genes, genomes seminar of molecular and cell biology markéta dostalíková
TRANSCRIPT
![Page 1: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/1.jpg)
Genes, genomes
Seminar of molecular and cell biology
Markéta Dostalíková
![Page 2: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/2.jpg)
Genome
• complete set of information in an organism´s DNA
• human genome– nuclear DNA – linear dsDNA
• 25 000 genes
– mitochondrial - circular dsDNA• 37 genes
– 13 genes encode for proteins (respiration complex – oxidative fosforylation)
– 24 genes encode for 22 tRNA and 2 rRNA
![Page 3: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/3.jpg)
Gene
• Short strech of DNA encoding a single RNA or a single protein and adjacent sequences that are involved in gene regulation (they are transcribed, but not translated)
• Exon - transcribed into RNA and codes for the amino acid sequence of part of a protein
• Intron - transcribed into RNA, excised by RNA splicing to produce mRNA, does not code for protein
![Page 4: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/4.jpg)
DNA
![Page 5: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/5.jpg)
DNA molecule
• 4 types of nucleotides: A,G,C,T• Base,sugar, phosphate
• Hydrogen bonds• Phosphodiester bonds
• 2 polynucleotide chains• Double helix
![Page 6: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/6.jpg)
Bases
DNA : A, G, C, TRNA : A, G, C, U
![Page 7: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/7.jpg)
![Page 8: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/8.jpg)
Sugars
![Page 9: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/9.jpg)
The Formation of DNA
Base + Sugar = Nucleoside– the 1´ carbon of pentose is attached to
nitrogen 1 of pyrymidine or nitrogen 9 of purine
![Page 10: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/10.jpg)
The Formation of DNA
Base + Sugar + Phosphate = Nucleotide– phosphate is attached to
the 5´-carbon of the pentose ring
![Page 11: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/11.jpg)
►deoxyribonukleotides – basic structure of DNA
dAMP = deoxyadenosinmonophosphate dATP = deoxyadenosintriphosphate
dNTP
nukleoside(eg. deoxyadenosin)
{
![Page 12: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/12.jpg)
The other functions of nucleotides
Energy carriers, chemical groups carriers Specific regulators
![Page 13: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/13.jpg)
The Formation of DNA
Nucleotides join together to form nucleic acid • The hydroxyl group attached to the 3´-pentose carbon of one
nucleotide forms an ester bond with the phosphate of another molecule, eliminating a water molecule
• The link between nucleotides is known as a phosphodiester bond
• Thus, one end of a DNA strand has a sugar residue in which the 5´-carbon is not linked to another sugar residue (the 5´end)
• Whereas at the other end the 3´carbon lacks a phosphordiester bond (the 3´end)
![Page 14: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/14.jpg)
3’
5’
3’
5’
Po
larity of D
NA
strand
![Page 15: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/15.jpg)
DNA Structure• The double helical structure of DNA was proposed by Watson and
Crick (1950)• The DNA helix
– The „backbone“ on the outside of the helix consists of alternating sugars and phosphates
– The bases are attached to the sugars and form the „rungs“ of the helix
• The strands are – anti-parallel
• their 5´,3´-phosphordiester links run in opposite directions– complementary
• because of base pairing the chains complement each other
![Page 16: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/16.jpg)
video
![Page 17: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/17.jpg)
DNA is usually found in the structure of right-handed double helix of complementary and antiparallel strands
Minor groove
Major groove
![Page 18: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/18.jpg)
Nucleid acid are polymers of nucleotids. Double-stranded DNA containing deoxyribose can have several conformations
A - DNA Z - DNA
B - DNA
![Page 19: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/19.jpg)
RNA
can have (3D) conformation because of the intramolecular base-pairing (A-U, G-C)
![Page 20: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/20.jpg)
Modifications of DNA
• methylation of cytosin
• CpG islands, in promotores, in non-coding regions
• they are involved in the gene imprinting, condensation of X chromosom
![Page 21: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/21.jpg)
The elementary structural unit of DNA is nucleosome
Histons: H2A, H2B, H3, H4 are present in nucleosome core (each twice). This protein - octamer - scaffold and DNA altogether form nucleosome
The lenght of DNA from one nucleosome to another is 200 bpcca 150 bases pairs is wounded around nucleosome
![Page 22: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/22.jpg)
Composition of nucleosome
Histons are very conservative proteins containing so call histon fold and long N-ends
Octamer of histons composes from tetramers H3/H4 and two dimers H2A/B
![Page 23: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/23.jpg)
Nucleosome is dynamic structure
Dynamics of nucleosome condensing and releasing is regulated by other proteins
Other various types of histones can be found in some specific nucleosomes and sequences
![Page 24: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/24.jpg)
Higher level of chromatin organisation – „solenoid“, 30 nm fiber
Nucleosomes are bound together by H1 activity and activity of N- ends, e.g. H4 free ends
Nucleosome beads on DNA wire
![Page 25: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/25.jpg)
10 000 fold condensated DNA form mitotic...
