Proc. Natl. Acad. Sci. USAVol. 90, pp. 9001-9005, October 1993Biochemistry

Genes for El, E2, and E3 small nucleolar RNAsMIHIR K. NAG, TUNG T. THAI, Eiuc A. RUFF, N. SELVAMURUGAN, M. KUNNIMALAIYAAN,AND GEORGE L. ELICEIRIDepartment of Pathology, St. Louis University School of Medicine, St. Louis, MO 63104-1028

Communicated by Joseph G. Gall, June 17, 1993 (received for review April 22, 1993)

ABSTRACT We have found earlier three small nucleolarRNA (snoRNA) species, named El, E2, and E3, that haveunique nudeotide sequences and may participate in ribosomeformation. The present report shows that there is a monophos-phate at the 5' end of each of these three snoRNAs, suggestingthat their 5' termini are formed by RNA processing. El, E2,and E3 human genomic sequences were isolated. Apparently,the E2 and E3 loci are genes for the main E2 and E3 RNAspecies, based on their full homology, while the El locus is agene for an El RNA sequence variant in HeLa cells. These locido not have any of the intragenic or flanking sequences knownto be functional in other genes. The El gene is located withinthe first intron of the gene for RCC1, a protein that regulatesonset of mitosis. There is subsntial sequence homology be-tween the human E3 gene and flanking regions, and intron 8and neighboring exons of the gene for mouse translationinitiion factor 4AII. Injection of the human El, E2, and E3genes into Xenopus oocytes generated sequence-specific tran-scripts of the approximate sizes of the respective snoRNAs. Wediscus why the available results are compatible with specifictranscription and prosing occurring in frog oocytes.

Some of the small nuclear RNA genes, such as Ul, U2, U3,U4 and U5, constitute an additional subfamily of genestranscribed by RNA polymerase II, while others, such as U6and 7SK, represent another class of genes transcribed byRNA polymerase III (1-3). Seven small nucleolar RNAs(snoRNAs) have been described in metazoa (U3, U8, U13,U14, X, Y, and 7-2/MRP) and 12 snoRNAs have beencharacterized in yeast (U3, U14, snR3, snR4, snR5, snR8,snR9, snR10, snRll, snR30, snR189, and snR190) (4). Werecently found three additional snoRNAs in human cells,which were named El, E2, and E3 (5). Their unique se-quences imply that they are members of another class ofsnoRNAs, their 5' termini are not capped, they are present atlow levels in vertebrate cells, and they appear to be "house-keeping" RNAs, expressed in all tissues examined (5). Theymay function in some aspect of ribosome formation, since inaddition to being detected only in the nucleolar fraction, theyare psoralen-photocrosslinked in vivo to unique segments ofpre-rRNA (6). The isolation and expression of human genesfor these three snoRNAs are reported here.*

MATERIALS AND METHODSA human blood genomic library in bacteriophage AGEM-11(Promega) was screened with 32P-labeledDNA probes for El,E2, and E3 RNAs. Fragments cut from the bacteriophage Aclones (with Pst I, EcoRI, and HindIII, for clones E1-7, E3-2,and E2-1, respectively) were subcloned into plasmid pT7/T3a-18 (BRL) and sequenced. The El-7, E3-2, and E2-1plasmids (16 pg, 80 pg, and 6 ng per oocyte, respectively,mixed with [a-32P]GTP, when indicated) and a Xenopus 5SRNA maxigene plasmid (7) (0.17 ng per oocyte, mixed with

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

the snoRNA plasmids when indicated) were injected into thenucleus of oocytes (20 nl per oocyte), which were thenincubated at 19°C for 24 hr. When indicated, 2 hr after theplasmid injection [a-32P]GTP was injected into the cytoplasmof half of the oocytes, and then all oocytes were incubated at19°C for 24 hr. When indicated, the solution containing oneor two plasmids also included a-amanitin at 2 or 400 pg/ml("low" or "high" level, respectively). The deproteinizedsamples were digested with DNase I [Worthington (codeDPFF) or BRL] at 100 pg/ml, with or without RNase A(Sigma) at 40 pg/ml for either 15 min at 22°C or 30 min at37°C. Nonradioactive RNA was fractionated by 5% (10% forradioactive RNA) polyacrylamide gel electrophoresis andelectroblotted to Zeta-Probe membrane (Bio-Rad).

