 175, 350, 400 and 525 mV; and scrubbing potential of 650 mV.
The mobile phase consisted of a 10% methanol solution in distilled H2O containing 21 g/l (0.1 M)
citric acid, 10.65 g/l (0.075 M) Na2HPO4, 176 mg/l (0.8 M) heptanesulfonic acid and 36 mg/l
(0.097 mM) EDTA at a pH of 4.1.
Mice
Adult male and female mice (20-32 g;Taconic Biosciences, Hudson, NY) were utilized in all
experiments. All mouse studies using either C57/Bl6 or human wild type SNCA-PAC (Licensed from
Mayo Foundation for Medical Education and Research) mice were conducted at Ionis pharmaceuticals.
The Institutional Animal Care and Use Committee approved all protocols.
Intrastriatal PFF injections in mice
Mouse PFF studies were performed as described previously including pSer129+ aggregate counts,
dopaminergic cell counts, and wire hang task in mice (Zhao et al., 2017). Purification of
recombinant in vitro fibril assembly was performed as previously described (Luk et al., 2012;
Volpicelli-Daley et al., 2014; Zhao et al., 2017). Mice were injected in the striatum with 5 µg of
aSyn PFFs in 2 µL of dosing solution.
ICV ASO injection in mice
Mice were injected into the right cerebroventricle (ICV) using a stereotactic device as previously
described (Zhao et al., 2017). For ICV bolus injections the coordinates 0.3 mm anterior to bregma,
1.0 mm right lateral, and -3.0 mm ventral were used. 10μL of injection solution was injected by
hand at injection rates of approximately 1 μL/second with a 5-minute wait following completion
of injection. The incision was sutured closed using one horizontal mattress stitch with 5-O Ethilon
suture. The animals were then allowed to recover from the anesthesia in their home cage.
Non-human primates
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
20
The non-human primate (cynomolgus) study was performed at Covance laboratories GmbH.
Covance Laboratories GmbH test facility is fully accredited by the AAALAC. All procedures in
this study plan are in compliance with the German Animal Welfare Act and are approved by the
local IACUC, and performed as described previously (DeVos et al., 2017). NHPs (n=4) were
administered, by intrathecal bolus injection, 5 doses of ASO or aCSF on Day 1, 14, 28, 56, and 84
with 1.0 mL dosing volume using a 35 mg/mL dosing solution and euthanized on day 91.
aSyn enzyme-linked immunosorbent assay (ELISA)
Roughly 50 mg of NHP brain tissue was added to 1 ml of RIPA buffer (Boston Bioproducts) with
protease and phosphatase inhibitor tablets (Sigma-Aldritch) in a 2 ml Lysing Matrix D tube (MP
Biomedicals). The samples were homogenized using an MP Fastprep-24 (MP Biomedicals), and
total protein was quantified using the Pierce BCA Protein Assay kit (Thermo Fisher) and
normalized to 1 mg/ml. Tissue samples were diluted either 1:100 (spinal cord), 1:2000 (brain
tissue) or 1:10 (CSF) prior to alpha synuclein protein determination. Alpha synuclein protein
concentrations were measured using the LEGENDMAX Human Alpha Synuclein ELISA Kit
(Biolegend) following the manufacturer’s protocol. CSF hemoglobin levels were also analyzed
using the human hemoglobin ELISA kit (Bethyl Laboratories). This was done to assess the impact
of blood contamination on the alpha synuclein levels detected in CSF due to the high levels of
alpha synuclein contained in red blood cells. Samples with greater than 1000 ng/ml HgB were
excluded from the CSF analysis.
Antisense oligonucleotide immunohistochemistry in NHP tissue
Immunohistochemical staining was performed on a Ventana DISCOVERY ULTRA autostainer
(Ventana). Staining was done according to the manufacturer's instructions. Briefly, five
micrometer thick sections were deparaffinized and rehydrated then subjected to antigen retrieval
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
21
using Proteinase K (Dako) for 4 minutes, followed by incubation with a Rabbit polyclonal anti-
ASO antibody at 1: 10,000 dilution (Ionis, #ASO 6651) for 60 minutes. The signal was detected
with polymer-based secondary antibody -Discovery OmniMap anti-Rb HRP and Discovery
ChromoMap DAB kits (Ventana). Control samples were also stained with rabbit IgG (Cell
signaling Technologies, #2792) as isotype controls. All slides were scanned on a 3DHISTECH
Panoramic P250 Slide Scanner. ASO images were scanned at 20X magnification. All images
were taken as screen shots from virtual slides. All images were analyzed with custom image
analysis algorithms performed on the VisioPharm software platform. Target brain regions on each
slide were manually outlined in Visiopharm to designate areas for algorithm analysis. In the
VisioPharm analysis algorithm, ASO staining was assessed as positively stained region area
broken down into three levels of intensity. A minimum threshold for ASO staining was
determined by assessing background levels of DAB (brown) staining. A maximum threshold of
100% intensity of DAB staining was used. ASO staining ranges were determined independently
per stain. This range was evenly divided into low, medium, and high intensity bins, each area of
staining was calculated as a percentage of the total outlined tissue area (brain region).
SNCA-RNA in situ hybridization (ISH) staining in NHP tissue
ISH staining was performed on a Leica Biosystems' BOND RX Autostainer (Leica Biosystems)
using mRNAscope® 2.5 LS Reagent Kit—RED (Advanced Cell Diagnostics). Staining was done
according to the manufacturer's instructions. Briefly, five micrometer thick sections were
deparaffinized and rehydrated then subjected to pretreatment, followed by specific probe-SNCA
(ACD, #421318) hybridized to target mRNA. The signal was amplified using multiple steps,
followed by hybridization to alkaline phosphatase (AP)-labeled probes and detection using Fast
Red (ACD, #322150). The tissue quality was examined by positive control probe-PPIB (ACD,
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
22
#424148), and background staining was assessed by negative control probe-dapB (ACD,
#312038). All slides were scanned on a 3DHISTECH Panoramic P250 Slide Scanner. ISH images
were scanned at 40X magnification. All images were taken as screen shots from virtual slides.
All images were analyzed with custom image analysis algorithms performed on the VisioPharm
software platform. Target brain regions on each slide were manually outlined in Visiopharm to
designate areas for algorithm analysis. In the VisioPharm analysis algorithm, aSyn mRNA counts
were determined by detecting and counting SNCA ISH labeled dots within each region. These
counts were normalized by the total outlined tissue area (brain region) in mm2.
aSyn immunohistochemistry in NHP tissue
Immunohistochemical staining was performed on a Ventana DISCOVERY ULTRA autostainer
(Ventana). Staining was done according to the manufacturer's instructions. Briefly, five
micrometer thick sections were deparaffinized and rehydrated then subjected to antigen retrieval
using Ventana CC1 (EDTA pH 8) for 64 minutes, followed by incubation with a Mouse
monoclonal antibody aSyn211 (Santa Cruz, #SC-12767) at 0.25 μg/ml for 60 minutes. The signal
was detected with polymer-based secondary antibody -Discovery OmniMap anti-Ms HRP for 16
minutes. Control samples were also stained with mouse IgG (Cell signaling Technologies) as
isotype controls. All slides were scanned on a 3DHISTECH Panoramic P250 Slide Scanner. aSyn
protein images were scanned at 20X magnification. All images were taken as screen shots from
virtual slides. All images were analyzed with custom image analysis algorithms performed on the
VisioPharm software platform. Target brain regions on each slide were manually outlined in
Visiopharm to designate areas for algorithm analysis. In the VisioPharm analysis algorithm, aSyn
Protein staining was assessed as positively stained region area broken down into three levels of
intensity. A minimum threshold for aSyn protein was determined by assessing background levels
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
23
of DAB (brown) staining. A maximum threshold of 100% intensity of DAB staining was
used. aSyn Protein ranges were determined independently per stain. This range was evenly
divided into low, medium, and high intensity bins, each area of staining was calculated as a
percentage of the total outlined tissue area (brain region).
