1

Genetics of Sex-linked yellow in the Syrian hamster

Azita Alizadeh1, Lewis Z. Hong1, Christopher B. Kaelin1, Terje Raudsepp2, Hermogenes Manuel1, and Gregory S. Barsh1

1Departments of Genetics and Pediatrics, Stanford University, Stanford, CA, USA 94305; 2Department of Veterinary Integrative Biosciences, Texas A&M University, College Station, TX.

Genetics: Published Articles Ahead of Print, published on February 2, 2009 as 10.1534/genetics.108.095018

2

Running title: Sex-linked yellow in Syrian hamsters

Keywords: Agouti gene Syrian hamster Melanocortin signaling Pigmentation patterns Tortoiseshell

Corresponding author:

Greg Barsh Beckman Center B271A Stanford University School of Medicine Stanford, CA 94305 650 723 5035 FAX 650 723 1399 gbarsh@stanford.edu

3

ABSTRACT

Alternating patches of black and yellow pigment are a ubiquitous feature of mammalian color

variation that contributes to camouflage, species recognition, and morphologic diversity. X-

linked determinants of this pattern—recognized by variegation in females but not males—have

been described in the domestic cat as Orange, and in the Syrian hamster as Sex-linked yellow

(Sly), but are curiously absent from other vertebrate species. Using a comparative genomic

approach, we develop molecular markers and a linkage map for the euchromatic region of the

Syrian hamster X chromosome that places Sly in a region homologous to the centromere-

proximal region of human Xp. Comparison to analogous work carried out for Orange in

domestic cats indicates, surprisingly, that the cat and hamster mutations lie in non-homologous

regions of the X chromosome. We also identify the molecular cause of recessively inherited

black coat color in hamsters (historically referred to as nonagouti) as a Cys115Tyr mutation in

the Agouti gene. Animals doubly mutant for Sly and nonagouti exhibit a Sly phenotype. Our

results indicate that Sly represents a melanocortin pathway component that acts similarly to, but

is genetically distinct from Mc1r, and which has implications for understanding both the

evolutionary history and the mutational mechanisms of pigment-type switching.

4

INTRODUCTION

The genetics of coat color is a longstanding and rich model system for studying gene action and

cell signaling. Like classical genetic systems in invertebrate model organisms, the cell types and

tissues that give rise to mammalian hair color are well-characterized and experimentally

accessible, and alterations in gene activity can be easily detected. Coat color mutations are

especially useful for studying genes and pathways unique to vertebrate genomes, and have led to

a deeper understanding of diverse biological processes because much of the molecular machinery

used by the pigmentary system is either shared by, or homologous to, molecules used in other

physiological pathways (BENNETT and LAMOREUX 2003; JACKSON 1997; STEINGRIMSSON et al.

2006).

This approach has proven particularly useful for dissecting the molecular mechanisms of

pigment-type switching, a phenomenon in which melanocytes choose between synthesizing

eumelanin (a relatively insoluble black or brown pigment) or pheomelanin (a cysteine-rich red or

yellow pigment that is soluble in dilute alkali) (SILVERS 1979). A focal point for pigment-type

switching is the Agouti—melanocortin 1 receptor (Mc1r) pathway. Mc1r is a G-protein coupled

receptor expressed in melanocytes, whereas Agouti protein is a paracrine signaling molecule

secreted by specialized dermal cells that inhibits Mc1r signaling (reviewed in BARSH 2006;

CONE et al. 1996). In laboratory mice, gain-of-function mutations that constitutively activate the

Mc1r (e.g. sombre, Mc1rso), cause exclusive production of eumelanin, whereas loss-of-function

Mc1r mutations (e.g. recessive yellow, Mc1re), cause exclusive production of pheomelanin

(ROBBINS et al. 1993). On the other hand, because Agouti is a Mc1r antagonist, gain-of-function

Agouti mutations (e.g. lethal yellow, Ay) cause exclusive production of pheomelanin, whereas

5

loss-of-function mutations (e.g. extreme nonagouti, ae) cause exclusive production of eumelanin

(HUSTAD et al. 1995; SIRACUSA 1994).

In the early 1900s, Sewall Wright (1917) concluded that genetic mechanisms that control

pigmentary variation have been largely conserved during mammalian evolution. In particular, the

Agouti phenotype—in which individual hairs display a subapical band of pheomelanin on an

otherwise eumelanic background—is observed across a wide range of mammalian phyla. In the

last decade, gain- and loss-of-function Mc1r mutations have been identified in many domestic

animals (ANDERSSON 2003; KLUNGLAND and VAGE 2003), and Agouti and/or Mc1r variation

have been shown to contribute to pigmentary variation in several natural populations (EIZIRIK et

al. 2003; HOEKSTRA et al. 2006; MUNDY et al. 2004; NACHMAN et al. 2003; STEINER et al.

2007). Most experimental work on the Agouti –Mc1r pathway has been carried out in laboratory

mice. Nonetheless, comparative zoologic studies by Wright (1918) and others (LITTLE 1957;

SEARLE 1968) suggested that some components of mammalian pigment type-switching are not

represented as coat color mutations in laboratory mice. In addition to a regular black and yellow

stripe pattern found in many carnivores that is usually attributed to the Tabby gene (SEARLE

1968), irregular black and orange patches due to the activity of an X-linked gene is also present

in the domestic cat and the Syrian hamster; neither of these phenomena have been described in

laboratory mice.

In the domestic cat, female-specific variegation of black and orange coat color patches has been

appreciated for more than a century, and helped support the initial hypothesis that random and

epigenetically heritable X-inactivation is a universal feature of placental mammals (LYON 1962).

A similar phenotype thought to be caused by mutation of a homologous X-linked gene was

6

described in Syrian hamsters more than 40 years ago (ROBINSON 1966). As in cats, hemizygous

male hamsters and homozygous female hamsters are completely yellow, while heterozygous

females exhibit a characteristic tortoiseshell pattern of yellow patches on a black background.

(The terms tortoiseshell and calico are often used to refer to the phenotype, the gene, and/or the

allele in both cats and hamsters; here we use Orange, O, to describe the gene in cats, and

Robinson’s original designation, Sex-linked yellow, Sly, to describe the gene in hamsters).

More than 100 mouse coat color mutations have been characterized over the last century, and

there exist multiple alleles for those directly implicated in pigment-type switching (Agouti, Mc1r,

Atrn, Mgrn, Sox18), none of which lie on the X chromosome (BENNETT and LAMOREUX 2003).

The apparent absence from laboratory mice of an X-linked pigment-type switching mutation is

perplexing in the face of Ohno’s law, which predicts conservation of synteny on the X

chromosome across different mammalian species due to selection against altered gene dosage

(OHNO 1969). Genetic characterization of Sex-linked yellow in Syrian hamsters could shed light

on this paradox, and identify additional components of the pigment-type switching pathway.

However, by contrast to laboratory mice, very little of the classical work on coat color variation

in Syrian hamsters (NIXON et al. 1970) has been developed at the molecular genetic level.

We have established a laboratory-based colony of Syrian hamsters to study the biology and

genetics of Sex-linked yellow together with other coat color variants, and confirmed that the

mutation behaves similarly to what was originally reported (ROBINSON 1966; ROBINSON 1972).

Here we use a comparative genomic approach to generate a molecular genetic map of the Syrian

hamster X chromosome that includes Sex-linked yellow, which provide a basis for molecular

genetic and epistasis studies revealing that Sly represents a component of the melanocortin

7

pathway similar to, but independent of, the Mc1r. Comparison to analogous work carried out for

Orange in domestic cats (Schmidt-Küntzel et al.) indicates that the cat and hamster mutations

likely lie in non-homologous regions of the X chromosome, which has implications for

understanding both evolutionary history and the mutational mechanisms of pigment-type

switching.

MATERIALS AND METHODS

Animal husbandry: Sly and other coat color variants in the Syrian hamster are well-recognized

in the hobbyist community, but are not maintained in an academic- or research-oriented setting;

none of the laboratory animal vendors we contacted were aware of a sex-linked and/or variegated

phenotype. We obtained animals with a diverse set of coat color phenotypes from San Joaquin

Valley Fisheries (Fresno, CA), including belted, black, cream, golden, red-eyed dilute,

tortoiseshell, and tricolor (analogous to calico in the domestic cat). For phenotypic

characterization and linkage mapping of Sly, we used tortoiseshell females and black males, and

confirmed that tortoiseshell segregated as an X-linked trait in accord with Mendelian

expectations as indicated in Figures 1, 2, and Table 2. All animal work was carried out under an

APLAC-approved protocol.

Genetic markers: We first developed simple sequence length polymorphism (SSLP) markers

using a comparative genomic strategy in which aligned regions of the mouse and human X

chromosomes were used to identify potential SSLP targets for PCR amplification using Primer 3

(ROZEN and SKALETSKY 2000). Precomputed alignments of the human and mouse genomes were

obtained from ftp://genome.ucsc.edu/goldenPath/hg16/vsMm4/axtTight/. From 39889 regions of

human-mouse X chromosome alignments, we used a custom perl script to identify 7204 pairs of

8

alignments in which each pair was separated by a 100 – 300 bp gap (in which no alignment was

recorded, and therefore may have contained an SSLP. We filtered the 7204 pairs of alignments

by the extent of similarity, allowing only those alignments in which there was a perfect human-

mouse match of at least 20 bp, yielding 943 alignment pairs. Among these, suitable primers (that

met default criteria for Primer3) could be designed for 452. Among the 452 alignment pairs, the

intervening (to be amplified) sequence contained one or more SSLP targets in both the mouse

and the rat genomic sequence in ~30 alignments, all of which were used for PCR of hamster

genomic DNA. This approach yielded 7 amplicons that contained polymorphic SSLPs; we then

designed new internal primers directly from the hamster sequence for subsequent amplification

of hamster genomic DNA.

We supplemented the SSLP framework map with SNP-based markers ascertained by

resequencing introns, or between pairs of conserved non-coding sequences. For resequencing

introns, exon-based primer pairs were chosen using a perl script designed to target

oligonucleotides corresponding to little or no codon degeneracy (and therefore likely to be

conserved between mouse and hamster). For resequencing between pairs of conserved non-

coding sequences, we modified the strategy described above to start with precomputed mouse-

human alignments (BRUDNO et al. 2004; KENT et al. 2003). From ~300 amplicons from hamster

DNA, we identified 9 SNPs used to supplement the SSLP-based linkage map. For 7 of the 9 SNP

markers, primers based on mouse sequence yielded robust and specific amplification products

from hamster genomic DNA; in 2 cases (DBarX111 and DBarX118) we developed new internal

primers directly from the hamster sequence.

9

Identity of the amplicons for all 16 primer pairs was investigated by aligning the amplified

hamster sequence to the predicted mouse amplicon. In four cases (DXBar53, DXBar 54, DXBar

DXBar 57, and DXBar 119), no significant similarity was observed between mouse and hamster

amplicons, probably due to internal repetitive sequence and/or lack of evolutionary constraint;

therefore the identity of these amplicons relies on comparative mapping results (Figure 3).

Molecular genetic and linkage analysis: SSLP-based markers were amplified with dye-labeled

primers; SNP-based markers were sequenced with dye terminators after amplification; all

markers were separated on a capillary instrument equipped for fluorescence detection. Genotypes

for SSLP markers were called manually; genotypes for SNPs were called with an automated

commercial detection platform (CodonCode). Prior to linkage analysis, Mendelian error-

checking was performed; apparent instances of non-Mendelian transmission were inspected for

potential genotype errors, and either corrected, or dropped from the analysis. An initial map

order was established by minimizing the number of double crossovers, and subsequently refined

with a regression-based analysis for intermarker distance implemented in JoinMap (STAM 1993).

Molecular cytogenetics: Fluorescence in situ hybridization (FISH) of bacterial artificial

chromosome (BAC) probes to metaphase chromosomes from cultured mouse and hamster

fibroblast cells was carried out as described previously (RAUDSEPP and CHOWDHARY 2008). We

selected three mouse BACs (RP24-77C5, RP24-186P1, and RP24-96H13) based on their gene

content as inferred from the July 2007 (Build 37) assembly on the UCSC genome browser,

http://genome.cse.ucsc.edu/ (KAROLCHIK et al. 2003). Each BAC contains one or more genes

that are found in segments whose order is physically conserved among mice, humans, dogs, and

cats; the genes (and BACs) were chosen to lie close to, and possibly flanking, the cat Orange

10

gene as depicted in Figure 5. BACs were labeled by nick-translation with digoxigenin (77C5 and

196H13)- or biotin (186P1)-coupled UTP, hybridized to nuclear chromatin in pairwise

combinations (77C5 + 186P1 or 196H13 + 186P1), and detected with indirect

immunofluorescence (RAUDSEPP and CHOWDHARY 2008). For cross-species detection (mouse

probes hybridized to hamster chromosomes), probe concentration was increased by ~ 5 – 10 fold,

and hybridization was carried out for 72 rather than 24 hours.

RESULTS

Sex-linked yellow in hamsters: phenotype and genetics: Commercial suppliers of Syrian

hamsters to research laboratories carry few, if any, coat color variants. We identified a major pet

store supplier in the California central valley, imported several different coat color variants, and

established standardized pedigrees from 7 tortoiseshell females and 6 black males to confirm and

characterize the phenotype and inheritance pattern. In what follows, we refer to mutant and non-

mutant alleles for Sly as SlyTo and Sly+, respectively.

As described originally (ROBINSON 1966), mutant animals (SlyTo/Y or SlyTo/SlyTo) are orange-

yellow in color with a darker dorsum than ventrum, and a sooty appearance, whereas non-mutant

animals (Sly+/Sly+ or Sly+/Y) are “golden”, presumably due to the presence of an Agouti allele

that promotes an extended band of pheomelanin. However, in the hobbyist community today,

SlyTo is almost always described on a presumptive nonagouti (a/a) background such that non-

mutant animals (Sly+/Sly+ or Sly+/Y) are black.

We examined dorsal hair pigment distribution from yellow (SlyTo/Y; a/a), black (Sly+/Y; a/a),

and golden (Sly+/Y; AW/AW) animals. As in the mouse (SUNDBERG 1994), the hamster coat

contains three major types of hair: long guard hairs, and shorter hairs, awls and zigzags, that

11

constitute the underfur, and whose relative proportions are similar among yellow, black, and

golden hamsters (Table 1). Pigment-type switching phenotypes are most evident in the zigzag

hairs, which comprise the majority of the underfur. Hairs from golden animals exhibit a dark tip

and base separated by a wide pheomelanic band that extends over ~80% of the hair length

(thereby accounting for a golden rather than a typical brushed Agouti appearance). Hairs from

yellow animals exhibit a dark tip (but less dark than in golden animals), a pale yellow shaft (less

intense than the pheomelanic band of golden hairs), and a white base (Figure 1).

To characterize the inheritance of Sly, we used a three-generation breeding scheme in which

phase could be inferred unambiguously for X-linked markers; tortoiseshell females were always

mated to black males, such that only a single Sly allele was segregating among F3 progeny

(Figure 2A). A total of 155 F3 progeny were obtained from 17 pedigrees. X-linked inheritance of

Sly was confirmed by the absence of yellow females in each pedigree, and a distribution of F3

progeny that did not deviate significantly from that expected for X-linkage (Table 2). These

observations confirmed that each kindred is segregating a single X-linked allele that results in

constitutive pheomelanin production, and provided a sufficient number of meiotic events to carry

out a linkage scan of the hamster X chromosome.

Linkage scan of the X chromosome: We used a combination of comparative genomic and

PCR-based approaches to develop molecular genetic markers for the hamster X chromosome.

Among all possible combinations of markers (7 SSLP markers and 9 SNP markers) with 155 F3

individuals, 1077 assays yielded informative results, and were used to establish a genetic map

(Figures 2B, 3). The hamster X chromosome map covers 46 cM with a median intermarker

distance of 4.1 cM; by comparison, the mouse X-specific region is 72 cM in length (BLAKE et al.

12

2003). The hamster map includes markers that map to both ends of the human X chromosome,

but lacks markers corresponding to two key regions in mouse (0 – 20 Mb and 85 – 129 Mb) and

one key region in humans (54 – 98 Mb). Thus, we cannot determine whether the shorter genetic

length of the hamster X chromosome relative to the mouse represents a reduced ratio of

genetic/physical distance in the hamster relative to the mouse, or a terminal region on the

hamster X that has not been captured by our genetic markers.

Comparing the relative position of homologous markers between the mouse, hamster, human,

and dog X chromosomes reveals a considerable degree of intrachromosomal rearrangement

between hamsters and mice, and between hamsters and humans or dogs (Figure 3A). However,

the relative position of markers in the hamster is almost identical to that in the rat (Figure 3B),

consistent with previous molecular cytogenetic work (KUROIWA et al. 2001a; KUROIWA et al.

2001b; KUROIWA et al. 2001c) suggesting that gene order on the X chromosome is largely

conserved between several rodent species (including the rat and the Syrian hamster), though not

in the laboratory mouse.

The Syrian hamster X chromosome is metacentric, but with the long arm composed entirely of

constitutive heterochromatin (DIPAOLO and POPESCU 1973); thus, our molecular map applies to

hamster Xp. Comparison of our results to molecular cytogenetic studies suggest an orientation in

which DXBar111 and DXBar51 lie most centromere-proximal and centromere-distal,

respectively. Sly lies in a 9.6 cM region at the centromere-proximal end, flanked by DXBar111

and DXBar56 (Figure 3). Transposed against the human and dog X chromosomes, this region

defines 8 Mb and 5 Mb intervals, respectively, that also lie close to the human and dog

centromeres.

13

Candidate genes for Sly: Agouti and Mc1r: As indicated above, although SlyTo was originally

described on an Agouti (“golden”) background, most animals carrying SlyTo are presumably

nonagouti, such that Sly+/Y and Sly+/ Sly+ animals display a black coat, whereas Sly+/SlyTo

animals display patches of yellow hair on a black background, presumably in regions where

melanocyte clones have undergone epigenetic inactivation of the wild-type X chromosome

(Figure 1A). However, coat color genetics in hamsters is based almost entirely on the similarity

of phenotypes and genetic interactions to those observed in laboratory mice, and there are at least

two hamster genes that can yield recessive inheritance of a black coat (KURAMOTO et al. 2002).

To investigate the underlying molecular basis for black coat color (and, indirectly, the epistasis

relationship between black coat color and Sly), we used a PCR-based strategy to determine the

coding sequence for the hamster Agouti gene. Within exon 4, which encodes the majority of the

Agouti protein-coding region, we detected a G to A mutation that predicts a Cys115Tyr

substitution (Figure 4A) found in both black hamsters and yellow hamsters in our colony, but not

in golden hamsters. This residue is conserved among all known Agouti homologs, and helps

stabilize the key active loop responsible for melanocortin receptor antagonism (MCNULTY et al.

2005). Furthermore, a Cys115Ser mutation in a mouse Agouti transgene has the same effect as a

null allele (PERRY et al. 1996). Taken together, these results indicate that loss-of-function in

Agouti is responsible for the black coat color in our colony.

Similar to what has been described for Orange in tortoiseshell and calico cats (SEARLE 1968), the

patches of black and yellow pigment in Sly+/SlyTo hamsters become larger in the presence of

white spotting mutations (ROBINSON 1972), suggesting that SlyTo acts in a melanocyte-

autonomous manner, similar to Mc1re in laboratory mice. To investigate the possibility that SlyTo

14

might represent an Mc1r loss-of-function allele that had been transposed to the hamster X

chromosome, we used oligonucleotide primers based on the mouse and rat genome to PCR-

amplify the hamster Mc1r gene and flanking sequences from yellow and black hamsters. We

identified several synonymous and/or flanking sequence SNPs that were heterozygous in at least

one male animal (data not shown), but did not observe any alterations expected to impair Mc1r

function; thus, as in all other mammals, including cats (EIZIRIK et al. 2003), the hamster Mc1r

appears to be autosomal. We conclude that, similar to Orange in cats, Sly is epistatic to Agouti

but genetically distinct from Mc1r (Figure 4B).

Relationship to Orange in domestic cats: The puzzling similarities between cat Orange and

hamster Sly—puzzling given the evolutionary distance between phyla and the absence of a

similar mutation in any other mammal—prompted us to investigate whether the two mutations

lie in homologous locations. In an accompanying manuscript, Schmidt-Küntzel et al.

demonstrate that Orange lies in a 6 cM, ~11 Mb interval, that corresponds to 96 Mb – 106 Mb,

and 120 Mb – 131 Mb, in the dog and human genomes, respectively. By contrast, flanking

markers for hamster Sly delineate a different interval, on the short arm of the dog (40 Mb – 45

Mb) and human (46 Mb – 54 Mb) X chromosomes (Figure 5C).

A potential caveat to the conclusion that the hamster Sly and cat Orange mutations lie in non-

homologous locations is that the large number of evolutionary breakpoints apparent from

comparing the mouse and hamster X chromosomes to those of other mammals might mask one

or more chromosomal rearrangements in which segments harboring the Orange gene were

transferred to what we currently recognize as the Sly region. To investigate this possibility, we

carried out cytogenetic FISH experiments to evaluate the location of the cat Orange interval in

15

mouse and hamster chromosomes. We selected 3 bacterial artificial chromosome (BAC) clones

from a mouse genomic DNA library that each carried genes found in homologous locations in

humans, dogs, and cats, and whose positions were likely to flank the Orange mutation (Figure

5C). Each of the three BACs was hybridized to metaphase spreads from an X/X mouse, an

Sly+/Y hamster, and an SlyTo/Y hamster. As expected, the cytogenetic locations for the three

BACs on the mouse X chromosome correspond to their positions on the physical map, at ~38

Mb (BAC1: 77C5), 39 Mb (BAC2: 186P1), and 47 Mb (BAC3: 196H13) (Figure 5A).

Hybridization of the same BAC probes to hamster chromosomes yielded weaker signals, and it

was not possible to order the probes in double labeling experiments. However, all three probes

hybridized to the same region at the telomeric end of hamster Xp for both the Sly+- and the SlyTo-

bearing chromosomes (Figures 5A, 5B). These results suggest that the X chromosomal region

that contains Orange (as defined by genetic mapping experiments carried out by Schmidt-

Küntzel et al.) remained intact during rodent evolution, and is distinct from the region where Sly

maps in hamsters.

DISCUSSION

In most respects, the effects of Sly in hamsters and Orange in domestic cats are similar to those

caused by Mc1r loss-of-function mutations in other mammals. Both Sly and Orange yield a

uniformly pheomelanic pelage whose effects are epistatic to those of nonagouti, as is the case for

Mc1r loss-of-function in mice (SILVERS 1979), horses (MARKLUND et al. 1996; RIEDER et al.

2001), and dogs (KERNS et al. 2004; NEWTON et al. 2000). Furthermore, both Sly and Orange

interact with white-spotting mutations in a manner that suggests they are melanocyte

autonomous, as is the case for mosaic Mc1r mutations in pigs (KIJAS et al. 2001), in mice

16

(LAMOREUX and MAYER 1975), and presumptive Mc1r mutations in guinea pigs and rabbits

(SEARLE 1968). However, both Sly and Orange are genetically distinct from the Mc1r, and

possibly from each other. In what follows, we consider two explanations that could account for

these observations.

Sly and Orange may be orthologs, representing loss-of-function mutations in the same

(previously unrecognized) component of melanocortin signaling that acts in a manner and cell

type similar to that of the Mc1r, but lies genetically upstream, such as a transcription factor

required for Mc1r expression, or a receptor-associated protein required for proper cell surface

expression and/or targeting of the Mc1r. Absence of a similar X-linked phenotype in mammals

other than hamsters and cats could be explained by redundancy, e.g. if the Sly/Orange gene was

duplicated early in mammalian evolution, and that the duplicated genes were redundant with

regard to pigmentary function in most mammals. According to this scenario, most mammals

would then have two Sly/Orange genes, but one of the duplicated genes would have been lost, by

chance, from the hamster and, independently, from the cat lineage.

If Sly and Orange are orthologs, the apparent lack of “homology” in their respective

chromosomal locations (homology as assessed with the comparative mapping approach in Figure

5) likely reflects additional chromosomal rearrangements during rodent evolution, in which the

the Orange gene in an ancestral mammal translocated to the centromere-proximal region of

hamster Xp. Although the FISH-based cytogenetics do not support such a rearrangement, the

sequences tested (3 BACs in an ~10 Mb region) represent only a fraction of the interval, and

cannot exclude the possibility of small chromosomal rearrangements that will only become

apparent from additional genome sequences.

17

Alternatively, Sly and/or Orange could represent unusual gain-of-function mutations in which a

(perhaps previously known) component of melanocortin signaling has been activated in

melanocytes. For example, retrotransposition of Agouti into a melanocyte-specific locus on the X

chromosome, or a point mutation of a melanocyte-specific X-linked Gi-coupled receptor that

causes constitutive activation would be expected to yield a phenotype and set of genetic

interactions similar to those observed for Sly and Orange. Both sorts of events would be very

rare—much less frequent than loss-of-function mutations—and therefore might explain why X-

linked pheomelanism has not been observed in species where very large numbers of animals

have been subjected to a natural screen, i.e. laboratory mice and humans. This idea is also

consistent with preliminary analyses of the cat and dog X chromosome sequences, in which the

dog region homologous to that which carries Orange also harbors several pseudogenes whose

origin is autosomal.

A consideration of SlyTo candidate genes must also account for the epistatic relationship between

Sly and Agouti; for example, Sly is unlikely to represent a gene such as Sox18 which acts in the

dermal papilla to promote Agouti expression (FITCH et al. 2003; PENNISI et al. 2000). From this

perspective, genetic interactions between Mc1r and Sly would also be helpful in evaluating

potential candidate genes. Variation at Mc1r is curiously absent from the cat, but prospects for

determining whether Sly lies upstream, downstream, or parallel to Mc1r in the hamster are

encouraging, since recessively inherited cream coat color in the hamster is thought to represent

the action of Mc1r (MAGALHAES 1954; ROBINSON 1964).

These questions can be resolved, of course, by molecular identification of the Sly and Orange

genes, and should be facilitated by availability of additional mammalian genome sequences.

18

Defining the molecular genetics of Sly and Orange may also be useful as a tool for understanding

the biology of other color variation patterns thought to affect the distribution of pheomelanin and

eumelanin, such as tabby striping in domestic and wild cats, zebra striping in horse x zebra

hybrids, and rostro-caudal striping seen in squirrels and/or chipmunks (SEARLE 1968).

Acknowledgments

We thank Tyler Vogt for collecting data on hamster hair, Anne Schmidt-Küntzel and Marilyn

Menotti-Raymond for communicating unpublished results, and Angie Crowley of San Joaquin

Valley Fisheries for collecting and organizing founder animals. This work was supported by

funds from the National Institutes of Health, and a Stanford Graduate Fellowship (to L.Z.H.).

19

LITERATURE CITED

ANDERSSON, L., 2003 Melanocortin receptor variants with phenotypic effects in horse, pig, and chicken. Ann N Y Acad Sci 994: 313-318.

BARSH, G. S., 2006 Regulation of pigment type-switching by Agouti, Melanocortin signaling, Attractin, and Mahoganoid, pp. 395-410 in The Pigmentary System, edited by J. J. NORDLUND, R. E. BOISSY, V. J. HEARING, R. A. KING, W. S. OETTING et al. Blackwell Publishing, Oxford.

BENNETT, D. C., and M. L. LAMOREUX, 2003 The color loci of mice--a genetic century. Pigment Cell Res 16: 333-344.

BLAKE, J. A., J. E. RICHARDSON, C. J. BULT, J. A. KADIN and J. T. EPPIG, 2003 MGD: the Mouse Genome Database. Nucleic Acids Res 31: 193-195.

BRUDNO, M., A. POLIAKOV, A. SALAMOV, G. M. COOPER, A. SIDOW et al., 2004 Automated whole-genome multiple alignment of rat, mouse, and human. Genome Res 14: 685-692.

CONE, R. D., D. LU, S. KOPPULA, D. I. VAGE, H. KLUNGLAND et al., 1996 The melanocortin receptors: agonists, antagonists, and the hormonal control of pigmentation. Recent Prog Horm Res 51: 287-318.

DIPAOLO, J. A., and N. C. POPESCU, 1973 Distribution of chromosome constitutive heterochromatin of Syrian hamster cells transformed by chemical carcinogens. Cancer Res 33: 3259-3264.

EIZIRIK, E., N. YUHKI, W. E. JOHNSON, M. MENOTTI-RAYMOND, S. S. HANNAH et al., 2003 Molecular genetics and evolution of melanism in the cat family. Curr Biol 13: 448-453.

FITCH, K. R., K. A. MCGOWAN, C. D. VAN RAAMSDONK, H. FUCHS, D. LEE et al., 2003 Genetics of dark skin in mice. Genes Dev 17: 214-228.

HOEKSTRA, H. E., R. J. HIRSCHMANN, R. A. BUNDEY, P. A. INSEL and J. P. CROSSLAND, 2006 A single amino acid mutation contributes to adaptive beach mouse color pattern. Science 313: 101-104.

HUSTAD, C. M., W. L. PERRY, L. D. SIRACUSA, C. RASBERRY, L. COBB et al., 1995 Molecular genetic characterization of six recessive viable alleles of the mouse agouti locus. Genetics 140: 255-265.

JACKSON, I. J., 1997 Homologous pigmentation mutations in human, mouse and other model organisms. Hum Mol Genet 6: 1613-1624.

KAROLCHIK, D., R. BAERTSCH, M. DIEKHANS, T. S. FUREY, A. HINRICHS et al., 2003 The UCSC Genome Browser Database. Nucleic Acids Res 31: 51-54.

KENT, W. J., R. BAERTSCH, A. HINRICHS, W. MILLER and D. HAUSSLER, 2003 Evolution's cauldron: duplication, deletion, and rearrangement in the mouse and human genomes. Proc Natl Acad Sci U S A 100: 11484-11489.

KERNS, J. A., J. NEWTON, T. G. BERRYERE, E. M. RUBIN, J. F. CHENG et al., 2004 Characterization of the dog Agouti gene and a nonagoutimutation in German Shepherd Dogs. Mamm Genome 15: 798-808.

KIJAS, J. M., M. MOLLER, G. PLASTOW and L. ANDERSSON, 2001 A frameshift mutation in MC1R and a high frequency of somatic reversions cause black spotting in pigs. Genetics 158: 779-785.

KLUNGLAND, H., and D. I. VAGE, 2003 Pigmentary switches in domestic animal species. Ann N Y Acad Sci 994: 331-338.

20

KURAMOTO, T., T. NOMOTO, A. FUJIWARA, M. MIZUTANI, T. SUGIMURA et al., 2002 Insertional mutation of the Attractin gene in the black tremor hamster. Mamm Genome 13: 36-40.

KUROIWA, A., F. SUTO, H. FUJISAWA and Y. MATSUDA, 2001a Chromosome assignment of four plexin A genes (Plxna1, Plxna2, Plxna3, Plxna4) in mouse, rat, Syrian hamster and Chinese hamster. Cytogenet Cell Genet 92: 127-129.

KUROIWA, A., K. TSUCHIYA, K. MATSUBARA, T. NAMIKAWA and Y. MATSUDA, 2001b Construction of comparative cytogenetic maps of the Chinese hamster to mouse, rat and human. Chromosome Res 9: 641-648.

KUROIWA, A., K. TSUCHIYA, T. WATANABE, H. HISHIGAKI, E. TAKAHASHI et al., 2001c Conservation of the rat X chromosome gene order in rodent species. Chromosome Res 9: 61-67.

LAMOREUX, M. L., and T. C. MAYER, 1975 Site of gene action in the development of hair pigment in recessive yellow (e/e) mice. Dev Biol 46: 160-166.

LITTLE, C. C., 1957 The Inheritance of Coat Color in Dogs. Comstock, Ithaca, N.Y. LYON, M. F., 1962 Sex chromatin and gene action in the mammalian X-chromosome. Am J Hum

Genet 14: 135-148. MAGALHAES, H., 1954 Cream and tawny, coat color mutations in golden hamster, Mesocricetus

auratus. Anat. Rec. 120: 752. MARKLUND, L., M. J. MOLLER, K. SANDBERG and L. ANDERSSON, 1996 A missense mutation in

the gene for melanocyte-stimulating hormone receptor (MC1R) is associated with the chestnut coat color in horses. Mamm Genome 7: 895-899.

MCNULTY, J. C., P. J. JACKSON, D. A. THOMPSON, B. CHAI, I. GANTZ et al., 2005 Structures of the agouti signaling protein. J Mol Biol 346: 1059-1070.

MUNDY, N. I., N. S. BADCOCK, T. HART, K. SCRIBNER, K. JANSSEN et al., 2004 Conserved genetic basis of a quantitative plumage trait involved in mate choice. Science 303: 1870-1873.

NACHMAN, M. W., H. E. HOEKSTRA and S. L. D'AGOSTINO, 2003 The genetic basis of adaptive melanism in pocket mice. Proc Natl Acad Sci U S A 100: 5268-5273.

NEWTON, J. M., A. L. WILKIE, L. HE, S. A. JORDAN, D. L. METALLINOS et al., 2000 Melanocortin 1 receptor variation in the domestic dog. Mamm Genome 11: 24-30.

NIXON, C. W., J. H. BEAUMONT and M. E. CONNELLY, 1970 Gene interaction of coat patterns and colors in the Syrian hamster. J Hered 61: 221-228.

OHNO, S., 1969 Evolution of Sex Chromosomes in Mammals. Annual Reviews in Genetics 3: 495-524.

PENNISI, D., J. BOWLES, A. NAGY, G. MUSCAT and P. KOOPMAN, 2000 Mice null for sox18 are viable and display a mild coat defect. Mol Cell Biol 20: 9331-9336.

PERRY, W. L., T. NAKAMURA, D. A. SWING, L. SECREST, B. EAGLESON et al., 1996 Coupled site-directed mutagenesis/transgenesis identifies important functional domains of the mouse agouti protein. Genetics 144: 255-264.

RAUDSEPP, T., and B. P. CHOWDHARY, 2008 FISH for mapping single copy genes. Methods Mol Biol 422: 31-49.

RIEDER, S., S. TAOURIT, D. MARIAT, B. LANGLOIS and G. GUERIN, 2001 Mutations in the agouti (ASIP), the extension (MC1R), and the brown (TYRP1) loci and their association to coat color phenotypes in horses (Equus caballus). Mamm Genome 12: 450-455.

21

ROBBINS, L. S., J. H. NADEAU, K. R. JOHNSON, M. A. KELLY, L. ROSELLI-REHFUSS et al., 1993 Pigmentation phenotypes of variant extension locus alleles result from point mutations that alter MSH receptor function. Cell 72: 827-834.

ROBINSON, R., 1964 Genetic studies of the Syrian hamster. Genetica 35: 241-250. ROBINSON, R., 1966 Sex-linked yellow in the Syrian hamster. Nature 212: 824-825. ROBINSON, R., 1972 Genetic studies of the Syrian hamster. 8. The sex-linked gene tortoiseshell.

Genetica 43: 239-243. ROZEN, S., and H. SKALETSKY, 2000 Primer3 on the WWW for general users and for biologist

programmers. Methods Mol Biol 132: 365-386. SEARLE, A. G., 1968 Comparative Genetics of Coat Color in Mammals. Academic Press, New

York, N.Y. SILVERS, W. K., 1979 The agouti and extension series of alleles, umbrous and sable, pp. 6-44 in

The Coat Colors of Mice. Springer-Verlag, New York. SIRACUSA, L. D., 1994 The agouti gene: turned on to yellow. Trends Genet 10: 423-428. STAM, P., 1993 Construction of integrated genetic linkage maps by means of a new computer

package: Join Map. The Plant Journal 3: 739-744. STEINER, C. C., J. N. WEBER and H. E. HOEKSTRA, 2007 Adaptive variation in beach mice

produced by two interacting pigmentation genes. PLoS Biol 5: e219. STEINGRIMSSON, E., N. G. COPELAND and N. A. JENKINS, 2006 Mouse coat color mutations: from

fancy mice to functional genomics. Dev Dyn 235: 2401-2411. SUNDBERG, J., 1994 Handbook of Mouse Mutations With Skin and Hair Abnormalities: Animal

Models and Biomedical Tools. CRC Press. WRIGHT, S., 1917 Color Inheritance in Mammals: Results of Experimental Breeding Can Be

Linked up With Chemical Researches on Pigments—Coat Colors of All Mammals Classified as Due to Variations in Action of Two Enzymes. J. Hered. 8: 224-235.

WRIGHT, S., 1918 Color Inheritance in Mammals: X., The Cat--Curious Association of Deafness with Blue-eyed White Color and of Femaleness with Tortoise-shelled Color, Long Known--Variations of Tiger Pattern Present Interesting Features. J Hered 9: 139-144.

22

Table 1. Hair type distribution and pigmentary phenotypes

Animal Guard Hairs Awls/Auchenes Zigzags

Golden

(AW/AW; Sly+/Sly+)

Black (2%) Black (4%)

Banded (8%)

White (2%)

Banded (84%)a

Yellow

(a/a; SlyTo/Y)

Dark-tippedb

(2%)

Dark-tippedb (10%)

Dark-tippedb (88%)

a Black tip and base, wide yellow band

b Darkened tip (mixed pigment types); pale yellow shaft; white base

23

Table 2. Phenotype of F3 progeny from Black x Tortoiseshell intercrossa

Phenotype Sex No. progeny

Black Male 39

Yellow Male 33

Tortoiseshell Male 0

Black Female 46

Yellow Female 0

Tortoiseshell Female 37

a Based on cross as depicted in Figure 2A and described in the text.

24

Table 3. Genetic markersa

Marker Name Type Primersb Coordinatesc

DBarX111 2(Rbm10) GTCCTGAAAGGCCCGTGT GAACCAAAGGCCAAAACTGA

20212996-20214673

DBarX 51 1 GGAGGCTTAGCTTACCCCTTT ACGTGAAATTGTGTGCGTGT

40781605-40782207

DBarX 52 1 CACATGAGCTCTGTTGCATCT AAAGTCACCCTCATGGGAAG

53759564-53760159

DBarX 112 2(Bgn) GACCACAACAAAATCCAGGCb

CTCTCACCTGGAGGAGCTTGb 70738334-70738684

DBarX 113 2(Tbl1x) GGACGCTCACACAGGAGAAGb

GTCCTTGGAAGGTTTTGACTGb 74895226-74895824

DBarX 114 2(CNS) CCAGCTTTGGTCATTTGACAGb

AGGGACTTGGAAAGCTCACAb 84947982-84948629

DBarX 53 1 AAGGCAATGGCTTCATTGTT TGCTTCTGACCTTTGAGCAG

129415830-12941667

DBarX 54 1 CCACCTCTGTGAGCACATTC TGTCTAAATGTGTTTCTCACACTCC

131291877-131292275

DBarX 55 1 ATGCACCCCTCCAGTTCTGC TGGATCTGCAGTAATGTGCAGT

136812895-136813493

DBarX 56 1 GAGCGTCCCGGGAGCTCCTT CCACCTCTTACAGGAAGCC

147389767-147390410

DBarX 115d 2(CNS) ATTGCCTGCCAAATCACACTb

TGATTAAGTGACCCCAGAAATCb 156649400-156649723

DBarX 57 1 TCCATTGTTATTCAAGGAAGGAA GCTTTTGTGCAGATTCCCAG

158286467-158286797

DBarX 119d 2(CNS) AGGTGATGTCAGCGGCTCTb

TCTTTCCAGAACTCATCCCCb 158595286-158595666

DBarX 116 2(CNS) GTCGATTAGCATTGGCATTTb

AAAGCATAGCACACACAAGGAb 162665068-162665558

DBarX 118d 2(Prps2) GCTCATTGGTCAGCCAATCT CCATGTGCTTTGTGATTCCA

163801537-163803099

DBarX 117 2(CNS) GAACAGCAAGGAGGAAATTGb

CCTGAAGCCTCCCACTCCb 164867514-164867994

a Marker names correspond to those on Figures 2 and 3; types “1” and “2” refer to SSLP and

SNP markers, respectively, the latter followed either by the gene name or CNS (conserved non-

coding sequence) depending on how the primers were derived. Oligonucleotide primers were

25

originally designed from mouse genome sequence, but unless otherwise stated (see footnote 3),

new primers were generated from the amplified hamster sequence and used for subsequent

genotyping.

b All of the type 1 (SSLP) primers represent hamster sequence. However, for 7 of the 9 type 2

(SNP) primers (those indicated with a superscript), oligonucleotides based on the mouse

sequence yielded robust products when amplifying hamster genomic DNA, and we did not

redesign new hamster primers.

c Physical position of amplicons on the mouse X chromosome based on coordinates from the

July 2007 (build 37) release.

d Not included in Figures 2 and 3 because they added no new map information. Genotypes from

DXBar115 and DXBar119 were identical to those obtained with DXBar57; genotypes from

DXBar118 were identical to those obtained with DXBar117.

26

Legends to Figures

Figure 1. Pigmentary phenotypes of hamsters with different Agouti and Sly genotypes. A,

Yellow, black, tortoiseshell, and golden animals as described in the text. Genotypes are inferred

from X-linked inheritance of the tortoiseshell phenotype, and from molecular genetic analysis of

Agouti as described in Figure 4. B, Representative zigzag hairs from golden (Sly+/Sly+; AW/AW)

and yellow (SlyTo/Y; a/a)animals. Upper panels show ~80% of the hair; the lower 20% of a

“golden” hair is black, and the lower 20% of a “yellow” hair is pale yellow with a white base.

(The dimensions of the hair are such that the shaft is difficult to see in photos that contain the

entire length of the hair). Dashed box indicates region of the hairs shown at higher magnification

in the lower panels, and illustrates that the tip of the “yellow” hair contains a mixture of yellow

and black pigment, while the shaft of the “yellow” hair is pale relative to the corresponding

region of a “golden” hair.

Figure 2. Transmission and linkage of Sly. A, Structure of pedigrees used for segregation and

linkage analysis. Open, hatched, and yellow symbols represent black, tortoiseshell, and yellow

animals, respectively, with associated Sly genotype inferred on the basis of coat color phenotype

and sex. As described in the text, 17 such pedigrees yielded 155 F3 progeny, who were then

genotyped for the molecular markers as indicated. B, C, Haplotype segregation diagram, with

grey or yellow indicating whether the chromosome of origin carried Sly+ or SlyTo, respectively,

and haplotypes organized into single (B) and multiple (C) recombinants. Gene order is based on

multiple regression analysis of intermarker distances; minimizing the number of double

crossovers yields an alternative order for the first three markers, DXBar112 – DXBar52 –

27

DXBar51. Recombination frequency (RF) in cM between each marker and Sly is given on the

right together with the number of informative meioses.

Figure 3. Comparative X chromosome maps for mouse, hamster, human, dog, and rat. (A)

Physical position (rounded to the nearest megabase, Mb) is given for mouse, human and dog

markers, and the location of the pseudoautosomal regions (PAR or PAR1) indicated for mouse

and human. As described in the text, the hamster map refers to Xp (the long arm is

heterochromatic) with the position of the centromere based on comparison to molecular

cytogenetic results (KUROIWA et al. 2001a; KUROIWA et al. 2001b; KUROIWA et al. 2001c). A

homology block on human (46 – 54 Mb) and dog (40 – 45 Mb) Xp corresponds to the position of

Sly in the hamster. (B) Position of markers on the hamster X chromosome relative to the rat.

Figure 4. Genetics and epistasis of Agouti and Sly. A, As described in the text, black hamsters

carry a missense mutation that predicts a Cys115Tyr substitution, predicted to disrupt Agouti

function. B, Sly is epistatic to Agouti because SlyTo/SlyTo; a/a animals exhibit the same phenotype

as SlyTo/SlyTo; AW/AW animals.

Figure 5. Comparative genomics of Sly and Orange. A, Representative images of FISH for

mouse BAC probes 1 and 2 hybridized to mouse or hamster chromosomes, as indicated. (BAC

probes 1, 2, and 3 are, respectively, RP24-77C5, RP24-186P1, and RP24-96H13.) B, Diagram of

BAC hybridization results showing that the region homologous to the cat Orange gene lies in the

centromere-proximal region of the mouse X chromosome but the centromere-distal region of the

hamster X chromosome. By contrast, genetic mapping studies place the hamster Sly gene close to

the centromere of Xp. C, Summary of comparative mapping. The position of the cat Orange

mutation is based on work from Schmidt-Küntzel et al.

A

B

Sly+/Sly+; a/a

Sly+/Sly+; AW/AW

Sly+/Sly+; AW/AW

SlyTo/Sly+; a/a

SlyTo/Y; a/a

SlyTo/Y; a/a

Sly+/Sly+; AW/AW

SlyTo/Y; a/a

DXBar51DXBar112DXBar52DXBar55DXBar54DXBar53DXBar114DXBar113DXBar57DXBar116DXBar117DXBar56SlyDXBar111

DXBar51DXBar112DXBar52DXBar55DXBar54DXBar53DXBar114DXBar113DXBar57DXBar116DXBar117DXBar56SlyDXBar111

41 36 1 5 1 2 1 2 0 2 9 5 3 6 0 1 5 2 3 2 1 3 1 0 3 0 0 1

1 1 1 1 1 1 1

39 ± 4.5 (117)34 ± 6.1 (59)32 ± 5.4 (75)36 ± 4.8 (100) 32 ± 4.4 (112)32 ± 4.3 (116)23 ± 4.3 (97)28 ± 9 (25)15 ± 3.4 (112)11 ± 4.1 (57)11 ± 3.3 (90)4.2 ± 2.1 (95)----5.1 ± 3.5 (39)

A

B

C

Par.

Single recombinant

Multiple recombinant

RF with Sly (n)

SlyTo/Sly+

SlyTo/Sly+Sly+/Sly+

Sly+/Y SlyTo/Sly+

SlyTo/Sly+

Sly+/Y

Sly+/Y

Sly+/Y SlyTo/Y

A

B SyrianHamster

Rat

DXBar111

DXBar51

DXBar112

DXBar113

DXBar114

DXBar53DXBar54DXBar55

DXBar56

DXBar57

DXBar116DXBar117

Mb

1

159

128122120

74

6353484640

12

PAR PAR1

Mb MbcM (intermarker dist.)cen

cen

cen cen

Physical map ofMouse Chr. X

Markername

Genetic map ofHamster Chr. X

Physical map ofHuman Chr. X

152

134

124

10610098

54

46

28

1913119

2.90.3

6.9

0.7

8.1

4.9

4.2

4.1

1.83.0

4.3

5.3

41

20

54

7175

85

129131137

147158163165

DXBar111

DXBar51

DXBar52

DXBar112DXBar113

DXBar114

DXBar53DXBar54DXBar55

DXBar56DXBar57DXBar116DXBar117

Mb

Physical map ofDog Chr. X

124

109

99

847876

45

40

24

131086

Sly

non-agouti

wild-type

Eumelanin(black/brown pigment)

Pheomelanin(red/yellow pigment)

C D P C A S C Q C R F F Human. . . . . . . . . . . . Dog. . . . . F . . . . . . Pig. . . . . . . . . . . . Mouse. . . . . . . . . . . . Syrian hamster (wt). . . . . . Y . . . . . Syrian hamster (non-agouti)

Ser Cys Gln

TCC TGC CAGTCC TAC CAG

Ser Tyr Gln

A

B

AgoutiMc1rSly

109 120

Hamster candidateinterval

(Sex-linked yellow)

Human Chr. X Dog Chr. XCat candidate

interval(Orange)

A B

C

Sly

O

Mb Mb

46

54

120

131

4045

106

96

DXBar111

DXBar56

FCA1464

Rap2117

Mb106

9.6 cM

6 cM

(BAC3)

(BAC2)

(BAC1)

BAC1BAC2BAC3

(BAC3)(BAC2)(BAC1)

(BAC3)(BAC2)(BAC1)

heteroc.

Mouse X/X

Mouse Hamster

Hamster Sly+/Y

cen cenHamster SlyTo/Y

regionhomologous

to Orange

approximatelocation

of Sly