RESULTSThe 5' ends of El, E2, and E3 RNAs do not have a trimeth-ylguanosine cap or another type of cap (5). They were radio-labeled with polynucleotide kinase and [-y-32P]ATP only afterdephosphorylation with alkaline phosphatase (Fig. 1A), indi-cating that they have a phosphate at the 5' terminus. El, E2,and E3 RNAs were not labeled with guanylyltransferase and[a-32P]GTP (Fig. 1B), suggesting that they have a monophos-phate group, instead of di- or triphosphate, at the 5' end. Theywere labeled with RNA ligase and [5'-32P]pCp (Fig. 1C),indicating that there is a hydroxyl group at the 3' terminus.These results imply that the 5' ends of El, E2, and E3 RNAsare formed by RNA processing. They also indicate that thesethree snoRNAs are not degradation products, which usuallyhave 5' hydroxyl ends and 3' phosphate termini.A human genomic library was screened with DNA probes

for El, E2, and E3 RNAs. After restriction endonucleasedigestion, some of the positive clones were compared withhuman blood genomic DNA by Southern blot analysis. PstI-cut clone E3-2 essentially comigrated with the slowestmajor band of Pst I-digested human genomic DNA thathybridized with an E3 probe (Fig. 2A, lanes 2 and 3). Severalgenomic clones showed sequence homology to El; theydiffered from each other by restriction enzyme mapping (Fig.2A, lanes 11-15 and 18-22; Fig. 2B; and data not shown)and/or nucleotide sequencing (data not shown). Pst I-cutclone El-7 migrated slightly faster than 4.4 kb (Fig. 2B, lane2)-that is, at virtually the same electrophoretic mobility asthe main band of Pst I-digested human genomic DNA thathybridized with an El probe (Fig. 2A, lane 16).The DNA fragments in the bacteriophage A clones that

showed homology to El, E2, or E3 RNA were subcloned intoplasmid and mapped. The El-7 clone, cleaved with Pst I, is-3.8 kb long; the length of the HindIl-cut E2-1 fragment is-2.9 kb; and, after digestion with EcoRI, the E3-2 clonefragment is -0.95 kb long. Restriction endonuclease mappingshowed that the 5' flanking sequences of these fiagments are-1.2 kb for El-7, ""2.2 kb for E2-1, and ""0.8 kb for E3-2. This

Abbreviation: snoRNA, small nucleolar RNA.*The sequences reported in this paper have been deposited in theGenBank database (accession nos. L22738, L22739, and L22740 forthe E1-7, E2-1, and E3-2 genes, respectively.

9001

Proc. Natl. Acad. Sci. USA 90 (1993)

C RNA ligase

E3 E2 El V SS M

A PstIPvuUIE3 E3 m E2

r iI -- I Iit '-Clonm 1 2 Tot 1 2 Tot 1 1

-;w_ .w. _ W.:_0.I* No

B

1 2 3 4 5 1 2 3 4 5 6

FIG. 1. El, E2, and E3 RNAs are labeled with polynucleotidekinase only after phosphatase treatment (A), are not labeled withguanylyltransferase (B), and are labeled with RNA ligase (C). (A)HeLa cell nucleolar RNA was (+) or was not (-) incubated withalkaline phosphatase and then was deproteinized, incubated withpolynucleotide kinase and [-32P]ATP, deproteinized again, hybrid-selected with El, E2, and E3 DNAs, and analyzed by 10% poly-acrylamide gel electrophoresis. (B) A mixture ofHeLa cell nucleolarRNA (50 pg) and cytoplasmic RNA (10 pg) was incubated withguanylyltransferase and [a-32PJGTP. The deproteinized RNA washybrid-selected (including 5S DNA) and analyzed as in A. A muchlonger x-ray film exposure of this gel was also negative. 32P-labeledfiagments of Hae III-digested OX174 bacteriophage DNA (72-1353bp long) provided size markers (M; an arrowhead marks the 118-bpfragment). (C) A mixture of HeLa cell nucleolar and cytoplasmicRNA was incubated with RNA ligase and labeled pCp. The depro-teinized RNA was hybrid-selected [including 5S DNA and theplasmid vector (V) without inserts] and analyzed as in A. The x-rayfilm exposure was much shorter in lane 5 than in lanes 1-4. Markers(M) are as in B.