mRNA purification and analysis for mice, rats, and non-human primates
Approximately 10 mg of tissue per sample was homogenized in guanidinium isothiocynate. Total
mRNA was purified further using a mini-mRNA purification kit (Qiagen, Valencia, CA). After
quantitation, the tissues were subjected to real time PCR analysis. The Life Technologies ABI
StepOne Plus Sequence Detection System was employed. Briefly, 20 µl RT-PCR reactions
containing 5µl of mRNA were run with the RNeasy 96 kit reagents and the primer probe sets listed
in the materials section optimized from manufacturer’s instructions. The following sequences of
primers and probes were used: mouse Snca 5’-GTCATTGCACCCAATCTCCTAAG-3’
(forward), 5’-GACTGGGCACATTGGAACTGA-3’ (reverse), and 5’-FAM-
CGGCTGCTCTTCCATGGCGTACAAX- TAMRA-3’ (probe); rat Snca 5’-
GATGGGCAAGGGTGAAGAAG-3’ (forward), 5’-GCTAGGGTCCACAGGCATGT-3’
(reverse), and 5’-FAM-TACCCACAAGAGGGAAT-MGB-3’ (probe) human SNCA 5’-
TGGCAGAAGCAGCAGGAAA-3’ (forward), 5’-TCCTTGGTTTTGGAGCCTACA-3’
(reverse), and 5’-FAM-CAAAAGAGGGTGTTCTC-TAMRA-3’ (probe); mouse cyclophilin A
5’-TCGCCGCTTGCTGCA-3’ (forward), 5’-ATCGGCCGTGATGTCGA-3’ (reverse), and 5’-
FAM-CCATGGTCAACCCCACCGTGTTCX-TAMRA-3’; Target SNCA mRNA was then
normalized to Cyclophilin A mRNA levels from the same mRNA sample. SNCA mRNA from
ASO treated animals was further normalized to the group mean of PBS treated animals, and
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
24
expressed as percent control. All qPCR reactions were run in triplicate. Data were analyzed using
Microsoft Excel (v14.4).
SH-SY5Y Cell Culture Assay:
SH-SY5Y cells (CRL-2266, ATCC) were cultured in growth medium at 37° C and 10% CO2.
ASO was electroporated into cells, by pulsing once at 160V for 6mS with the ECM 830 instrument
(Harvard Apparatus). After 24 hr, the cells were washed 1X with PBS before lysing for mRNA
isolation and analysis. For each treatment condition quadruplicate wells were tested.
RNA purification and analysis for cell culture
The mRNA was purified with a glass fiber filter plate (Pall # 5072) and chaotropic salts. The
human SNCA message level was quantitated with RT-qPCR on the QS7 instrument (Applied
Biosystems). Total mRNA levels were measured with the Quant-iT™ RiboGreen® mRNA reagent
and used to normalize the SNCA data. Data were analyzed using Microsoft Excel (v14.4) and
GraphPad Prism (v6).
Statistical Analysis
Statistical tests were completed using either GraphPad Prism software (version 6, GraphPad, La
Jolla, CA) or Microsoft excel (v14.4). Data are expressed as mean +/- s.e.m., unless otherwise
noted. For two group comparisons t-tests were used. For more than two group comparisons, one-
way ANOVAs were used. Comparisons of multiple groups made across time points were analyzed
using a two-way ANOVA. When appropriate, post-hoc comparisons were made between groups using
Tukey or Bonferonni post hoc tests. A ROUT analysis was performed to determine outliers using
(Q=1%). The level of significance was set at P ≤ 0.05. Tests used are reported in the figure
legends.
Summary of supplemental material
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
25
Supplemental material consists of ASO sequences, confirmation of POC results with an additional
Snca ASO, non-critical RNA results, additional characterization of human SNCA ASOs in
transgenic mice, and supporting histological evidence from NHP study.
Author contributions: The study was conceived by T.A.C. and H.B.K. Experiments were
designed by T.A.C., H.B.K., H.Z, and K.L.P. ASOs were designed by T.A.C, H.B.K, and E.E.S.
Experiments were performed and analyzed by K.L.P, T.J.C., H.Z., A.B., A.M., C. S., E.S., E.L.,
A.C-S., M.W., M.B., L.J, and J.L. Animal work was carried out by K.L.P, H.Z., T.J.C., B.F.D,
I.S., C.E.S., K.S-C, and A.B. ELISA/Immunohistochemistry was carried out by K.L.P, M.W.,
M.B., T.J.C., H.Z., D.Q., and B.F.D. HPLC was performed by J.L. Fibrils were obtained from
A.W. and K.C.L. E. E. S., C.F.B., K.L.P, T.J.C, D.G. A.W. and K.C.L. gave conceptual advice.
T.A.C. and H.B.K. wrote the manuscript. Competing interests: T.A.C., H.Z., A.M., C.F.B., D.Q.,
E.E.S., and H.B.K. are paid employees and stockholders of Ionis Pharmaceuticals Inc. (Carlsbad,
CA). D.G., M.W., M.B., L.J., A.W., are paid employees and stock holders of Biogen (Cambridge,
MA). T.J.C., I.S., C.E.S., K.S-C., B.F.D., A.B., J.L., C.S., E.S., A.C-s., K.C.L., and K.L.P. have
no conflicts of interest. Data and materials availability: No large scale data sets were generated
in this study. All ASO sequences and chemistries, as well as references to the synthesis are
included in the methods to allow for generation of these compounds. SNCA-PAC mice were
licensed from Mayo Foundation for Medical Education and Research.
Acknowledgements: We thank Donna Sipe, Johnnatan Tamayo and Gemma Ebeling for vivarium
assistance. Tracy Reigle for figure design and assembly. We also would like to thank the oligo
screening group (RTS), the preclinical development team, the oligo synthesis group, vivarium staff
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
26
and histology core staff at Ionis Pharmaceuticals. We would also like to acknowledge the
translational pathology laboratory at Biogen for staining IHC/ISH for the NHP study. We want to
acknowledge Mian Horvath, a wonderful technician in the Luk laboratory at UPenn.
References:
Abeliovich, A., Y. Schmitz, I. Farinas, D. Choi-Lundberg, W.H. Ho, P.E. Castillo, N. Shinsky, J.M. Verdugo, M.
Armanini, A. Ryan, M. Hynes, H. Phillips, D. Sulzer, and A. Rosenthal. 2000. Mice lacking alpha-
synuclein display functional deficits in the nigrostriatal dopamine system. Neuron 25:239-252.
Aflaki, E., W. Westbroek, and E. Sidransky. 2017. The Complicated Relationship between Gaucher Disease and
Parkinsonism: Insights from a Rare Disease. Neuron 93:737-746.
Alarcon-Aris, D., A. Recasens, M. Galofre, I. Carballo-Carbajal, N. Zacchi, E. Ruiz-Bronchal, R. Pavia-Collado, R.
Chica, A. Ferres-Coy, M. Santos, R. Revilla, A. Montefeltro, I. Farinas, F. Artigas, M. Vila, and A.
Bortolozzi. 2018. Selective alpha-Synuclein Knockdown in Monoamine Neurons by Intranasal
Oligonucleotide Delivery: Potential Therapy for Parkinson's Disease. Mol Ther 26:550-567.
Arai, K., N. Kato, K. Kashiwado, and T. Hattori. 2000. Pure autonomic failure in association with human alpha-
synucleinopathy. Neuroscience letters 296:171-173.
Bennett, C.F., and E.E. Swayze. 2010. RNA targeting therapeutics: molecular mechanisms of antisense
oligonucleotides as a therapeutic platform. Annual review of pharmacology and toxicology 50:259-293.
Benskey, M.J., R.C. Sellnow, I.M. Sandoval, C.E. Sortwell, J.W. Lipton, and F.P. Manfredsson. 2018. Silencing
Alpha Synuclein in Mature Nigral Neurons Results in Rapid Neuroinflammation and Subsequent Toxicity.
Front Mol Neurosci 11:36.
Brys, M., L. Fanning, S. Hung, A. Ellenbogen, N. Penner, M. Yang, M. Welch, E. Koenig, E. David, T. Fox, S.
Makh, J. Aldred, I. Goodman, B. Pepinsky, Y. Liu, D. Graham, A. Weihofen, and J.M. Cedarbaum. 2019.
Randomized phase I clinical trial of anti-alpha-synuclein antibody BIIB054. Movement disorders : official
journal of the Movement Disorder Society 34:1154-1163.
Cabin, D.E., K. Shimazu, D. Murphy, N.B. Cole, W. Gottschalk, K.L. McIlwain, B. Orrison, A. Chen, C.E. Ellis, R.
Paylor, B. Lu, and R.L. Nussbaum. 2002. Synaptic vesicle depletion correlates with attenuated synaptic
responses to prolonged repetitive stimulation in mice lacking alpha-synuclein. J Neurosci 22:8797-8807.
Chandra, S., F. Fornai, H.B. Kwon, U. Yazdani, D. Atasoy, X. Liu, R.E. Hammer, G. Battaglia, D.C. German, P.E.
Castillo, and T.C. Sudhof. 2004. Double-knockout mice for alpha- and beta-synucleins: effect on synaptic
functions. Proc Natl Acad Sci U S A 101:14966-14971.
Chartier-Harlin, M.C., J. Kachergus, C. Roumier, V. Mouroux, X. Douay, S. Lincoln, C. Levecque, L. Larvor, J.
Andrieux, M. Hulihan, N. Waucquier, L. Defebvre, P. Amouyel, M. Farrer, and A. Destee. 2004. Alpha-
synuclein locus duplication as a cause of familial Parkinson's disease. Lancet 364:1167-1169.
Chiriboga, C.A., K.J. Swoboda, B.T. Darras, S.T. Iannaccone, J. Montes, D.C. De Vivo, D.A. Norris, C.F. Bennett,
and K.M. Bishop. 2016. Results from a phase 1 study of nusinersen (ISIS-SMN(Rx)) in children with
spinal muscular atrophy. Neurology 86:890-897.
Collier, T.J., D.E. Redmond, Jr., K. Steece-Collier, J.W. Lipton, and F.P. Manfredsson. 2016. Is Alpha-Synuclein
Loss-of-Function a Contributor to Parkinsonian Pathology? Evidence from Non-human Primates. Front
Neurosci 10:12.
Cronin, K.D., D. Ge, P. Manninger, C. Linnertz, A. Rossoshek, B.M. Orrison, D.J. Bernard, O.M. El-Agnaf, M.G.
Schlossmacher, R.L. Nussbaum, and O. Chiba-Falek. 2009. Expansion of the Parkinson disease-associated
SNCA-Rep1 allele upregulates human alpha-synuclein in transgenic mouse brain. Hum Mol Genet
18:3274-3285.
Dehay, B., M. Bourdenx, P. Gorry, S. Przedborski, M. Vila, S. Hunot, A. Singleton, C.W. Olanow, K.M. Merchant,
E. Bezard, G.A. Petsko, and W.G. Meissner. 2015. Targeting alpha-synuclein for treatment of Parkinson's
disease: mechanistic and therapeutic considerations. The Lancet. Neurology 14:855-866.
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
27
Devine, M.J., K. Gwinn, A. Singleton, and J. Hardy. 2011. Parkinson's disease and alpha-synuclein expression.
Movement disorders : official journal of the Movement Disorder Society 26:2160-2168.
DeVos, S.L., R.L. Miller, K.M. Schoch, B.B. Holmes, C.S. Kebodeaux, A.J. Wegener, G. Chen, T. Shen, H. Tran,
B. Nichols, T.A. Zanardi, H.B. Kordasiewicz, E.E. Swayze, C.F. Bennett, M.I. Diamond, and T.M. Miller.
2017. Tau reduction prevents neuronal loss and reverses pathological tau deposition and seeding in mice
with tauopathy. Sci Transl Med 9:
Di Maio, R., P.J. Barrett, E.K. Hoffman, C.W. Barrett, A. Zharikov, A. Borah, X. Hu, J. McCoy, C.T. Chu, E.A.
Burton, T.G. Hastings, and J.T. Greenamyre. 2016. alpha-Synuclein binds to TOM20 and inhibits
mitochondrial protein import in Parkinson's disease. Sci Transl Med 8:342ra378.
Dolatshahi, M., S. Pourmirbabaei, A. Kamalian, A. Ashraf-Ganjouei, M. Yaseri, and M.H. Aarabi. 2018.
Longitudinal Alterations of Alpha-Synuclein, Amyloid Beta, Total, and Phosphorylated Tau in
Cerebrospinal Fluid and Correlations Between Their Changes in Parkinson's Disease. Front Neurol 9:560.
Duffy, M.F., T.J. Collier, J.R. Patterson, C.J. Kemp, D.L. Fischer, A.C. Stoll, and C.E. Sortwell. 2018. Quality Over
Quantity: Advantages of Using Alpha-Synuclein Preformed Fibril Triggered Synucleinopathy to Model
Idiopathic Parkinson's Disease. Front Neurosci 12:621.
Farrer, M., J. Kachergus, L. Forno, S. Lincoln, D.S. Wang, M. Hulihan, D. Maraganore, K. Gwinn-Hardy, Z.
Wszolek, D. Dickson, and J.W. Langston. 2004. Comparison of kindreds with parkinsonism and alpha-
synuclein genomic multiplications. Annals of neurology 55:174-179.
Finkel, R.S., C.A. Chiriboga, J. Vajsar, J.W. Day, J. Montes, D.C. De Vivo, M. Yamashita, F. Rigo, G. Hung, E.
Schneider, D.A. Norris, S. Xia, C.F. Bennett, and K.M. Bishop. 2016. Treatment of infantile-onset spinal
muscular atrophy with nusinersen: a phase 2, open-label, dose-escalation study. Lancet 388:3017-3026.
Friedrich, J., H.B. Kordasiewicz, B. O'Callaghan, H.P. Handler, C. Wagener, L. Duvick, E.E. Swayze, O.
Rainwater, B. Hofstra, M. Benneyworth, T. Nichols-Meade, P. Yang, Z. Chen, J.P. Ortiz, H.B. Clark, G.
Oz, S. Larson, H.Y. Zoghbi, C. Henzler, and H.T. Orr. 2018. Antisense oligonucleotide-mediated ataxin-1
reduction prolongs survival in SCA1 mice and reveals disease-associated transcriptome profiles. JCI
Insight 3:
Fuchs, J., C. Nilsson, J. Kachergus, M. Munz, E.M. Larsson, B. Schule, J.W. Langston, F.A. Middleton, O.A. Ross,
M. Hulihan, T. Gasser, and M.J. Farrer. 2007. Phenotypic variation in a large Swedish pedigree due to
SNCA duplication and triplication. Neurology 68:916-922.
Fuchs, J., A. Tichopad, Y. Golub, M. Munz, K.J. Schweitzer, B. Wolf, D. Berg, J.C. Mueller, and T. Gasser. 2008.
Genetic variability in the SNCA gene influences alpha-synuclein levels in the blood and brain. FASEB J
22:1327-1334.
Games, D., E. Valera, B. Spencer, E. Rockenstein, M. Mante, A. Adame, C. Patrick, K. Ubhi, S. Nuber, P. Sacayon,
W. Zago, P. Seubert, R. Barbour, D. Schenk, and E. Masliah. 2014. Reducing C-terminal-truncated alpha-
synuclein by immunotherapy attenuates neurodegeneration and propagation in Parkinson's disease-like
models. J Neurosci 34:9441-9454.
Giasson, B.I., J.E. Duda, S.M. Quinn, B. Zhang, J.Q. Trojanowski, and V.M. Lee. 2002. Neuronal alpha-
synucleinopathy with severe movement disorder in mice expressing A53T human alpha-synuclein. Neuron
34:521-533.
Goedert, M. 2015. NEURODEGENERATION. Alzheimer's and Parkinson's diseases: The prion concept in relation
to assembled Abeta, tau, and alpha-synuclein. Science 349:1255555.
Goedert, M., M.G. Spillantini, K. Del Tredici, and H. Braak. 2013. 100 years of Lewy pathology. Nature reviews.
Neurology 9:13-24.
Goldberg, M.S., and P.T. Lansbury, Jr. 2000. Is there a cause-and-effect relationship between alpha-synuclein
fibrillization and Parkinson's disease? Nat Cell Biol 2:E115-119.
Gombash, S.E., F.P. Manfredsson, R.J. Mandel, T.J. Collier, D.L. Fischer, C.J. Kemp, N.M. Kuhn, S.L.
Wohlgenant, S.M. Fleming, and C.E. Sortwell. 2014. Neuroprotective potential of pleiotrophin
overexpression in the striatonigral pathway compared with overexpression in both the striatonigral and
nigrostriatal pathways. Gene Ther 21:682-693.
Greten-Harrison, B., M. Polydoro, M. Morimoto-Tomita, L. Diao, A.M. Williams, E.H. Nie, S. Makani, N. Tian,
P.E. Castillo, V.L. Buchman, and S.S. Chandra. 2010. alphabetagamma-Synuclein triple knockout mice
reveal age-dependent neuronal dysfunction. Proc Natl Acad Sci U S A 107:19573-19578.
Gundersen, H.J., E.B. Jensen, K. Kieu, and J. Nielsen. 1999. The efficiency of systematic sampling in stereology--
reconsidered. J Microsc 193:199-211.
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
28
Hagemann, T.L., B. Powers, C. Mazur, A. Kim, S. Wheeler, G. Hung, E. Swayze, and A. Messing. 2018. Antisense
suppression of glial fibrillary acidic protein as a treatment for Alexander disease. Annals of neurology
83:27-39.
Hayashita-Kinoh, H., M. Yamada, T. Yokota, Y. Mizuno, and H. Mochizuki. 2006. Down-regulation of alpha-
synuclein expression can rescue dopaminergic cells from cell death in the substantia nigra of Parkinson's
disease rat model. Biochem Biophys Res Commun 341:1088-1095.
Ibanez, P., S. Lesage, S. Janin, E. Lohmann, F. Durif, A. Destee, A.M. Bonnet, C. Brefel-Courbon, S. Heath, D.
Zelenika, Y. Agid, A. Durr, A. Brice, and G. French Parkinson's Disease Genetics Study. 2009. Alpha-
synuclein gene rearrangements in dominantly inherited parkinsonism: frequency, phenotype, and
mechanisms. Archives of neurology 66:102-108.
Isonaka, R., C. Holmes, G.A. Cook, P. Sullivan, Y. Sharabi, and D.S. Goldstein. 2017. Pure autonomic failure
without synucleinopathy. Clin Auton Res 27:97-101.
Jagmag, S.A., N. Tripathi, S.D. Shukla, S. Maiti, and S. Khurana. 2015. Evaluation of Models of Parkinson's
Disease. Front Neurosci 9:503.
Kingwell, K. 2017. Zeroing in on neurodegenerative alpha-synuclein. Nat Rev Drug Discov 16:371-373.
Klein, R.L., M.A. King, M.E. Hamby, and E.M. Meyer. 2002. Dopaminergic cell loss induced by human A30P
alpha-synuclein gene transfer to the rat substantia nigra. Hum Gene Ther 13:605-612.
Koprich, J.B., N.G. Campbell, and J.W. Lipton. 2003a. Neonatal 3,4-methylenedioxymethamphetamine (ecstasy)
alters dopamine and serotonin neurochemistry and increases brain-derived neurotrophic factor in the
forebrain and brainstem of the rat. Brain Res Dev Brain Res 147:177-182.
Koprich, J.B., E.Y. Chen, N.M. Kanaan, N.G. Campbell, J.H. Kordower, and J.W. Lipton. 2003b. Prenatal 3,4-
methylenedioxymethamphetamine (ecstasy) alters exploratory behavior, reduces monoamine metabolism,
and increases forebrain tyrosine hydroxylase fiber density of juvenile rats. Neurotoxicol Teratol 25:509-
517.
Koprich, J.B., L.V. Kalia, and J.M. Brotchie. 2017. Animal models of alpha-synucleinopathy for Parkinson disease
drug development. Nat Rev Neurosci 18:515-529.
Kordasiewicz, H.B., L.M. Stanek, E.V. Wancewicz, C. Mazur, M.M. McAlonis, K.A. Pytel, J.W. Artates, A. Weiss,
S.H. Cheng, L.S. Shihabuddin, G. Hung, C.F. Bennett, and D.W. Cleveland. 2012. Sustained therapeutic
reversal of Huntington's disease by transient repression of huntingtin synthesis. Neuron 74:1031-1044.
Kruger, R., W. Kuhn, T. Muller, D. Woitalla, M. Graeber, S. Kosel, H. Przuntek, J.T. Epplen, L. Schols, and O.
Riess. 1998. Ala30Pro mutation in the gene encoding alpha-synuclein in Parkinson's disease. Nat Genet
18:106-108.
Kruse, N., and B. Mollenhauer. 2019. Quantification of Alpha-Synuclein in Biological Fluids by
Electrochemiluminescence-Based Detection. Methods Mol Biol 1948:59-68.
Lagier-Tourenne, C., M. Baughn, F. Rigo, S. Sun, P. Liu, H.R. Li, J. Jiang, A.T. Watt, S. Chun, M. Katz, J. Qiu, Y.
Sun, S.C. Ling, Q. Zhu, M. Polymenidou, K. Drenner, J.W. Artates, M. McAlonis-Downes, S. Markmiller,
K.R. Hutt, D.P. Pizzo, J. Cady, M.B. Harms, R.H. Baloh, S.R. Vandenberg, G.W. Yeo, X.D. Fu, C.F.
Bennett, D.W. Cleveland, and J. Ravits. 2013. Targeted degradation of sense and antisense C9orf72 RNA
foci as therapy for ALS and frontotemporal degeneration. Proc Natl Acad Sci U S A 110:E4530-4539.
Lim, Y., V.M. Kehm, E.B. Lee, J.H. Soper, C. Li, J.Q. Trojanowski, and V.M. Lee. 2011. alpha-Syn suppression
reverses synaptic and memory defects in a mouse model of dementia with Lewy bodies. J Neurosci
31:10076-10087.
Ludtmann, M.H.R., P.R. Angelova, M.H. Horrocks, M.L. Choi, M. Rodrigues, A.Y. Baev, A.V. Berezhnov, Z. Yao,
D. Little, B. Banushi, A.S. Al-Menhali, R.T. Ranasinghe, D.R. Whiten, R. Yapom, K.S. Dolt, M.J. Devine,
P. Gissen, T. Kunath, M. Jaganjac, E.V. Pavlov, D. Klenerman, A.Y. Abramov, and S. Gandhi. 2018.
alpha-synuclein oligomers interact with ATP synthase and open the permeability transition pore in
Parkinson's disease. Nat Commun 9:2293.
Luk, K.C., V. Kehm, J. Carroll, B. Zhang, P. O'Brien, J.Q. Trojanowski, and V.M. Lee. 2012. Pathological alpha-
synuclein transmission initiates Parkinson-like neurodegeneration in nontransgenic mice. Science 338:949-
953.
Luna, E., S.C. Decker, D.M. Riddle, A. Caputo, B. Zhang, T. Cole, C. Caswell, S.X. Xie, V.M.Y. Lee, and K.C.
Luk. 2018. Differential alpha-synuclein expression contributes to selective vulnerability of hippocampal
neuron subpopulations to fibril-induced toxicity. Acta Neuropathol 135:855-875.
Martin, L.J., Y. Pan, A.C. Price, W. Sterling, N.G. Copeland, N.A. Jenkins, D.L. Price, and M.K. Lee. 2006.
Parkinson's disease alpha-synuclein transgenic mice develop neuronal mitochondrial degeneration and cell
death. J Neurosci 26:41-50.
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
29
Masliah, E., E. Rockenstein, A. Adame, M. Alford, L. Crews, M. Hashimoto, P. Seubert, M. Lee, J. Goldstein, T.
Chilcote, D. Games, and D. Schenk. 2005. Effects of alpha-synuclein immunization in a mouse model of
Parkinson's disease. Neuron 46:857-868.
Mata, I.F., M. Shi, P. Agarwal, K.A. Chung, K.L. Edwards, S.A. Factor, D.R. Galasko, C. Ginghina, A. Griffith,
D.S. Higgins, D.M. Kay, H. Kim, J.B. Leverenz, J.F. Quinn, J.W. Roberts, A. Samii, K.W. Snapinn, D.W.
Tsuang, D. Yearout, J. Zhang, H. Payami, and C.P. Zabetian. 2010. SNCA variant associated with
Parkinson disease and plasma alpha-synuclein level. Archives of neurology 67:1350-1356.
McLoughlin, H.S., L.R. Moore, R. Chopra, R. Komlo, M. McKenzie, K.G. Blumenstein, H. Zhao, H.B.
Kordasiewicz, V.G. Shakkottai, and H.L. Paulson. 2018. Oligonucleotide therapy mitigates disease in
spinocerebellar ataxia type 3 mice. Annals of neurology 84:64-77.
Miller, D.W., S.M. Hague, J. Clarimon, M. Baptista, K. Gwinn-Hardy, M.R. Cookson, and A.B. Singleton. 2004.
Alpha-synuclein in blood and brain from familial Parkinson disease with SNCA locus triplication.
Neurology 62:1835-1838.
Mollenhauer, B. 2014. Quantification of alpha-synuclein in cerebrospinal fluid: how ideal is this biomarker for
Parkinson's disease? Parkinsonism Relat Disord 20 Suppl 1:S76-79.
Mollenhauer, B., R. Batrla, O. El-Agnaf, D.R. Galasko, H.A. Lashuel, K.M. Merchant, L.M. Shaw, D.J. Selkoe, R.
Umek, H. Vanderstichele, H. Zetterberg, J. Zhang, C. Caspell-Garcia, C. Coffey, S.J. Hutten, M. Frasier, P.
Taylor, and J.F.F.f.P.s.R. Investigating Synuclein Consortium of the Michael. 2017. A user's guide for
alpha-synuclein biomarker studies in biological fluids: Perianalytical considerations. Movement disorders :
official journal of the Movement Disorder Society 32:1117-1130.
Muller, S.K., A. Bender, C. Laub, T. Hogen, F. Schlaudraff, B. Liss, T. Klopstock, and M. Elstner. 2013. Lewy
body pathology is associated with mitochondrial DNA damage in Parkinson's disease. Neurobiol Aging
34:2231-2233.
Mutez, E., F. Lepretre, E. Le Rhun, L. Larvor, A. Duflot, V. Mouroux, J.P. Kerckaert, M. Figeac, K. Dujardin, A.
Destee, and M.C. Chartier-Harlin. 2011. SNCA locus duplication carriers: from genetics to Parkinson
disease phenotypes. Hum Mutat 32:E2079-2090.
Nalls, M.A., N. Pankratz, C.M. Lill, C.B. Do, D.G. Hernandez, M. Saad, A.L. DeStefano, E. Kara, J. Bras, M.
Sharma, C. Schulte, M.F. Keller, S. Arepalli, C. Letson, C. Edsall, H. Stefansson, X. Liu, H. Pliner, J.H.
Lee, R. Cheng, C. International Parkinson's Disease Genomics, G.I. Parkinson's Study Group Parkinson's
Research: The Organized, andMe, GenePd, C. NeuroGenetics Research, G. Hussman Institute of Human, I.
Ashkenazi Jewish Dataset, H. Cohorts for, E. Aging Research in Genetic, C. North American Brain
Expression, C. United Kingdom Brain Expression, C. Greek Parkinson's Disease, G. Alzheimer Genetic
Analysis, M.A. Ikram, J.P. Ioannidis, G.M. Hadjigeorgiou, J.C. Bis, M. Martinez, J.S. Perlmutter, A.
Goate, K. Marder, B. Fiske, M. Sutherland, G. Xiromerisiou, R.H. Myers, L.N. Clark, K. Stefansson, J.A.
Hardy, P. Heutink, H. Chen, N.W. Wood, H. Houlden, H. Payami, A. Brice, W.K. Scott, T. Gasser, L.
Bertram, N. Eriksson, T. Foroud, and A.B. Singleton. 2014. Large-scale meta-analysis of genome-wide
association data identifies six new risk loci for Parkinson's disease. Nat Genet 46:989-993.
Nishioka, K., C. Wider, C. Vilarino-Guell, A.I. Soto-Ortolaza, S.J. Lincoln, J.M. Kachergus, B. Jasinska-Myga,
O.A. Ross, A. Rajput, C.A. Robinson, T.J. Ferman, Z.K. Wszolek, D.W. Dickson, and M.J. Farrer. 2010.
Association of alpha-, beta-, and gamma-Synuclein with diffuse lewy body disease. Archives of neurology
67:970-975.
Nussbaum, R.L., and C.E. Ellis. 2003. Alzheimer's disease and Parkinson's disease. N Engl J Med 348:1356-1364.
Ostergaard, M.E., A.L. Southwell, H. Kordasiewicz, A.T. Watt, N.H. Skotte, C.N. Doty, K. Vaid, E.B. Villanueva,
E.E. Swayze, C.F. Bennett, M.R. Hayden, and P.P. Seth. 2013. Rational design of antisense
oligonucleotides targeting single nucleotide polymorphisms for potent and allele selective suppression of
mutant Huntingtin in the CNS. Nucleic Acids Res 41:9634-9650.
Parnetti, L., C. Cicognola, P. Eusebi, and D. Chiasserini. 2016. Value of cerebrospinal fluid alpha-synuclein species
as biomarker in Parkinson's diagnosis and prognosis. Biomark Med 10:35-49.
Passini, M.A., J. Bu, A.M. Richards, C. Kinnecom, S.P. Sardi, L.M. Stanek, Y. Hua, F. Rigo, J. Matson, G. Hung,
E.M. Kaye, L.S. Shihabuddin, A.R. Krainer, C.F. Bennett, and S.H. Cheng. 2011. Antisense
oligonucleotides delivered to the mouse CNS ameliorate symptoms of severe spinal muscular atrophy. Sci
Transl Med 3:72ra18.
Paumier, K.L., K.C. Luk, F.P. Manfredsson, N.M. Kanaan, J.W. Lipton, T.J. Collier, K. Steece-Collier, C.J. Kemp,
S. Celano, E. Schulz, I.M. Sandoval, S. Fleming, E. Dirr, N.K. Polinski, J.Q. Trojanowski, V.M. Lee, and
C.E. Sortwell. 2015. Intrastriatal injection of pre-formed mouse alpha-synuclein fibrils into rats triggers
alpha-synuclein pathology and bilateral nigrostriatal degeneration. Neurobiology of disease 82:185-199.
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
30
Recasens, A., B. Dehay, J. Bove, I. Carballo-Carbajal, S. Dovero, A. Perez-Villalba, P.O. Fernagut, J. Blesa, A.
Parent, C. Perier, I. Farinas, J.A. Obeso, E. Bezard, and M. Vila. 2014. Lewy body extracts from Parkinson
disease brains trigger alpha-synuclein pathology and neurodegeneration in mice and monkeys. Annals of
neurology 75:351-362.
Rigo, F., P.P. Seth, and C.F. Bennett. 2014. Antisense oligonucleotide-based therapies for diseases caused by pre-
mRNA processing defects. Adv Exp Med Biol 825:303-352.
Rodrigues, F.B., and E.J. Wild. 2018. Huntington's Disease Clinical Trials Corner: February 2018. J Huntingtons
Dis 7:89-98.
Ross, O.A., A.T. Braithwaite, L.M. Skipper, J. Kachergus, M.M. Hulihan, F.A. Middleton, K. Nishioka, J. Fuchs, T.
Gasser, D.M. Maraganore, C.H. Adler, L. Larvor, M.C. Chartier-Harlin, C. Nilsson, J.W. Langston, K.
Gwinn, N. Hattori, and M.J. Farrer. 2008. Genomic investigation of alpha-synuclein multiplication and
parkinsonism. Annals of neurology 63:743-750.
Satake, W., Y. Nakabayashi, I. Mizuta, Y. Hirota, C. Ito, M. Kubo, T. Kawaguchi, T. Tsunoda, M. Watanabe, A.
Takeda, H. Tomiyama, K. Nakashima, K. Hasegawa, F. Obata, T. Yoshikawa, H. Kawakami, S. Sakoda,
M. Yamamoto, N. Hattori, M. Murata, Y. Nakamura, and T. Toda. 2009. Genome-wide association study
identifies common variants at four loci as genetic risk factors for Parkinson's disease. Nat Genet 41:1303-
1307.
Schenk, D.B., M. Koller, D.K. Ness, S.G. Griffith, M. Grundman, W. Zago, J. Soto, G. Atiee, S. Ostrowitzki, and
G.G. Kinney. 2017. First-in-human assessment of PRX002, an anti-alpha-synuclein monoclonal antibody,
in healthy volunteers. Movement disorders : official journal of the Movement Disorder Society 32:211-218.
Scoles, D.R., P. Meera, M.D. Schneider, S. Paul, W. Dansithong, K.P. Figueroa, G. Hung, F. Rigo, C.F. Bennett,
T.S. Otis, and S.M. Pulst. 2017. Antisense oligonucleotide therapy for spinocerebellar ataxia type 2. Nature
544:362-366.
Seth, P.P., G. Vasquez, C.A. Allerson, A. Berdeja, H. Gaus, G.A. Kinberger, T.P. Prakash, M.T. Migawa, B. Bhat,
and E.E. Swayze. 2010. Synthesis and biophysical evaluation of 2',4'-constrained 2'O-methoxyethyl and
2',4'-constrained 2'O-ethyl nucleic acid analogues. J Org Chem 75:1569-1581.
Simon-Sanchez, J., C. Schulte, J.M. Bras, M. Sharma, J.R. Gibbs, D. Berg, C. Paisan-Ruiz, P. Lichtner, S.W.
Scholz, D.G. Hernandez, R. Kruger, M. Federoff, C. Klein, A. Goate, J. Perlmutter, M. Bonin, M.A. Nalls,
T. Illig, C. Gieger, H. Houlden, M. Steffens, M.S. Okun, B.A. Racette, M.R. Cookson, K.D. Foote, H.H.
Fernandez, B.J. Traynor, S. Schreiber, S. Arepalli, R. Zonozi, K. Gwinn, M. van der Brug, G. Lopez, S.J.
Chanock, A. Schatzkin, Y. Park, A. Hollenbeck, J. Gao, X. Huang, N.W. Wood, D. Lorenz, G. Deuschl, H.
Chen, O. Riess, J.A. Hardy, A.B. Singleton, and T. Gasser. 2009. Genome-wide association study reveals
genetic risk underlying Parkinson's disease. Nat Genet 41:1308-1312.
Singleton, A.B., M. Farrer, J. Johnson, A. Singleton, S. Hague, J. Kachergus, M. Hulihan, T. Peuralinna, A. Dutra,
R. Nussbaum, S. Lincoln, A. Crawley, M. Hanson, D. Maraganore, C. Adler, M.R. Cookson, M. Muenter,
M. Baptista, D. Miller, J. Blancato, J. Hardy, and K. Gwinn-Hardy. 2003. alpha-Synuclein locus triplication
causes Parkinson's disease. Science 302:841.
Soldner, F., Y. Stelzer, C.S. Shivalila, B.J. Abraham, J.C. Latourelle, M.I. Barrasa, J. Goldmann, R.H. Myers, R.A.
Young, and R. Jaenisch. 2016. Parkinson-associated risk variant in distal enhancer of alpha-synuclein
modulates target gene expression. Nature 533:95-99.
Spencer, B., E. Valera, E. Rockenstein, C. Overk, M. Mante, A. Adame, W. Zago, P. Seubert, R. Barbour, D.
Schenk, D. Games, R.A. Rissman, and E. Masliah. 2017. Anti-alpha-synuclein immunotherapy reduces
alpha-synuclein propagation in the axon and degeneration in a combined viral vector and transgenic model
of synucleinopathy. Acta Neuropathol Commun 5:7.
Spillantini, M.G., R.A. Crowther, R. Jakes, N.J. Cairns, P.L. Lantos, and M. Goedert. 1998. Filamentous alpha-
synuclein inclusions link multiple system atrophy with Parkinson's disease and dementia with Lewy bodies.
Neuroscience letters 251:205-208.
Spillantini, M.G., M.L. Schmidt, V.M. Lee, J.Q. Trojanowski, R. Jakes, and M. Goedert. 1997. Alpha-synuclein in
Lewy bodies. Nature 388:839-840.
Tabrizi, S.J., B.R. Leavitt, G.B. Landwehrmeyer, E.J. Wild, C. Saft, R.A. Barker, N.F. Blair, D. Craufurd, J. Priller,
H. Rickards, A. Rosser, H.B. Kordasiewicz, C. Czech, E.E. Swayze, D.A. Norris, T. Baumann, I. Gerlach,
S.A. Schobel, E. Paz, A.V. Smith, C.F. Bennett, R.M. Lane, and I.-H.S.S.T. Phase 1-2a. 2019. Targeting
Huntingtin Expression in Patients with Huntington's Disease. The New England journal of medicine
380:2307-2316.
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
31
Tapias, V., X. Hu, K.C. Luk, L.H. Sanders, V.M. Lee, and J.T. Greenamyre. 2017. Synthetic alpha-synuclein fibrils
cause mitochondrial impairment and selective dopamine neurodegeneration in part via iNOS-mediated
nitric oxide production. Cell Mol Life Sci 74:2851-2874.
Tran, H.T., C.H. Chung, M. Iba, B. Zhang, J.Q. Trojanowski, K.C. Luk, and V.M. Lee. 2014. Alpha-synuclein
immunotherapy blocks uptake and templated propagation of misfolded alpha-synuclein and
neurodegeneration. Cell Rep 7:2054-2065.
Uehara, T., C.J. Choong, M. Nakamori, H. Hayakawa, K. Nishiyama, Y. Kasahara, K. Baba, T. Nagata, T. Yokota,
H. Tsuda, S. Obika, and H. Mochizuki. 2019. Amido-bridged nucleic acid (AmNA)-modified antisense
oligonucleotides targeting alpha-synuclein as a novel therapy for Parkinson's disease. Sci Rep 9:7567.
Volpicelli-Daley, L.A., K.C. Luk, and V.M. Lee. 2014. Addition of exogenous alpha-synuclein preformed fibrils to
primary neuronal cultures to seed recruitment of endogenous alpha-synuclein to Lewy body and Lewy
neurite-like aggregates. Nat Protoc 9:2135-2146.
Zarranz, J.J., J. Alegre, J.C. Gomez-Esteban, E. Lezcano, R. Ros, I. Ampuero, L. Vidal, J. Hoenicka, O. Rodriguez,
B. Atares, V. Llorens, E. Gomez Tortosa, T. del Ser, D.G. Munoz, and J.G. de Yebenes. 2004. The new
mutation, E46K, of alpha-synuclein causes Parkinson and Lewy body dementia. Annals of neurology
55:164-173.
Zhao, H.T., N. John, V. Delic, K. Ikeda-Lee, A. Kim, A. Weihofen, E.E. Swayze, H.B. Kordasiewicz, A.B. West,
and L.A. Volpicelli-Daley. 2017. LRRK2 Antisense Oligonucleotides Ameliorate alpha-Synuclein
Inclusion Formation in a Parkinson's Disease Mouse Model. Molecular therapy. Nucleic acids 8:508-519.
Zharikov, A.D., J.R. Cannon, V. Tapias, Q. Bai, M.P. Horowitz, V. Shah, A. El Ayadi, T.G. Hastings, J.T.
Greenamyre, and E.A. Burton. 2015. shRNA targeting alpha-synuclein prevents neurodegeneration in a
Parkinson's disease model. J Clin Invest 125:2721-2735.
Zhou, B., M. Wen, W.F. Yu, C.L. Zhang, and L. Jiao. 2015. The Diagnostic and Differential Diagnosis Utility of
Cerebrospinal Fluid alpha -Synuclein Levels in Parkinson's Disease: A Meta-Analysis. Parkinsons Dis
2015:567386.
Abbreviations
PD – Parkinson’s disease
CNS – central nervous system
mRNA – mature ribonucleic acid
Snca/SNCA – alpha synuclein rodent/human gene, respectively
aSyn - alpha synuclein protein
LB – Lewy body
LN – Lewy neurite
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
32
ASO – antisense oligonucleotide
PFF – pre-formed fibril
CSF - cerebrospinal fluid
NHP – non-human primate
MSA - multiple systems atrophy
DLBD - Diffuse Lewy body disease
GD – Gaucher disease
PAF - pure autonomic failure
TH+ – tyrosine hydroxylase positive
DA – dopamine
SN – substantia nigra
IHC – immunohistochemistry
pSer129+ aggregates – phospho serine 129 positive aggregates
Figures:
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
33
Fig. 1. ASO-mediated reduction of Snca improves cellular function in cells and prevents
pathogenic aSyn aggregate deposition in an in vivo PFF model of PD. (A) Quantification of
pSer129+ area by intensity in mouse primary cortical cultures and (B) cellular function, by
γH2AX Ser139, in mouse primary cortical cultures with either PBS, CTL ASO, or ASO1 30
minutes following PFF addition. Replicated 2 times. (C) Timeline for single 700µg ICV bolus
ASO administration prior to PFF injection paradigm with termination at day 56. (D to E) mRNA
reduction by RT-PCR in striatum and midbrain. (F) Quantification of pSyn+ aggregate reduction
(total enumeration) in the substantia nigra by IHC. (G) Representative images of
immunostaining (IHC) for pSer129+ aggregate counts. (H) Performance on a wire hang task
(n=4, 12 and 11 for naïve, PBS and ASO1, respectively, except wire hang, in which n=12 for
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
34
naive). Error bars represent ± s.e.m. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 (Two-way
ANOVA with Tukey post hoc analyses for duration of action with all other analyses using One-
way ANOVA with Tukey post hoc analyses). PFF (pre-formed fibril), TRMT(treatment).
Fig. 2. ASO-mediated reduction of Snca is dose-responsive, exhibits a prolonged duration of
action, and dose-responsively prevents pathogenic aSyn aggregate deposition in an in vivo PFF
model of PD. (A to C) 3 week dose response of rat Snca levels from cortical, striatal, and
midbrain rat samples by RT-qPCR (n=8 per dose). (D) Timeline for ASO dose response
administration prior to PFF injection paradigm. (E) Quantification of immunostaining for
pSer129+ aggregate counts by total enumeration (n=6, 7, 5, 8, 8 for PBS, 100 µg, 300 µg, 1000
µg, and CTL ASO). (F) Representative images of pSer129+ aggregate counts in the substantia
nigra. (Scale bar = 100 μm). Error bars represent ± s.e.m. *P<0.05, **P<0.01, ***P<0.001,
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
35
****P<0.0001 (Two-way ANOVA with Tukey post hoc analyses for duration of action with all
other analyses using One-way ANOVA with Tukey post hoc analyses). PFF (pre-formed fibril),
TRMT(treatment), CTL ASO (Control ASO)
Fig. 3. ASO-mediated suppression of Snca prevents dopaminergic cell dysfunction in an in
vivo PFF model of PD. (A) Time course of Snca mRNA reduction (the same 1000 µg results for
the three week time point in (Fig. 2 A to C) are included. (B to E) Results from ASO
administration (1000 µg) prior to PFF injection paradigm in rats with study termination at 181
days. (B) Timeline for ASO administration prior to PFF injection paradigm in rats. (C) pSer129+
aggregate counts using total enumeration by IHC (n=13, 13, 15 for PBS, ASO1, and CTL ASO,
respectively) (D) dopaminergic cell counts by IHC (by stereology) (n=13, 13, 12 for PBS,
ASO1, and CTL ASO, respectively), and (E) striatal dopamine levels by HPLC (n=13, 13, 14 for
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
36
PBS, ASO1, and CTL ASO, respectively) Data are ± s.e.m. *P<0.05, **P<0.001, ***P<0.0001,
****P<0.00001 (one-way ANOVA with Tukey post hoc analyses). PFF(pre-formed fibril),
TRMT(treatment), CTL ASO(Control ASO).
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
37
Fig. 4. Pathogenic aSyn aggregate deposition is reversible and its amelioration reduces TH loss.
(A) Timeline for ASO administration after PFF injection paradigm in the mouse. (B and C)
mRNA reduction by RT-PCR, (n=12, 10, 10 for naïve, PBS, ASO1) (D) Quantification of
aggregate reduction in the substantia nigra by IHC, (n=4, 10, 10 for naïve, PBS, and ASO1) and
(E) performance on a wire hang task (n= 10, 10, 10 for naïve, PBS, ASO1, respectively). (A and
B) Results from ASO administration after PFF injection with study termination at 60 and 81 days
post PFF injection in the rat. (F) Timeline for ASO administration (1000 µg) for G to I. (G)
Quantification of Snca mRNA reduction in the midbrain at each time point (H) Quantification of
immunostaining for pSer129+ aggregate counts and (I) representative images from the insular
cortex (n=10, 9, 9, 9, 10 for PFF only, PBS 60 days, ASO1 60 days, PBS 81 days, and ASO1 81
days (PBS at 60 days = 8). (J to M) Results from ASO administration (1000 µg) with study
termination at 181 days. (D) Timeline for ASO administration for K to M. (K) TH+ cell counts
by IHC (by stereology, (n=12, 11, 14 for PBS, ASO1, and CTL ASO, respectively) (L)
Quantification of pSer129+ aggregate counts in the substantia nigra by IHC, (n=13, 12, 12 for
PBS, ASO1, and CTL ASO, respectively) and (M) striatal dopamine levels by HPLC (n=13, 12,
14 for PBS, ASO1, and CTL ASO, respectively). Data are ± s.e.m. *P<0.05, **P<0.001,
***P<0.0001, ****P<0.00001. (one-way ANOVA with Tukey post hoc analyses). PFF(pre-
formed fibril), TRMT(treatment), CTL ASO(Control ASO).
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
38
Fig. 5. Sustained reduction of Snca with ASO administered after aggregates are established
reduces aggregate pathology and prevents TH loss. (A to F) Results from ASO administration
prior to PFF injection paradigm with sustained suppression and study termination at 224 days
post PFF injection in mice. (A) Timeline for ASO administration (700µg) prior to PFF injection
paradigm. (B and C) mRNA reduction in the striatum and midbrain. pSer129+ aggregate counts
quantified by IHC in (D) neurites and (E) cell bodies. (F) Dopaminergic cell counts quantified
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
39
by IHC. (n=12 for PBS and ASO1) (n=6 for immunohistochemistry endpoints). (G to K)
Results from ASO administration after PFF injection paradigm with sustained suppression and
study termination at 224 days post PFF injection in mice. (700 µg). (G) Timeline for ASO
administration (700µg) after to PFF injection paradigm. (H and I) mRNA reduction in the
striatum and midbrain. pSer129+ aggregate counts quantified by IHC in (J). (K) Dopaminergic
cell counts quantified by IHC. (n=4). Data are ± s.e.m. *P<0.05, **P<0.001, ***P<0.0001,
****P<0.00001. (one-way ANOVA with Tukey post hoc analyses). PFF(pre-formed fibril),
TRMT(treatment), CTL ASO(Control ASO).
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
40
Fig. 6. Human SNCA ASOs are potent, suppress aSyn broadly in the primate CNS and CSF aSyn
is a suitable pharmacodynamic biomarker. In vitro dose response of human SNCA hASO1 and
hASO2 in (A and C) SHSY5Y cells and (B and D) in vivo dose response in SNCA-PAC mouse
cortex 2 weeks post injection (n=10 except 700 µg n=7 for hASO1) (n=8 for for hASO2 (2 mice
removed with ROUT analysis from 300 µg and 700 µg groups, combination of two studies of
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
41
n=4 each, n=12 for all PBS groups). (E and F) mRNA by RT-PCR and (G and H) protein by
ELISA throughout the brain and spinal cord of the NHP (n=4 for PBS, hASO1, and hASO2). (I)
Representative images for IHC (ASO and aSyn antibody) or ISH (SNCA mRNA). Scale bar =
600 µm for protein/300 µm for ASO and ISH results. (J) Quantification of aSyn protein by
ELISA in CSF with (K) correlation of aSyn protein levels in the frontal cortex and CSF (n=2, 3,
and 4 for PBS, hASO1, and hASO2). Data are ± s.e.m except for SHSY5Y, which are StDev.
*P<0.05, **P<0.001, ***P<0.0001, ****P<0.00001. (One-way ANOVA with Tukey post hoc
analyses).
Table 1. Table of Snca/SNCA ASOs used for in vivo testing.
Supplementary Material Titles
Fig. S1. ASO1 and ASO2 administration prior to PFF injection result in mRNA reduction and
pSer129+ aggregate reduction in multiple rat studies.
Fig. S2. Snca mRNA reduction and contralateral TH positive cell counts, from single dose rat
ASO administration prior to PFF injection study.
Fig S3. Human SNCA ASOs exhibit concentration dependent reduction and a long duration of
action.
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint
42
Fig. S4. Representative images for IHC (anti-ASO and aSyn antibodies) or ISH (SNCA mRNA)
for motor cortex from NHP (cynomolgus) experiment.
not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (which wasthis version posted November 4, 2019. . https://doi.org/10.1101/830554doi: bioRxiv preprint