...chromosome
Stick structure is in next step condensated by group of proteins - condensins
![Page 26: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/26.jpg)
Organization of DNA into chromosomesEukaryotic chromosomes contain one linear dsDNADNA associates with histons and creates chromatin
![Page 27: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/27.jpg)
Chromatin remodeling complexes
Modification of chromatin
![Page 28: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/28.jpg)
Modification of histons: acetylation, methylation, fosphorylation
Modification of chromatin
![Page 29: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/29.jpg)
Histon code
In addition to genetic code there is also „histon code“ – next level of genome information realization
![Page 30: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/30.jpg)
Histon code
Modificated histons are bound to other types of proteins - system of readers and writers
![Page 31: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/31.jpg)
DNA and histon modifications take place in epigenetic regulation of gene expression
Genetic vs epigenetic information and heredity
![Page 32: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/32.jpg)
Genetic information
• nearly all information that is realized by cell is in DNA
• information concerning the structure and functioning of cell
• It is carried through generations
• It must be changeable but not too much (lasting and stable
enough vs capability of changing during evolution)
• Genom is complete set of DNA (and thus information)
• Genophore: carrier of genetic information
![Page 33: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/33.jpg)
![Page 34: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/34.jpg)
Genes• Gene: sequence of nucleid acid which encodes a single polypeptide
chain (protein) or a single RNA chain (rRNA, tRNA)• Eukaryotic and prokaryotic genes differs in many features
(monocistrons, introns)• Regulatory regions of genes – promotors; enhancers• Repetitive sequences: are used for identification • Mobil elementes (transposons): spread in genom• Pseudogenes
Gene locus
![Page 35: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/35.jpg)
35
![Page 36: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/36.jpg)
Repetitive sequences are used for identification
![Page 37: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/37.jpg)
Seqences in DNA:
• Encode aminoacids – proteins (mRNA)• Encode RNA as a final product
![Page 38: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/38.jpg)
Genetic codeGenetic code – a rule by which certain sequence of bases
determines relevant amino acid
tripletive, universal, redundant
Three bases code one amino acid = triplet = codon
20 coded amino acids
4 bases (A, G, C, T) → 64 (43) combination of triplets (codons)
initiation codon is also a codone for methionin
3 triplets function as stop codons 3 possibilities of reading of the sequence of triplets: reading frames
38
Some aminoacids can be encoded by one codon (methionine, tryptophan) some by six codons (leucine, serine, arginine)
![Page 39: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/39.jpg)
Task
AGUGAAAUGAUUAAUGCAAGGUGAGGGGAGAACGAGUGAUAA
Tyrosine - Y
Tryptofan - W
Glutamine - Q
Arginine - R
Asparagine - N
Lysine - K
Aspartic acid - D
Glutamic acid - E
![Page 40: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/40.jpg)
Frameshift
Deletion or addition of DNA sequences– They may arise as a result of unequal crossing over during
meiosis, or spontaneous breakage of chromosomes
• For example, deletion of a single base will alter remaining
amino acid sequence
• Duchenne muscular dystrophy (deletion and alteration of
reading frame)
• Becker muscular dystrophy (deletion but not alteration of
reading frame)
![Page 41: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/41.jpg)
![Page 42: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/42.jpg)
Expansion of trinucleotide repeats
expansion of a sequence of DNA that contains a series of repeated
nucleotide triplets
– In diseases identified so far the repetitive sequence is present in
the gene of normal individuals, but is expanded up to a 1000-fold
in the gene of affected patients
– Myotonic dystrophy – CAG repetition, progressive muscle
weakness
– Huntington‘s disease – progressive dementia and involuntary
movements, in middle age
– Fragile X syndrome – X chromosome linked mental retardation
![Page 43: Genes, genomes Seminar of molecular and cell biology Markéta Dostalíková](https://reader036.vdocuments.us/reader036/viewer/2022062806/5697bf7b1a28abf838c8348e/html5/thumbnails/43.jpg)
Task
To find this nucleotide sequence on web site
gcccgagagaccatgcagaggtcgcctctggaaaaggccagcgttgtctccaaacttttt
http://blast.st-va.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastHome