heart failure - circulationcirc.ahajournals.org/content/126/14/1705.full.pdf · clinical trials...

Heart Failure

Carnitine Palmitoyltransferase-1b Deficiency AggravatesPressure Overload–Induced Cardiac Hypertrophy Caused

by LipotoxicityLan He, MD, PhD; Teayoun Kim, PhD; Qinqiang Long, PhD; Jian Liu, MD, PhD;

Peiyong Wang, MD, PhD; Yiqun Zhou, PhD; Yishu Ding, MD; Jeevan Prasain, PhD;Philip A. Wood, PhD; Qinglin Yang, MD, PhD

Background—Carnitine palmitoyltransferase-1 (CPT1) is a rate-limiting step of mitochondrial �-oxidation by controllingthe mitochondrial uptake of long-chain acyl-CoAs. The muscle isoform, CPT1b, is the predominant isoform expressedin the heart. It has been suggested that inhibiting CPT1 activity by specific CPT1 inhibitors exerts protective effectsagainst cardiac hypertrophy and heart failure. However, clinical and animal studies have shown mixed results, therebycreating concerns about the safety of this class of drugs. Preclinical studies using genetically modified animal modelsshould provide a better understanding of targeting CPT1 to evaluate it as a safe and effective therapeutic approach.

Methods and Results—Heterozygous CPT1b knockout (CPT1b�/�) mice were subjected to transverse aorta constriction–induced pressure overload. These mice showed overtly normal cardiac structure/function under the basal condition.Under a severe pressure-overload condition induced by 2 weeks of transverse aorta constriction, CPT1b�/� mice weresusceptible to premature death with congestive heart failure. Under a milder pressure-overload condition, CPT1b�/�

mice exhibited exacerbated cardiac hypertrophy and remodeling compared with wild-type littermates. There were morepronounced impairments of cardiac contraction with greater eccentric cardiac hypertrophy in CPT1b�/� mice than incontrol mice. Moreover, the CPT1b�/� heart exhibited exacerbated mitochondrial abnormalities and myocardial lipidaccumulation with elevated triglycerides and ceramide content, leading to greater cardiomyocyte apoptosis.

Conclusions—CPT1b deficiency can cause lipotoxicity in the heart under pathological stress, leading to exacerbation ofcardiac pathology. Therefore, caution should be exercised in the clinical use of CPT1 inhibitors. (Circulation. 2012;126:1705-1716.)

Key Words: carnitine palmitoyltransferase-1b � heart failure � hypertrophy � lipotoxicity

The heart is an energy-demanding organ relying on fattyacid and glucose oxidation. Long-chain fatty acids con-

tribute up to 70% of the energy required by an adult heart tofunction under normal physiological conditions (see else-where for review1,2). The remaining energy needs are derivedmainly from glucose. A failing heart usually shows impairedtranscription of key enzymes involved in fatty acid metabo-lism.1–5 Consequently, the heart switches to use glucose as themain fuel. Nevertheless, whether this substrate use shift isadaptive or maladaptive remains controversial. Several pre-clinical and clinical studies showed beneficial effects byinhibiting various steps of fatty acid oxidation (FAO) inanimal and human subjects with cardiac hypertrophy andheart failure.6–10 Meanwhile, others reported adverse effectsof drugs that exert inhibiting effects on FAO in animalstudies,11–13 raising safety concerns about this class of drugs.

Nevertheless, it remains unclear whether the adverse effectsare derived from attenuated FAO in the heart or fromnonspecific confounding effects of a particular compound.

Clinical Perspective on p 1716Carnitine palmitoyltransferase-1 (CPT1) is located within

the mitochondrial outer membrane as a rate-limiting enzymeof mitochondrial �-oxidation by controlling mitochondrialentry of long-chain fatty acids. CPT1b is one of the 3 CPT1isoforms (CPT1a, CPT1b, and CPT1c). It is expressed mainlyin skeletal muscle, heart, brown adipose tissue, and testis.14,15

In adult cardiomyocytes, CPT1b is the predominant isoformand contributes �98% of total cardiac CPT1 activity.16,17

CPT1 is a major target for metabolic therapies aiming toimprove cardiac performance in patients with cardiac hyper-trophy and heart failure by suppressing FAO. Small-scale

Received November 9, 2011; accepted August 17, 2012.From the Departments of Nutrition Sciences (L.H., T.K., Q.L., J.L., P.W., Y.Z., Q.Y., Y.D.) and Pharmacology (J.P.), University of Alabama at

Birmingham, and Sanford-Burnham Medical Research Institute at Lake Nona, Orlando, FL (P.A.W.).The online-only Data Supplement is available with this article at http://circ.ahajournals.org/lookup/suppl/doi:10.1161/CIRCULATIONAHA.

111.075978/-/DC1.Correspondence to Qinglin Yang, MD, PhD, Department of Nutrition Sciences, University of Alabama at Birmingham, 1675 University Blvd, Webb

435, Birmingham, AL 35294-3360. E-mail [email protected]© 2012 American Heart Association, Inc.

Circulation is available at http://circ.ahajournals.org DOI: 10.1161/CIRCULATIONAHA.111.075978

1705

by guest on May 31, 2018

http://circ.ahajournals.org/D

ownloaded from

by guest on M

ay 31, 2018http://circ.ahajournals.org/

Dow

nloaded from



ownloaded from

by guest on M


Dow

nloaded from



ownloaded from

by guest on M


Dow

nloaded from



ownloaded from

by guest on M


Dow

nloaded from



ownloaded from

by guest on M


Dow

nloaded from



ownloaded from

by guest on M


Dow

nloaded from

http://circ.ahajournals.org/lookup/suppl/doi:10.1161/CIRCULATIONAHA.111.075978/-/DC1

http://circ.ahajournals.org/lookup/suppl/doi:10.1161/CIRCULATIONAHA.111.075978/-/DC1

http://circ.ahajournals.org/












clinical trials reported beneficial effects of CPT1 inhibitors intreating heart failure patients. Specific CPT1 inhibitors suchas etomoxir have been actively pursued as a therapeuticagent.18,19 On the other hand, animal studies showed mixedresults, from beneficial to unchanged to harmful effects onpressure overload–induced cardiac dysfunction, hypertrophy,and progression to end-stage failure.11,20–22 A major hurdle isto differentiate the specific CPT1 inhibition effects fromnonspecific off-target effects. Studies on animal models withgenetic manipulation should help identify the CPT1 effectwithout potential confounding effects from a compound. Thehomozygous CPT1b knockout mice exhibit embryonic lethal-ity, whereas the heterozygous CPT1b- deficient mice show noapparent phenotypic change.23 The present study was de-signed to determine whether partial CPT1b deficiency in theheterozygous CPT1b knockout mice is beneficial or detri-mental to cardiac structure/function under physiological andpathological conditions.

MethodsAn expanded Methods section is available in the online-onlyData Supplement.

Experiment AnimalsHeterozygous CPT1b�/� knockout mice were generated as de-scribed previously.23 Wild-type (WT) littermates with CPT1b�/�

genotyping were used as controls. Both male and female mice wereused. Mice were kept on a 12-hour/12-hour light/dark cycle intemperature-controlled rooms and had ad libitum access to water andstandard rodent diet. All experimental procedures were conducted inaccordance with the Guide for Care and Use of Laboratory Animalsand approved by the Institutional Animal Care and Use Committeeof the University of Alabama at Birmingham.

CPT1 Activity AssayA modified mitochondrial CPT1 assay was used by measuring therate of formation of palmitoylcarnitine from palmitoyl-CoA pluscarnitine according to the method described in detail in the Methodssection in the online-only Data Supplement.

Echocardiography MeasurementEchocardiographic measurement was performed with the high-resolution echocardiography analysis system for small animals(Vevo 770 imaging system, Visual Sonics). Mice were anesthetizedby inhalation with isoflurane and O2. A 2-dimensional short-axisview and M-mode tracings of the left ventricle (LV) were obtainedwith a 30-MHz transducer.

Isolated Working Mouse Heart PerfusionsMyocardial contractile function and metabolism under basal physi-ological conditions were determined ex vivo through isolated work-ing heart perfusions as previously described.24 All hearts wereperfused in the working mode in a nonrecirculating manner with apreload of 8.0 mm Hg and an afterload of 55 mm Hg. Radiolabeledtracers were used to monitor glucose oxidation and palmitateoxidation, as specified in individual experiments described previ-ously.24 For hypertrophied hearts subjected to pressure overloadinduced by transverse aorta constriction (TAC), the isolated mito-chondria were used to assay FAO rate, and heart homogenates wereused to assay glucose oxidation rate. Details on the TAC procedureand palmitate and glucose oxidation assays are given in the online-only Data Supplement.

Heart Ceramide AssayCeramide species were quantified by electrospray ionization–massspectrometry/mass spectrometry (ESI-MS/MS, Applied Biosystems/MDS SCIEX, Canada) as described in the online-only DataSupplement.

Mitochondrial DNA Copy Number AnalysisTotal genomic DNA was isolated from LVs, processed by standardprocedures with a DNA extraction kit (Wizard), and subjected toreal-time quantitative polymerase chain reaction (PCR) analysis.Cytochrome b (Cyto b) was used as a mitochondrial DNA (mtDNA)marker, and the regulator of calcineurin 1 (Rcan1) was used as anuclear DNA marker. The relative copy number of mtDNA wasassessed by the amplicon within a mitochondrial gene (Cyto b) tothat of a nuclear gene (Rcan 1).

Quantitative Real-Time ReverseTranscriptase–PCR AnalysesQuantitative real-time reverse transcriptase–PCR analyses were car-ried out with the Step 1 real-time PCR system (Applied Biosystems).Results from each gene/primer pair were normalized to �-actin andcompared across conditions. The sequences of the primers are listedin Table I in the online-only Data Supplement.

Western Blot AnalysesWestern blots were conducted with commercially available antibod-ies. The immunoblotting images were captured with KODAK imageStation 4000R (Carestream Health Inc) by developing the mem-branes in Supersignal West substrates (Thermo Scientific) andanalyzed with KODAK IM software (version 4.5.1).

Statistical AnalysesData for 2-group comparisons were analyzed with the nonparametricStudent t test; otherwise, data were analyzed by 1-factor or mixed,2-factor ANOVA using GraphPad Prism software (GraphPad Soft-ware Inc). Survival data were analyzed with the Kaplan-Meiermethod using GraphPad Prism software. Values of quantitativeresults were expressed as mean�SEM. Differences between groupsand treatments were regarded as significant at P�0.05.

ResultsMice With Heterozygous CPT1b Knockout(CPT1b�/�) Exhibit No Cardiac Phenotype Underthe Basal ConditionThe CPT1b�/� mice were generated as described previously.23

Although the homozygous CPT1b�� mice were embryoni-cally lethal, the heterozygous CPT1b�/� mice were overtlynormal with the same lifespan as their WT littermates. Heartweight, body weight, and ratio of heart to body weight werenot different between the CPT1b�/� mice and their WTlittermates (Figure I in the online-only Data Supplement).CPT1b�/� mice did not exhibit detectable changes in cardiachistology and function (Figure II in the online-only DataSupplement). Real-time PCR revealed that CPT1b transcriptexpression was attenuated by �50% in CPT1b�/� relative toWT hearts (Figure 1A). Western blots revealed that CPT1bprotein content in the heart was correspondingly decreased by�50% in CPT1b�/� relative to WT hearts (Figure 1B).CPT1a, a dominant CPT1 isoform in neonatal hearts,25 couldhave been reupregulated in response to CPT1b deficiency inthe heart. However, quantitative PCR illustrated no change in

1706 Circulation October 2, 2012



ownloaded from


CPT1a expression in the CPT1b-deficient heart (Figure 1C).Total CPT1 activity in CPT1b�/� hearts was substantiallydecreased to �73% of that in WT hearts (Figure 1D). Despitethe significant CPT1b deficiency in the heart, echocardio-graphic assessment revealed normal anatomic structure of theheart with comparable cardiac performance in the CPT1b�/�

and WT hearts (Figure III and Table II in the online-only DataSupplement). Isolated working heart measurements of exvivo cardiac function revealed no difference between theCPT1b mice and their WT littermates (Table III in theonline-only Data Supplement). Both cardiac contractility(dP/dtmax) and relaxation (dP/dtmin) in CPT1b�/� heartswere similar to those in WT controls. Interestingly, the ratesof FAO and glucose oxidation were not changed inCPT1b�/� hearts. Therefore, these results indicate that amodest CPT1b deficiency in the heart is not sufficient tocause cardiac dysfunction under a basal physiologicalcondition.

CPT1 Deficiency Aggravates Cardiac Hypertrophyand Dysfunction Induced by Pressure OverloadThe absence of phenotypic changes in the CPT1b�/� heartprovides an ideal animal model to determine whether apartially reduced CPT1 activity can prevent cardiac patho-logical development under pathological stress conditions.Adult mice were subjected to TAC-induced LV pressureoverload. The CPT1b�/� mice were dramatically more sus-ceptible to a severe pressure-overload condition induced by 3weeks of TAC than their WT littermates. The majority of theCPT1b�/� mice died before the 2-week term of pressure

overload with signs of heart failure (dilated heart, effluence,shortness of breath, etc), whereas WT littermates survived(Figure 2A). Under a milder pressure-overload condition,with a similar level of pressure gradient (the Table), theCPT1b�/� mice showed more pronounced cardiac hypertro-phy than their WT littermates. Echocardiographic assessmentshowed that left posterior wall thickness at diastole, LVdimension volume at systole, and LV mass were furtherincreased in CPT1b�/� mice. Stroke volume, cardiac output,ejection fraction, and fractional shortening were furtherdecreased in CPT1b�/� mice (the Table and Figure 2B–2E).Ratios of heart weight to body weight and heart weight totibia length were increased in CPT1b�/� mice compared withWT hearts (Figure 3A and 3B). Furthermore, quantitativePCR revealed that cardiac expression of molecular markers ofcardiac hypertrophy such as natriuretic peptide precursor Aand B (Nppa and Nppb) and myosin heavy chain-� wasincreased more in CPT1b�/� mice than in their WT litter-mates (Figure 3C). In addition, hematoxylin and eosin andtrichrome blue staining on heart sections demonstrated in-creased cross-sectional area of cardiomyocytes and morepronounced fibrosis in CPT1b�/� mice than in their WTlittermates (Figure 4A–4D). Transmission electron micro-scope (TEM) assessment illustrated a dramatically increasednumber of swelling mitochondrial with the loss of matrix anda reduced overall mitochondrial volume in heart sections ofCPT1b�/� mice after TAC (Figure 4E and 4F). Therefore,these results demonstrate that CPT1b deficiency is detrimen-tal in hearts under mechanical stress–induced cardiac hyper-trophy and heart failure.

Figure 1. Carnitine palmitoyltransferase-1b (CPT1b) mRNA level and activity in CPT1b�/� mice. Mice were euthanized at 12 to 14weeks of age. RNA samples were extracted from ventricular tissues. A and C, Transcript levels of CPT1b and CPT1a were determinedby quantitative polymerase chain reaction; results from each gene/primer pair were normalized to �-actin (n�4). B, Protein expressionwas determined by Western blot (n�4). D, CPT1 activity was measured using isolated mitochondria according to the method describedin the online-only Data Supplement (n�4). E and F, Palmitate oxidation rate and glucose oxidation rate were measured in isolatedworking heart (n�6). *P�0.05 vs wild-type (WT).

He et al CPT1b�/� Aggravates TAC-Induced Hypertrophy 1707



ownloaded from


CPT1b Deficiency in Hearts Under PressureOverload Leads to IncreasedCardiomyocyte ApoptosisApoptosis has been shown to be one of the major patho-logical events involved in the development of cardiac

hypertrophy and heart failure induced by pressure over-load.26 –28 We investigated whether more pronounced car-diomyocyte apoptosis in the CPT1b-deficient heart isattributed to the exacerbated pathological development. Ter-minal deoxynucleotidyl transferase dUTP nick-end labeling

Figure 2. Echocardiographic parameters of the mice with pressure overload. Mice were subjected to transverse aorta constriction(TAC) procedures at 10 to 12 weeks of age. A, Kaplan-Meier survival curves for wild-type (WT) and CPT1b�/� mice that were subjectedto severe TAC-induced pressure overload. The survival curves were statistically different (P�0.05) by log-rank test. B through E, Micewere subjected to modest TAC at 10 to 12 weeks of age. Representative echocardiographic images of M-mode measurement andechocardiographic results of ejection fraction, fractional shortening, and corrected ratio of left ventricular (LV) mass to body weight (2weeks after TAC; *P�0.05 vs sham, #P�0.05 vs WT TAC; sham, n�9; TAC, n�11).

Table. Echocardiography Measurement in Mice 2 Weeks After Transverse Aorta Constriction

Parameters

WT CPT1b�/�

Sham (n�9) TAC (n�11) Sham (n�9) TAC (n�11)

Pressure gradient, mm Hg NA 54.91�6.28 NA 52.02�7.94

IVSd, mm 0.81�0.17 1.21�0.13* 0.75�0.08 1.24�0.16*

IVSs, mm 1.13�0.08 1.39�0.23* 1.33�0.05 1.42�0.17*

LVIDd, mm 3.79�0.36 4.02�0.24 3.82�0.35 3.90�0.26

LVIDs, mm 2.71�0.40 3.04�0.28* 2.65�0.30 3.23�0.27*

LVPWd, mm 0.72�0.18 1.09�0.19* 0.75�0.16 1.31�0.26*†

LVPWs, mm 1.03�0.19 1.41�0.11* 1.04�0.15 1.52�0.29*

LVIDd VOL, �L 65.27�12.03 76.15�12.02* 65.28�11.06 70.89�10.92

LVIDs VOL, �L 25.18�7.26 33.40�5.88* 23.14�6.56 41.61�9.06*†

Stroke volume, �L 40.11�7.24 41.88�8.54 42.14�5.95 29.28�7.70*†

Cardiac output, mL/min 17.64�2.87 17.40�2.97 18.62�2.95 13.65�4.94*†

WT indicates wild type; IVSd, diastolic interventricular septal wall thickness; IVSs, systolic interventricular septalwall thickness; LVIDd, diastolic left ventricular dimension; LVIDs, systolic left ventricular dimension; LVPWd, diastolicleft ventricular posterior wall thickness; LVPWs, systolic left ventricular posterior wall thickness; LVIDd VOL, diastolicleft ventricular dimension estimated left ventricular volume; and LVIDs VOL, systolic left ventricular dimensionestimated left ventricular volume.

*P�0.05 vs sham.†P�0.05 vs WT TAC.




ownloaded from


(TUNEL) assay on frozen heart sections revealed an in-creased number of TUNEL-positive cardiac myocytes onsections from CPT1b�/� hearts (Figure 5A and 5B). Westernblot analysis on fractionated protein samples revealed thatcytochrome c in the cytosol protein samples of CPT1b�/�

hearts after TAC was markedly increased compared with thatof WT controls (Figure 5C). Therefore, these results indicatethat apoptosis is more pronounced in CPT1b�/� relative toWT hearts under the TAC condition.

Pressure Overload in CPT1b�/� Hearts Leads toMyocardial Lipid AccumulationBecause CPT1b is a key enzyme for the entry of long-chainfatty acids into the mitochondria, we investigated whetherCPT1b deficiency in the heart leads to myocardial triglycer-ide accumulation. Although no change could be detectedunder basal conditions, myocardial triglyceride concentrationwas markedly increased in CPT1b�/� relative to WT heartssubjected to TAC (Figure 6A). Oil Red O staining on frozenheart sections demonstrated numerous lipid droplets onCPT1b�/� but not on WT heart sections (Figure 6B). Wefurther investigated whether myocardial ceramide content isaltered with the myocardial accumulation of triglycerides inthe CPT1b heart. Mass spectroscopic assessment of the totalceramide and ceramide species composition revealed thattotal ceramide content in CPT1b�/� hearts was substantiallyelevated compared with WT controlled hearts (Figure 6C).C16, C18, and C24 were the ceramide species markedlyincreased in CPT1b-deficient hearts (Figure 6D).

Expression of Proteins Involved in Fatty AcidUptake Is Further Downregulated in CPT1b�/�

Hearts Under Pressure OverloadTo assess whether TAC-induced stress triggers the release offree fatty acids from adipose tissues, we measured the serumcontent of free fatty acids. As expected, serum free fatty acidswere modestly increased in both WT and CPT1b�/� mice

subjected to TAC at various time points (Figure IV in theonline-only Data Supplement). The increased serum free fattyacids under TAC condition may contribute to myocardiallipid accumulation in CPT1b-deficient hearts by enhancingfatty acid uptake through peroxisomal proliferator-activatedreceptor (PPAR) � and PPAR� activation. The expression ofPPAR target genes involved in long-chain fatty acid uptake ortransport was measured. We found that CD36, the heart-typefatty acid–binding protein, and fatty acid transport protein-1were unchanged under basal conditions but decreased inCPT1b-deficient heart subjected to pressure overload (Figure7A and 7B). Therefore, it is not likely that myocardial lipidaccumulation in CPT1b�/� hearts is a result of an upregula-tion of long-chain fatty acid uptake.

Mitochondrial Biogenesis Is Decreased inCPT1b�/� Hearts Under Pressure OverloadIt has been reported that myocardial lipid accumulation maybe associated with impaired mitochondrial biogenesis.29

Quantitative PCR revealed that the transcript levels of repre-sentative mitochondria proteins such as mitofusin 2, Cyto b,cytochrome c oxidase subunit II and III, and dynamin-relatedprotein-1 were substantially attenuated (Figure 7C). More-over, transcription factors that are essential for mitochondrialbiogenesis such as transcription factor A, mitochondrial(TFAM), nuclear respiratory factors 1 and 2, and peroxisomeproliferator-activated receptor-� coactivator 1�/� (PGC-1�

and PGC-1�) were all decreased in CPT1b�/� hearts (Figure7C). Protein contents of PGC-1� and TFAM were similarlydownregulated in CPT1b�/� relative to WT hearts (Figure7D). Mitochondria DNA copy number was also reduced inCPT1b�/� hearts (Figure 7E). Thus, CPT1b deficiency andsubsequent lipid accumulation are associated with a reductionin mitochondrial biogenesis in the heart under pressure-overload conditions.

Figure 3. Transcript levels of molecularmarkers of pathological cardiac hyper-trophy in CPT1b�/� mice with pressureoverload. Mice were subjected to amodest pressure-overload condition at10 to 12 weeks of age and euthanized 2weeks after transverse aorta constriction(TAC). A and B, Ratio of heart weight(mg) to body weight (g) and heart weight(mg) to tibia length (mm). *P�0.05 vssham (n�6); # P�0.05 vs wild-type (WT)TAC (n�13). C, Real-time polymerasechain reaction assessment of natriureticpeptide precursor A (Nppa) and B(Nppb) and myosin heavy chain-�(MHC-�) transcripts. *P�0.05 vs sham;#P�0.05 vs WT TAC (n�5).




ownloaded from


Figure 4. Cardiac histology and ultrastructure in CPT1b�/� mice with pressure overload. Mice were subjected to transverse aorta con-striction (TAC) procedures at 10 to 12 weeks of age and euthanized 2 weeks after TAC. A, Representative histological images (�400)with hematoxylin and eosin staining on a heart section. B, Relative cross-sectional areas. The mean cardiomyocyte cross-sectionalarea in sham wild-type (WT) mice was set as 1. *P�0.05 vs sham; #P�0.05 vs WT TAC (n�6). C, Representative images of heart sec-tions stained with Trichrome blue. D, Relative fibrosis areas. The whole section area was set as 100%. E, Representative images of leftventricular transmission electron microscope (TEM) assessment (�1100). F, Quantification results of mitochondrial volume (%) of heartsections from transmission electron microscope images. *P�0.05 vs sham; #P�0.05 vs WT TAC (n�8).




ownloaded from


Fatty Acid Oxidation Is Impaired in CPT1b�/�

Hearts Under Pressure OverloadTo investigate how CPT1b deficiency affects myocardialsubstrate use under the TAC-induced pressure-overload con-dition, we assessed the rates of FAO and glucose oxidation incardiac samples 3 days, 1 week, and 2 weeks after TAC.Interestingly, mitochondrial FAO was increased in WT butnot in CPT1b�/� hearts at all 3 time points after TAC (Figure8A). On the other hand, the glucose oxidation rate in cardiachomogenates was not changed at the earlier time points butwas increased in CPT1b�/� compared with WT hearts at 2weeks after TAC (Figure 8B). CPT1 activity assay showedthat mitochondrial CPT1 activity was modestly but signifi-cantly increased at all 3 time points in WT hearts with TAC.However, CPT1 activity was increased at 3 days but wasdecreased at 1 and 2 weeks after TAC in CPT1b�/� heartscompared with sham hearts for the same time points (Figure8C). Similarly, CPT1b expression remained �50% lower inboth transcript and protein levels in CPT1b�/� hearts than inWT hearts (Figure 8E and 8F).

DiscussionWe investigated the effects of CPT1b deficiency on thepathological development of cardiac hypertrophy and remod-eling under the LV pressure-overload condition in mice. Wepreviously demonstrated cardiac hypertrophy in mice withother FAO enzyme deficiencies, which is most predominantin homozygous long-chain acyl-CoA dehydrogenase defi-ciency.30 The most important finding based on the geneticmouse model of CPT1b deficiency is that CPT1b deficiencycauses lipotoxicity in the heart under the pressure-overloadcondition and leads to exacerbated cardiac pathology.

CPT1b, the predominant CPT1 isoform expressed in theheart, plays an essential role in myocardial FAO. Repressingmyocardial FAO has been proposed as a therapeutic target toimprove cardiac efficiency in the failing heart. Inhibitors ofCPT1 have already been developed and tested in preclinicalanimal studies and small clinical trials.18,19 However, theyremain controversial because of mixed results from animalstudies. Schwarzer et al showed that etomoxir failed toreverse pressure overload–induced heart failure in vivo.Strikingly, the most studied compound, etomoxir, has beenshown to exert adverse effects that eventually lead to cardiachypertrophy.31–34 It was proposed that etomoxir treatmentmay induce cardiac hypertrophy via increased cellular oxida-tive stress and nuclear factor-�B activation.12 Wolkowicz etal11 showed that another CPT1 inhibitor, 2-tetradecylglycidicacid, induces myocardial hypertrophy via the AT1 receptor.

It is clear that the potential adverse effects of CPT1inhibitors may not be just a nonspecific side effect. They maybe associated with the irreversible inhibition of CPT1 activityin the heart. The present study provides evidence to supportthat partial CPT1b deficiency in a mouse model of CPT1knockout is detrimental to cardiac structure/function owing topressure overload–induced LV systolic dysfunction. CPT1b�/�

mice showed a more pronounced systolic dysfunction butremained in concentric hypertrophy. It is likely that mostCPT1b�/� hearts were still at the stage before the transitionto dilated cardiomyopathy. Therefore, we could not rule outthe possibility that CPT1 inhibition might exert beneficialeffects only in dilated cardiomyopathy. Additionally, it ispossible that inhibitors and the gene knockout will exhibitdistinct functions when the corresponding proteins havenonenzymatic functions as a scaffold.

Figure 5. Apoptosis assay of CPT1b�/� mice with pressure overload. Mice were subjected to transverse aorta constriction (TAC) pro-cedures at 10 to 12 weeks of age and euthanized 2 weeks after TAC. A, Representative image of apoptotic cardiomyocytes in a sec-tion of mice hearts. Green staining (see white arrows) indicates apoptotic cells; blue, nuclei (terminal deoxynucleotidyl transferase dUTPnick-end labeling [TUNEL] fluorescence FITC kit; GenScript). B, Quantification results of TUNEL assay (n�5). C, Western blots of cyto-chrome c in cytosolic and mitochondrial fractions extracted from hearts of mice. *P�0.05 vs sham; #P�0.05 vs WT TAC (n�4).




ownloaded from


To the best of our knowledge, the present study is the firststudy based on a gene-targeted mouse model with CPT1bdeficiency. Although a complete knockout of CPT1b causesembryonic lethality, the heterozygous CPT1b knockout miceare overtly normal. It is noted that in the heterozygous CPT1bknockout heart, CPT1b expression was blunted in bothtranscript and protein levels. Because CPT1a is also ex-pressed in the adult heart at a low level, a compensatoryupregulation of CPT1a is possible. In fact, the inverseresponse of increased CPT1b expression in livers of diet-challenged CPT1a�/� mice was reported.35 However, tran-script expression of CPT1a was unchanged in the CPT1b-deficient hearts. Because the total CPT1 activity wasdecreased by �30% compared with WT littermates andCPT1 activity is upregulated during at least the early stage ofcardiac hypertrophy, the depression of CPT1 activity in theCPT1b-deficient heart appears to be the key determinant forthe detrimental response to pressure overload–induced car-diac pathology. The partial CPT1b deficiency in the heartseems insufficient to affect basal cardiac performance andcardiac metabolism. This result does not support previousobservations that partial inhibition of CPT1 activity by CPT1inhibitors such as etomoxir leads to cardiac dysfunction and

hypertrophy under physiological conditions.11,12 Therefore, itis likely that the detrimental cardiac effects of etomoxirtreatment under normal physiological conditions may beassociated with effects unrelated to CPT1 inhibition or moresevere cardiac CTP1 inhibition (30% in CPT1b�/� versus40%–50% with etomoxir treatment36).

The most important finding in the present study is that theCPT1b�/� mice were much more susceptible to pressureoverload–induced pathological cardiac hypertrophy, suggest-ing that partial CPT1b deficiency is detrimental with patho-logical development under mechanical stress conditions. Thisresult is in sharp contrast to those using CPT1 inhibitors inhuman studies.18,19 The reasons for this obvious discrepancymay be derived from different degrees of CPT1 inhibitionamong studies, nonspecific effects of CPT1 inhibitors, or theexistence of certain levels of CPT1a activity in CPT1bknockout hearts. Importantly, the present finding on thedetrimental effects of CPT1b deficiency is against the basicconcept of FAO inhibition as a therapeutic approach intreating heart failure patients. A specific site and specificquantity of the inhibition could be crucial. Moreover, ourresults demonstrated that mitochondrial FAO and CPT1bactivity were upregulated in mitochondria samples from

Figure 6. Myocardial lipid accumulation of mice with pressure overload. Mice were subjected to transverse aorta constriction (TAC)procedures at 10 to 12 weeks of age and euthanized 2 weeks after TAC. A, Myocardial triglyceride content in hearts (n�5). B, Repre-sentative photomicrographs depicting the histological appearance of ventricular tissue sections stained with Oil Red O. C, Ceramidespecies were quantified by electrospray ionization–mass spectrometry/mass spectrometry (EIS-MS/MS) as described in Methods in theonline-only Data Supplement. D, Total ceramide was calculated from the sum of C16:0, C18:0, C20:0, C22:0, and C24:0 ceramide sub-species. *P�0.05 vs sham; #P�0.05 vs wild-type (WT) TAC (n�4).




ownloaded from


hearts with pressure overload–induced hypertrophy. It islikely that increased CPT1 activity is crucial to maintainmitochondrial FAO among the remaining mitochondria dur-ing the development of pathological cardiac hypertrophy.However, the suppressed mitochondrial biogenesis and func-tion in the heart may potentially impair overall myocardialFAO.

Lipotoxicity in addition to the pressure overload–associ-ated systolic dysfunction appears to be the cause of thedetrimental effect of CPT1b deficiency under pathologicalconditions. Patients with inborn errors of FAO typicallymanifest cardiomyopathy with diminished systolic function.37

Moreover, intramyocardial lipid accumulation is associatedwith contractile dysfunction in heart tissues from patientswith nonischemic heart failure.38 The reduction of mitochon-drial biogenesis should be the consequence of the progressionof cardiac pathology and cardiomyocyte apoptosis. Theincreased sympathetic activity in response to hemodynamicoverload might lead to increased lipolysis. Although thisappears to be the case, it is insufficient to activate peroxisomeproliferator-activated receptor signaling to increase the ex-pression of fatty acid uptake proteins. Instead, the expressionof fatty acid uptake proteins was further decreased, possiblybecause of the exacerbated cardiac pathological development.

Figure 7. The expression of fatty acid uptakeproteins and mitochondrial biogenesis in micesubjected to pressure overload. Mice weresubjected to transverse aorta constriction (TAC)procedures at 10 to 12 weeks of age andeuthanized 2 weeks after TAC. A, Quantitativepolymerase chain reaction (qPCR) assessmentof CD36, FABP, and fatty acid transport protein(FATP) transcripts (n�4). B, Western blotimages and quantification of CD36 and FATP(n�4). C, qPCR assessment of mitochondrialbiogenesis genes transcripts (n�4). D, Westernblot images and quantification of peroxisomalproliferator-activated receptor-� coactivator 1�(PGC1�) and transcription factor A, mitochon-drial (TFAM; n�4). E, Mitochondrial DNA copynumber was assessed by the ratio of mito-chondrial gene (Cyto b) to nuclear gene(Rcan-1) as described in Methods in the online-only Data Supplement. *P�0.05 vs sham;#P�0.05 vs wild-type (WT) TAC (n�6).




ownloaded from


Therefore, it is plausible that the increased myocardialtriglyceride content in CPT1b�/� hearts is due to the relativereduction of mitochondrial FAO and mitochondrial biogene-sis. As a result, myocardial lipid accumulates and feeds theceramide synthesis. Our observation is in agreement with theprevious report that oxfenicine induced myocardial lipidaccumulation in rats.39,40 Myocardial lipid accumulation andthe elevation of ceramide content in the heart should be themechanisms underlying the detrimental effects during thedevelopment of pathological cardiac hypertrophy in responseto the pressure-overload condition. The cytotoxic effect ofceramide in cardiomyocytes has been well established.41,42

Ceramide induces apoptosis of cardiomyocyte in vitro and invivo.43–46 In the peroxisome proliferator-activated receptor-�overexpression heart, myocardial lipid accumulation andincreased ceramide content have been observed to accom-pany cardiomyocyte apoptosis.46 Therefore, the increasedceramide content in the CPT1b-deficient heart subjected toTAC is likely to trigger apoptosis signaling in the heart and toaggravate the pathological development.

One limitation of the present study is that the CPT1bdeficiency preexisted; hence, we are cautious to avoid over-interpreting this result because CPT1 inhibitors are used astreatment in heart failure patients. We cannot rule out thepossibility that the initial development of pressure overload–induced cardiac hypertrophy is exceptionally susceptible to

CPT1b deficiency. A conditional gene-targeting model ofCPT1b could provide more in-depth insights into the effectsof CPT1b deficiency in the heart during the various stages ofcardiac hypertrophy and heart failure. Despite this limitation,the present finding clearly demonstrates the necessity tofurther evaluate the use of CPT1 inhibitors as a therapeuticapproach to treat patients with cardiac hypertrophy and evenheart failure.

The present study demonstrates in a genetic mouse modelthat partial CPT1 deficiency is not sufficient to cause cardiacdysfunction under the normal physiological conditions. How-ever, it is detrimental in animals subjected to TAC-inducedLV pressure overload. CPT1b deficiency exacerbates thecardiac pathological development induced by LV pressureoverload caused by myocardial lipotoxicity.

AcknowledgmentsWe thank the technical services of the UAB Metabolism CoreLaboratory and the Targeted Metabolomics and Proteomics Labora-tory. We also thank Kevin Yang for proofreading and editing themanuscript.

Sources of FundingThis work was supported by grants from National Institutes of Health(1R01 HL085499 and1R01 HL084456 to Dr Yang, 1R01 RR02599to Dr Wood, and T32 HL007457 to Dr Kim). The technical servicesof the UAB Metabolism Core Laboratory were supported by grants

Figure 8. Fatty acid and glucose oxidation rates and carnitine palmitoyltransferase-1 (CPT1) activity/expression in pressure-overloadedhearts. Mice were subjected to transverse aorta constriction (TAC) procedures at 10 to 12 weeks of age and euthanized 3 days, 1week, and 2 weeks after TAC, respectively. A, Fatty acid oxidation rate was determined on isolated mitochondria (n�6). B, Glucoseoxidation rate was determined on heart homogenate (n�6). C, CPT1 activity was assayed using isolated mitochondria (n�6). D, Quanti-tative polymerase chain reaction assessment of CPT1b 2 weeks after TAC (n�4). E, Western blot images and quantification of CPT1b 2weeks after TAC. *P�0.05 vs sham; #P�0.05 vs wild-type (WT) TAC; ‚P�0.05 vs WT sham (n�6).




ownloaded from


P30DK56336 and UL 1RR025777. The Targeted Metabolomics andProteomics Laboratory was supported partly by P30DK079337 andP30AR50948.

DisclosuresNone.

References1. van Bilsen M, van Nieuwenhoven FA, van der Vusse GJ. Metabolic

remodelling of the failing heart: beneficial or detrimental? CardiovascRes. 2009;81:420–428.

2. Lopaschuk GD, Ussher JR, Folmes CD, Jaswal JS, Stanley WC. Myo-cardial fatty acid metabolism in health and disease. Physiol Rev. 2010;90:207–258.

3. Sack MN, Rader TA, Park S, Bastin J, McCune SA, Kelly DP. Fatty acidoxidation enzyme gene expression is downregulated in the failing heart.Circulation. 1996;94:2837–2842.

4. Razeghi P, Young ME, Alcorn JL, Moravec CS, Frazier OH, Taegtmeyer H.Metabolic gene expression in fetal and failing human heart. Circulation.2001;104:2923–2931.

5. Stanley WC, Recchia FA, Lopaschuk GD. Myocardial substrate metab-olism in the normal and failing heart. Physiol Rev. 2005;85:1093–1129.

6. Jaswal JS, Keung W, Wang W, Ussher JR, Lopaschuk GD. Targetingfatty acid and carbohydrate oxidation: a novel therapeutic intervention inthe ischemic and failing heart. Biochim Biophys Acta. 2011;1813:1333–1350.

7. Zarain-Herzberg A, Rupp H. Therapeutic potential of CPT I inhibitors:cardiac gene transcription as a target. Expert Opin Investig Drugs. 2002;11:345–356.

8. Panchal AR, Stanley WC, Kerner J, Sabbah HN. Beta-receptor blockadedecreases carnitine palmitoyl transferase I activity in dogs with heartfailure. J Card Fail. 1998;4:121–126.

9. Abozguia K, Clarke K, Lee L, Frenneaux M. Modification of myocardialsubstrate use as a therapy for heart failure. Nat Clin Pract CardiovascMed. 2006;3:490–498.

10. Cuthbert KD, Dyck JR. Malonyl-CoA decarboxylase is a major regulatorof myocardial fatty acid oxidation. Curr Hypertens Rep. 2005;7:407–411.

11. Wolkowicz PE, Urthaler F, Forrest C, Shen H, Durand J, Wei CC, OparilS, Dell’Italia LJ. 2-Tetradecylglycidic acid, an inhibitor of carnitinepalmitoyltransferase-1, induces myocardial hypertrophy via the AT1receptor. J Mol Cell Cardiol. 1999;31:1405–1412.

12. Cabrero A, Merlos M, Laguna JC, Carrera MV. Down-regulation ofacyl-CoA oxidase gene expression and increased NF-kappab activity inetomoxir-induced cardiac hypertrophy. J Lipid Res. 2003;44:388–398.

13. Pagliaro P, Chiribiri A, Gattullo D, Penna C, Rastaldo R, Recchia FA.Fatty acids are important for the Frank-Starling mechanism and Greggeffect but not for catecholamine response in isolated rat hearts. ActaPhysiol Scand. 2002;176:167–176.

14. Esser V, Britton CH, Weis BC, Foster DW, McGarry JD. Cloning,sequencing, and expression of a cDNA encoding rat liver carnitine palmi-toyltransferase I: direct evidence that a single polypeptide is involved ininhibitor interaction and catalytic function. J Biol Chem. 1993;268:5817–5822.

15. Yamazaki N, Shinohara Y, Shima A, Terada H. High expression of anovel carnitine palmitoyltransferase I like protein in rat brown adiposetissue and heart: isolation and characterization of its cDNA clone. FEBSLett. 1995;363:41–45.

16. Weis BC, Cowan AT, Brown N, Foster DW, McGarry JD. Use of aselective inhibitor of liver carnitine palmitoyltransferase I (CPT I) allowsquantification of its contribution to total CPT I activity in rat heart:evidence that the dominant cardiac CPT I isoform is identical to theskeletal muscle enzyme. J Biol Chem. 1994;269:26443–26448.

17. Brown NF, Weis BC, Husti JE, Foster DW, McGarry JD. Mitochondrialcarnitine palmitoyltransferase I isoform switching in the developing ratheart. J Biol Chem. 1995;270:8952–8957.

18. Schmidt-Schweda S, Holubarsch C. First clinical trial with etomoxir inpatients with chronic congestive heart failure. Clin Sci. 2000;99:27–35.

19. Valerio A, D’Antona G, Nisoli E. Branched-chain amino acids, mito-chondrial biogenesis, and healthspan: an evolutionary perspective. Aging(Albany N Y). 2011;3:464–478.

20. Schwarzer M, Faerber G, Rueckauer T, Blum D, Pytel G, Mohr FW,Doenst T. The metabolic modulators, etomoxir and NVP-LAB121, fail toreverse pressure overload induced heart failure in vivo. Basic ResCardiol. 2009;104:547–557.

21. Lionetti V, Linke A, Chandler MP, Young ME, Penn MS, Gupte S,d’Agostino C, Hintze TH, Stanley WC, Recchia FA. Carnitine palmitoyltransferase-I inhibition prevents ventricular remodeling and delaysdecompensation in pacing-induced heart failure. Cardiovasc Res. 2005;66:454–461.

22. Turcani M, Rupp H. Modification of left ventricular hypertrophy bychronic etomixir treatment. Br J Pharmacol. 1999;126:501–507.

23. Ji S, You Y, Kerner J, Hoppel CL, Schoeb TR, Chick WS, Hamm DA,Sharer JD, Wood PA. Homozygous carnitine palmitoyltransferase 1b(muscle isoform) deficiency is lethal in the mouse. Mol Genet Metab.2008;93:314–322.

24. Cheng L, Ding G, Qin Q, Huang Y, Lewis W, He N, Evans RM,Schneider MD, Brako FA, Xiao Y, Chen YE, Yang Q. Cardiomyocyte-restricted peroxisome proliferator-activated receptor-delta deletionperturbs myocardial fatty acid oxidation and leads to cardiomyopathy.Nat Med. 2004;10:1245–1250.

25. Bartelds B, Takens J, Smid GB, Zammit VA, Prip-Buus C, Kuipers JR,van der Leij FR. Myocardial carnitine palmitoyltransferase I expressionand long-chain fatty acid oxidation in fetal and newborn lambs. Am JPhysiol Heart Circ Physiol. 2004;286:H2243–H2248.

26. Teiger E, Than VD, Richard L, Wisnewsky C, Tea BS, Gaboury L,Tremblay J, Schwartz K, Hamet P. Apoptosis in pressure overload-induced heart hypertrophy in the rat. J Clin Invest. 1996;97:2891–2897.

27. Anversa P, Kajstura J, Olivetti G. Myocyte death in heart failure. CurrOpin Cardiol. 1996;11:245–251.

28. Anselmi A, Gaudino M, Baldi A, Vetrovec GW, Bussani R, Possati G,Abbate A. Role of apoptosis in pressure overload cardiomyopathy. J Car-diovasc Med (Hagerstown). 2008;9:227–232.

29. Glenn DJ, Wang F, Nishimoto M, Cruz MC, Uchida Y, Holleran WM,Zhang Y, Yeghiazarians Y, Gardner DG. A murine model of isolatedcardiac steatosis leads to cardiomyopathy. Hypertension. 2011;57:216–222.

30. Cox KB, Liu J, Tian L, Barnes S, Yang Q, Wood PA. Cardiac hypertro-phy in mice with long-chain acyl-CoA dehydrogenase or very long-chainacyl- CoA dehydrogenase deficiency. Lab Invest. 2009;89:1348–1354.

31. Rupp H, Elimban V, Dhalla NS. Modification of subcellular organelles inpressure overloaded heart by etomoxir, a carnitine palmitoyltransferase 1inhibitor. FASEB J. 1992;6:2349–2353.

32. Vetter R, Kott M, Rupp H. Differential influences of carnitinepalmitoyltransferase-1 inhibition and hyperthyroidism on cardiac growthand sarcoplasmic reticulum phosphorylation. Eur Heart J. 1995;16(supplC):15–19.

33. Hulsmann WC, Peschechera A, Schneijdenberg CT, Verkleij AJ. Com-parison of the effects of carnitine palmitoyltransferase-1 and -2 inhibitorson rat heart hypertrophy. Cardioscience. 1994;5:193–197.

34. Yotsumoto T, Naitoh T, Kitahara M, Tsuruzoe N. Effects of carnitinepalmitoyltransferase 1 inhibitors on hepatic hypertrophy. EurJ Pharmacol. 2000;398:297–302.

35. Nyman LR, Tian L, Hamm DA, Schoeb TR, Gower BA, Nagy TR, WoodPA. Long term effects of high fat or high carbohydrate diets on glucosetolerance in mice with heterozygous carnitine palmitoyltransferase-1a(CPT-1a) deficiency: diet influences on CPT1a deficient mice. NutrDiabetes. 2011;1:e14.

36. Lopaschuk GD, Kelly DP. Signalling in cardiac metabolism. CardiovascRes. 2008;79:205–207.

37. Kelly DP, Strauss AW. Inherited cardiomyopathies. N Engl J Med.1994;330:913–919.

38. Sharma S, Adrogue JV, Golfman L, Uray I, Lemm J, Youker K, NoonGP, Frazier OH, Taegtmeyer H. Intramyocardial lipid accumulation in thefailing human heart resembles the lipotoxic rat heart. FASEB. 2004;18:1692–1700.

39. Jodalen H, Ytrehus K, Moen P, Hokland B, Mjos OD. Oxfenicine-induced accumulation of lipid in the rat myocardium. J Mol Cell Cardiol.1988;20:277–282.

40. Bachmann E, Weber E. Biochemical mechanisms of oxfenicine cardio-toxicity. Pharmacology. 1988;36:238–248.

41. Park TS, Hu Y, Noh HL, Drosatos K, Okajima K, Buchanan J, Tuinei J,Homma S, Jiang XC, Abel ED, Goldberg IJ. Ceramide is a cardiotoxin inlipotoxic cardiomyopathy. J Lipid Res. 2008;49:2101–2112.

42. Brindley DN, Kok BP, Kienesberger PC, Lehner R, Dyck JR. Sheddinglight on the enigma of myocardial lipotoxicity: the involvement of knownand putative regulators of fatty acid storage and mobilization. Am JPhysiol Endocrinol Metab. 2010;298:E897–E908.

43. Dyntar D, Eppenberger-Eberhardt M, Maedler K, Pruschy M, Eppen-berger HM, Spinas GA, Donath MY. Glucose and palmitic acid induce




ownloaded from


degeneration of myofibrils and modulate apoptosis in rat adult cardio-myocytes. Diabetes. 2001;50:2105–2113.

44. Holland WL, Miller RA, Wang ZV, Sun K, Barth BM, Bui HH, DavisKE, Bikman BT, Halberg N, Rutkowski JM, Wade MR, Tenorio VM,Kuo MS, Brozinick JT, Zhang BB, Birnbaum MJ, Summers SA, SchererPE. Receptor-mediated activation of ceramidase activity initiates thepleiotropic actions of adiponectin. Nat Med. 2011;17:55–63.

45. Usta E, Mustafi M, Artunc F, Walker T, Voth V, Aebert H, Ziemer G.The challenge to verify ceramide’s role of apoptosis induction in humancardiomyocytes: a pilot study. J Cardiothorac Surg. 2011;6:38.

46. Son NH, Yu S, Tuinei J, Arai K, Hamai H, Homma S, Shulman GI, AbelED, Goldberg IJ. PPAR gamma-induced cardiolipotoxicity in mice isameliorated by PPAR alpha deficiency despite increases in fatty acidoxidation. J Clin Invest. 2010;120:3443–3454.

CLINICAL PERSPECTIVEThe present study based on a mouse model with heterozygous carnitine palmitoyltransferase-1b (CPT1b) deficiencydemonstrated that CPT1b deficiency is detrimental to the heart under left ventricular pressure-overload conditions. Thisfinding contrasts with the common view that fatty acid oxidation (FAO) depression may be beneficial for the heart in theprogression of cardiac hypertrophy and heart failure. It is recognized that myocardial FAO provides the majority of cardiacenergy in a normal heart. However, the more oxygen-consuming FAO becomes a burden for the heart under hypertrophyand heart failure conditions. Consequently, the heart switches to use glucose as the main fuel with better energy efficiency.Therefore, compounds of FAO inhibitors targeting various FAO steps for the treatment of cardiac hypertrophy and heartfailure have been developed and tested. Some beneficial effects have been shown in small clinical trials, especially forCPT1 inhibitors. However, this therapy is also associated with adverse effects. These untoward effects limit clinical utilityand highlight the need for more preclinical studies. A major hurdle for the clinical use of this class of drugs is the lack ofunderstanding of the potential detrimental effects of FAO deficiency in the heart under pathological conditions. Therefore,the present studies based on a genetic mouse model should provide definitive insights into the potential problems with theclinical use of this class of drugs to treat cardiac hypertrophy and heart failure.




ownloaded from


Jeevan Prasain, Philip A. Wood and Qinglin YangLan He, Teayoun Kim, Qinqiang Long, Jian Liu, Peiyong Wang, Yiqun Zhou, Yishu Ding,

Cardiac Hypertrophy Caused by LipotoxicityInduced−Carnitine Palmitoyltransferase-1b Deficiency Aggravates Pressure Overload

Print ISSN: 0009-7322. Online ISSN: 1524-4539 Copyright © 2012 American Heart Association, Inc. All rights reserved.

is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231Circulation doi: 10.1161/CIRCULATIONAHA.111.075978

2012;126:1705-1716; originally published online August 29, 2012;Circulation.

http://circ.ahajournals.org/content/126/14/1705World Wide Web at:

The online version of this article, along with updated information and services, is located on the

http://circ.ahajournals.org/content/suppl/2012/08/29/CIRCULATIONAHA.111.075978.DC1Data Supplement (unedited) at:

http://circ.ahajournals.org//subscriptions/

is online at: Circulation Information about subscribing to Subscriptions:

http://www.lww.com/reprints Information about reprints can be found online at: Reprints:

document. Permissions and Rights Question and Answer this process is available in the

click Request Permissions in the middle column of the Web page under Services. Further information aboutOffice. Once the online version of the published article for which permission is being requested is located,

can be obtained via RightsLink, a service of the Copyright Clearance Center, not the EditorialCirculationin Requests for permissions to reproduce figures, tables, or portions of articles originally publishedPermissions:



ownloaded from

http://circ.ahajournals.org/content/126/14/1705

http://circ.ahajournals.org/content/suppl/2012/08/29/CIRCULATIONAHA.111.075978.DC1

http://www.ahajournals.org/site/rights/

http://www.lww.com/reprints

http://circ.ahajournals.org//subscriptions/


SUPPLEMENTAL MATERIAL

Method details:

CPT1 activity assay: A modified mitochondrial CPT1 assay was employed by

measuring the rate of formation of palmitoylcarnitine from palmitoyl-CoA plus carnitine

as described previously.1,2 Quantified mitochondria (100 µg protein) were incubated

with the reaction buffer (containing 117 mM Tris-HCl, 0.28 mM reduced glutathione, 4.4

mM ATP, 4.4 mM MgCl2, 16.7 mM KCl, 2.2 mM KCN, 40 mg/l rotenone, 0.1% BSA, and

50 AM palmitoyl CoA ) 3 at 37oC for 5 min.The reactions were initiated when a 2mM

[14C]-carnitine (0.1 uCi) was added. The reaction was quenched with 50ul 1.2 mM ice-

cold HCl after 10 min. The formed [14C]-palmitoylcarnitine was extracted with water-

saturated butanol and determined by liquid scintillation counting.

Pressure-overload induced hypertrophy: The surgical procedure of transverse aorta

constriction (TAC) has been previously described.4 A 27-gauge needle was used to

generate the severe pressure-overload condition; a 26-gauge needle was used for

medium pressure-overload condition. Mice were sacrificed 2 weeks after TAC or sham

operation.

Palmitate and glucose oxidation assay of the heart subjected to TAC 5, 6: Freshly

isolated heart ventricles were minced and homogenized in ice-cold buffer (250 mM

sucrose, 10 mM Tris-HCl, 2 mM EDTA, and 1 mM ATP [pH 7.4]) , mitochondria were

isolated , quantified (100 µg protein) and used for palmitate oxidation assay in a sealed

system7 with reaction buffer( 75.5 mM sucrose,12.5 mM K2HPO4,100mM

KCl,1.75mMMgCl2 - 6H2O, 1.75mM L-carnitine, 0.125mM L(-) malic acid, 1.75mM

DTT,0.07mM NAD+,2mM ATP, 10 mM Tris-HCl, 0.07mM Coenzyme A). The reaction

started when 200µM [14C]-palmitate-15% BSA (1:6) complex(0.04 µCi/reaction mixture)

was added and stopped by 3.5 M perchloric acid after 30min,37oC incubation. CO2-

trapping medium (NaOH,0.1 M) for 14C radioactivity was measured by liquid scintillation

to calculate palmitate oxidation rate.

For glucose oxidation, fresh heart ventricles were homogenized in ice-cold buffer (5

mM KCl, 2 mM Tris-HCl, 0.5 mM Tris base, 0.25 mM MgCl2 - 6H2O, 0.05 mM EDTA,

and 0.05 mM ATP [pH 7.4]), 400µl homogenate was used and the reaction started when

200µM [14C]-glucose (0.1 µCi/reaction mixture) was added. The reaction buffer and

condition are same as above. CO2-trapping medium (NaOH,0.1 M) for 14C radioactivity

was measured by liquid scintillation to calculate glucose oxidation and quantified by

weight of heart tissue for homogenate.

Heart ceramide assay: Ceramide species were quantified by ESI-MS/MS (Applied

Biosystems/MDS sciex,Canada) as described previously.8, 9 Heart tissue homogenates,

in parallel with standard solutions, were spiked with 50 ng C17:0 ceramide as internal

standard and were extracted lipid according to the protocol.10 After the extracted

solution was evaporated to dryness and reconstituted, the samples were analyzed by

mass spectrometry. The analysis was performed in positive ion mode electrospray ion

(ESI-MS) source and precursor ion scans m/z 264 and 282 (ceramides). Ceramide

subspecies were quantified by taking the ratios of the integrated intensity for each

subspecies to the intensity of C17:0. Total ceramide was calculated from the sum of

C16:0, C18:0, C20:0, C22:0, and C24:0 ceramide subspecies.

Supplementary references

1. Zierz S, Engel AG. Different sites of inhibition of carnitine palmitoyltransferase by malonyl-coa, and by acetyl-coa and coa, in human skeletal muscle. Biochem J. 1987;245:205-209

2. McGarry JD, Mills SE, Long CS, Foster DW. Observations on the affinity for carnitine, and malonyl-coa sensitivity, of carnitine palmitoyltransferase 1 in animal and human tissues. Demonstration of the presence of malonyl-coa in non-hepatic tissues of the rat. Biochem J. 1983;214:21-28

3. Doh KO, Kim YW, Park SY, Lee SK, Park JS, Kim JY. Interrelation between long-chain fatty acid oxidation rate and carnitine palmitoyltransferase 1 activity with different isoforms in rat tissues. Life Sci. 2005;77:435-443

4. Liu J, Wang P, Luo J, Huang Y, He L, Yang H, Li Q, Wu S, Zhelyabovska O, Yang Q. Peroxisome proliferator-activated receptor beta/delta activation in adult hearts facilitates mitochondrial function and cardiac performance under pressure-overload condition. Hypertension. 2011;57:223-230

5. Ellis JM, Mentock SM, Depetrillo MA, Koves TR, Sen S, Watkins SM, Muoio DM, Cline GW, Taegtmeyer H, Shulman GI, Willis MS, Coleman RA. Mouse cardiac acyl coenzyme a synthetase 1 deficiency impairs fatty acid oxidation and induces cardiac hypertrophy. Mol Cell Biol. 2011;31:1252-1262

6. Piot C, Hocquette JF, Veerkamp JH, Durand D, Bauchart D. Effects of dietary coconut oil on fatty acid oxidation capacity of the liver, the heart and skeletal muscles in the preruminant calf. Br J Nutr. 1999;82:299-308

7. Campbell SE, Tandon NN, Woldegiorgis G, Luiken JJ, Glatz JF, Bonen A. A novel function for fatty acid translocase (fat)/cd36: Involvement in long chain fatty acid transfer into the mitochondria. J Biol Chem. 2004;279:36235-36241

8. Kasumov T, Huang H, Chung YM, Zhang R, McCullough AJ, Kirwan JP. Quantification of ceramide species in biological samples by liquid chromatography electrospray ionization tandem mass spectrometry. Anal Biochem. 2010;401:154-161

9. Haus JM, Kashyap SR, Kasumov T, Zhang R, Kelly KR, Defronzo RA, Kirwan JP. Plasma ceramides are elevated in obese subjects with type 2 diabetes and correlate with the severity of insulin resistance. Diabetes. 2009;58:337-343

10. Bligh EG, Dyer WJ. A rapid method of total lipid extraction and purification. Can J Biochem Physiol. 1959;37:911-917

On line Table 1: Primers set for quantitative Real-time PCR Gene Forward (5’ to 3’) Reverse (5’ to 3’) β-actin CPT1b CPT1a Nppa Nppb MHC-β Mitofusion 2 COX2 COX3 Cyto b NRF1 NRF2 DRP1 PGC1-α PGC1-β TFAM CD36 FABP FATP Rcan 1

CTGTCCCTGTATGCCTCTG TTCAACACTACACGCATCCC CTCAGTGGGAGCGACTCTTCA ACCGAAGATAACAGCCAAGGAG TCGTGATAGATGAAGGCAGGAA TTTCGTCCGCTGTATCGT AAGTCCGGGAAGCTGAAAGT TCTCGGTTATGGAACCAACC GCAGGATTCTTCTGAGCGTTC TTCCCATTCCCTTCCCAGAC TCCGAACACAGCGTAGATAGA GAAGTGGTTACCGCAGAATC AACCCTTCCCATCAATACATC TGTTCCCGATCACCATATTCC AGGTGTTCGGTGAGATTGTA AGCAGCAGGCACTACAGCGATAC AAAGTTGCCATAATTGAGTCCT TCGAGAAGAACGGGGATAC CGGCGGTGGCGGAGGTGA TTCTGCTTTCCCAGTCATCGTG

ATGTCACGCACGATTTCC GCCCTCATAGAGCCAGACC GGCCTCTGTGGTACACGACAA TCGTGATAGATGAAGGCAGGAA TGCTCTGGAGACTGGCTAGGAC CAAAGGTGTCGTCTGGGAT TCTCGGTTATGGAACCAACC GTCGGTTTGATGTTACTGTTGC AGGGCTTGATTTATGTGGTTTC GCACAGGAGGAAAGGGAAAC AGCAGCCAGATGGGCAGTTA CTTGCTGTCCATCGGGCATCG AATTCCATTATCCTCGCCGGTC TCCCGCTTCTCGTGCTCTTT TCAGATGTGGGATCATAGTCA TTCCCATTCCCTTCCCAGAC TCCGAACACAGCGTAGATAGA CTGCCATGGGTGAGAGT AGAAGCGGCTGGCGGAGAACT GAACATCAACCCATTTGCTCCC

On line Table 2. Echocardiography measurement in mice

Parameters WT CPT1b+/- IVS;d (mm) 0.79±0.17 0.74±0.07 IVS;s (mm) 1.19±0.22 1.13±0.14 LVID;d (mm) 3.63±0.39 3.70±0.24 LVID;s (mm) 2.44±0.33 2.55±0.26 LVPW;d (mm) 0.78±0.23 0.75±0.14 LVPW;s (mm) 1.11±0.21 1.04±0.77 LVID VOL;d(µL) LVID VOL;s(µL)

60.44±13.85 20.41±5.59

65.28±9.14 22.72±3.89

Stroke Volume (µL) 40.03±9.57 42.50±6.64 Cardiac Output (ml/min) EF(%) FS(%) LV Mass

16.45±5.15 62.11±6.75 32.93±4.82 98.56±15.32

19.72±3.21 59.80±4.83 31.26±3.34 94.26±12.57

Abbreviations: IVS;s and IVS; d: interventricular septal wall thickness (diastole and

systole);LVID;s and LVID;d: left ventricular dimension at systole and diastole; LVPW;s

and LVPW;d: posterior wall thickness at systole and diastole; LVID VOL;s and LVID

VOL;d: left ventricular dimension estimated left ventricular volume at systole and

diastole; EF%: ejection fraction; FS%: fractional shortening. LV Mass: left ventricular

mass.

On line Table 3. Hemodynamic measurement of isolated working heart

Parameters WT CPT1b+/- HR 413.72±83.77 405.24±77.43 LVPsys(mmHg) 107.16±8.60 114.74±10.90 LVEDP(mmHg) 7.07±1.51 7.00±0.83 dLVPdtmax(mmHg/s) 6084.57±805.19 6557.24±1385.26 -dLVPdtmin(mmHg/s) -6730.96±480.65 -6757.19±1244.36 CI 123.47±12.23 119.70±22.55 RT50(ms) 25.35±2.91 27.07±3.85

Abbreviations: Heart rate (HR), systolic left ventricular pressure (LVPsys), left

ventricular end-diastolic pressure (LVEDP), cardiac output index (CI), left ventricular

maximal and minimal dP/dt indicate rates of cardiac contractility and relaxation, 50%

relaxation time (RT50). n=6.

Supplemental Figure Legends

Supplemental Figure 1. Body weight, heart weight and heart body weight ratio.

Mice were sacrificed at their 12~14 weeks of age (n=5).

Supplemental Figure 2. Representative histological images (400 X) with H&E

staining on heart section. Mice were sacrificed at 12~14 weeks of age.

Supplemental Figure 3. Representative echocardiographic images of M-mode

measurement. Measurements were performed on mice at their 12~14 weeks of age.

Supplemental Figure 4. Serum Free fatty acid content in mice subjected to TAC at

different time points. Mice were subjected to TAC procedures at 10~12 weeks of age

and sacrificed 3 days, 1 week, two weeks after TAC, respectively. A commercial kit

(NFFA-HR Assay kit,Wako) was used. *p<0.05 vs sham (n= 6).

Supplemental Figure 1

0

5

10

15

20

25

W T CPT1b+/-

Bo

dy w

eig

ht (

g)

0.00

0.02

0.04

0.06

0.08

0.10

WT CPT1b+/-

Hea

rt w

eigh

t (g

)

0

1

2

3

4

5

W T CPT1b+/-

Hea

rt /

Bo

dy

wei

gh

t(m

g/g

)

C.B.A.


CPT1b +/-WT


1.0

1.5

2.0

2.5

W T^Sham CPT1b+/- Sham

W T^TAC CPT1b+/- TAC

***

*

**

Ser

um

fre

e fa

tty

acid

s(m

Eq

/L)

TAC 3d TAC 1w TAC 2w0.0

0.5

Ser

um

fre

e fa

tty

acid

s

heart failure - circulationcirc.ahajournals.org/content/126/14/1705.full.pdf · clinical trials...

Documents