E3-2 fragment has 104 nt of 3' flanking sequence. The nucle-otide sequences of El, E2, and E3 RNA homology and theirflanking segments were determined. Clones E2-1 and E3-2have regions of perfect homology to E2 and E3 RNAs,respectively (Fig. 3A). Nucleotide U19 is present in HeLa celltotal El RNA (Fig. 3B), but its equivalent T residue is absentfrom genomic clone E1-7 (Fig. 3A) and from a HeLa cellcDNA clone (data not shown). The rest ofthe El sequence inclone E1-7 is identical to that of HeLa cell unfractionated ElRNA. The transcription signals that function in other genes(1-3, 8-10) are absent from the flanking and coding regions ofthese three loci, in the expected locations relative to themature ends ofthe snoRNAs. The E1-7 sequence is located inthe first intron of the gene for the protein RCC1 (GenBankaccession no. D00591) (11). RCC1 is involved in the regulationofcell entry into mitosis (12-14). The El gene is found betweenpositions 1279 and 1486 of the 2040-bp intron 1 of the RCC1gene. There are only two differences between the 955-bpsequenced portion of the E1-7 clone and the sequence of theRCC1 gene. In the RCC1 gene there is an additional G residuebetween nucleotides C192 and A193 of the El coding region,and a T residue instead ofa C 91 bases downstream of the Elcoding region. It seems virtually certain that the El-7 sequenceis a region of the first intron of the RCC1 gene, because adiscrepancy of 2 out of 955 nt could easily represent experi-mental error. The nucleotide sequences ofotherhuman El andE3 genomic loci (Fig. 2) differed substantially from those ofEland E3 RNAs, respectively (data not shown), and were notstudied further. The sequence of human E3 RNA (5) is 90oidentical to a section of intron 8 of the gene for mousetranslation initiation factor 4AII (GenBank accession no.

1 2 3 4 5 6 7 8 9 10 111213141516171819202122

E1l12 7 18

kb- 9.4-6.6

-4.4

1 2 3

FiG. 2. Southern blot analysis of human total genomic DNA andgenomic clones. (A) Total (Tot) genomic DNA (lanes 3, 4, 7, 8, 16,and 17) and the indicated genomic clones were digested with Pst I orPvu II and analyzed by agarose gel electrophoresis followed bySouthern blot hybridization With 32P-labeled DNA probes for E3(lanes 1-6), E2 (lanes 7-10), and El (lanes 11-22) RNAs. Mobilitiesoffragments from a HindIll digest of A phage DNA are shown on thesides. (B) El genomic clones were digested with Pst I and analyzedas above with a probe for El RNA. Mobilities of three fiagments ofA DNA are indicated at right.

X56953) (15). There is also high sequence homology betweenthe flanking regions of the human E3 RNA gene and exons 8and 9 ofthe gene for mouse initiation factor 4AII; within intron8 the sequence homology is highest in the segment thatcorresponds to the E3 coding region (Fig. 3). This suggests thatthe E3 RNA gene might be located in an intron ofthe gene forinitiation factor 4AII. The mouse U14 snoRNA gene lies in anintron ofthe gene for hsc70 heat shock pre-mRNA, and mouseU14 RNA is generated by processing of that intron of thepre-mRNA (16).We tested next whether these snoRNA genomic clones

were expressed in Xenopus oocytes. Expression of the Eland E3 sequences was low and needed Northern blot analysisfor easier detection. The nucleic acid samples isolated fromoocytes were digested with DNase I before electrophoresis.The human El transcript in frog oocytes comigrated withHeLa cell El RNA in polyacrylamide gel electrophoresis,was resistant to extensive DNase I digestion, and wassensitive to RNase A (Fig. 4A). The human E3 transcript inoocytes migrated slightly behind HeLa cell E3 RNA and wasDNase I-resistant and RNase A-sensitive (Fig. 4B). Therewere also heterodisperse transcripts bearing E3 sequencehomology, which were larger than mature E3 RNA (Fig. 4B);the intensity of these signals varied among different prepa-rations and they were not studied further. Injection of theE2-1 plasmid and [a-32P]GTP into frog oocytes produced aradioactive transcript that could be hybrid-selected with E2DNA and that comigrated electrophoretically with HeLa cellE2 RNA (Fig. 4C). The hybridization signals detected afterinjection of El, E2, and E3 genomic DNAs were sequence-specific new transcripts, since they were not affected byextensive digestion of the samples with DNase I beforeelectrophoresis, disappeared if pretreated with DNase-freeRNase A, and were absent after injection of only the plasmidvector (data not shown) or after hybrid selection of radiola-beled transcripts with only plasmid vector DNA (Fig. 4C).Expression of the El sequence began within 4 hr of postin-

Pst I Pvu IIIEl - -El

1 --2345 o 1 2 41 2 3 4 5 Tot 1 2 3 4 5

A 4a

phosphatase -

El

* E3

1

2

- kbJ231

*,9.-6.8- 646

9002 Biochemistry: Nag et al.

Biochemistry: Nag et al.

A E1-7I,(l; :'GA': A:A.':(:5Gf-r l~( W.,:I:A'JI'I''"I:. \ '''1''.0lI"ATA ?.11A>G¢.\rTICA¢''AT'

(C !"FGCCA': ;(IFGGTC'rI7 (1'AA(:GCC'GA(FTr'rC.-TGG'TCCCCCACGCCAGC;C(r'( AAC.ATlT''

'l AFA.A I'Ll'I'';AAICrATlA( ;'." iCGiAA' 'I'ArI,GCrl"'l'('CTCCFAil l" '!'(.:I1GATT;TCCCIl

CAT'II-TAT''':'IAT-:'A,1 A AIFACA'.CCC:CAf,AI'-CTCCCCCA'!''I

CC)(.( I A=^ I sAA:-'AAv1':(:A I'; ITTTCA .AAI1TACIA1ACCI'G AATC-I'I'

(.''I 'T T('Tl'f(;CC-GTArCT Fr(AACA l'AG (I'AC:I'AACCG(CCT'A'TITGTAAAC;TAAl'11 AGAATA

C, l:'! (.AA'i'.> 'A'*R';~TIIAC¾Cl'A1'-I-A,IAACCCGAT7 FTT'I'"17AA ACCA '7'A.K f T A.A

(I(;I'GCAAACCCTTT¢CF'1'l C' Cl''lTAAC'ATC'TGTAG'FAACATGAAT'(CATCAAATTG

rr{l'T'IC"'i'A'Ilr'W'.. A1"'i'.': I'AAATTTATGCGl"[lACACTCAETGT.'fCAACGTCCATACACCC-12'

Cr"I, A.C,CT'C .,'I,.'C C.. fCCGTCT-. G'T C'CA1AC'I.G"C CCTAC GAG CATA C;C.CTC TGCCC

ATfA-l'.'1FAAAGTCCCrTTTC,Af '.CA TTCIC.AAATAAAGCi'CCGCCTCC1C,TCTC.fTCGCCT

;('A _FAT 'CCTA CA'.. 'TTCC'CAACATCCTCfTCCACAATTACTC,CGGAGACAAACCATC,CAG

CAAA'A.' ..'("' 'iTA''A CAoCACI'.AATC "'C'II-AA1T'"TTTTTTTT1T'IIfrTTTT:TCC

ACATICGA' CGCCFCTC,GTTCCCACGG'I'C--GACT'CCAGTGCCGCAC'rCCA1"'(.'CCTCT3CCI'I

CCCGCC;TTCAA ;'ICAT'TA'rCCTAATCrGAT'lI':'I'CCTGCCl"l'CIGCCTCCT(;Ar TAGC'FGGC-A

I "rACAC,. '(CCCCGCCACAC1-CCAC-CTAA 'I l'TTTrGCTATrTT"I'AG).AAAT,A,A-Al

E2-1(.C ':'IGC' ;: 'I'(. ACAAAA'i FAC'Ie,C A. CAl' ',I GAACi;'C' :,A.: sTACT'lTG': IACTG -

C-'(;C.GATATAl'ACl' ACGAAAAAC'AAGCCTC'I'('l TTTT'I'AA'I'T('l'ATI'GCAGGAAATCTCTGCC,AC;

AAC"TAAGA.ArGCTTAAC>"AAAC 'I'C-GATA, G'T'T^TC('CTTTACATCCACTACTACGTGATI

AA5'I 1'GGCCA-'.GCCCA .-ATC.CTlACl'CU;G;'I' CC(A. ';CA;A'1'TTGCTGT'rFCAAI'.ATCGA

CIA'A-AC'IAAC¢'ll''Fl'AAA l'l'CTT'CAA5ACA' ;CC CTCGl'C"'A.V5'PFTC¢C'C( TCTGCCACTC;C;

A.''CCACTCCAAT'rCCTGCCCCCCGT"I'CACTC(< 'CCGAACCT'I'CACTAACCAGA'T'CCA.GCCAC-G"

C( ''CCC-1A' ("CACGCCC I'I'CCI'G'CGG1ITt.'"l' GA C CCAoCC' T A'-CACCACCCTC'T'AC

GCACGCAI'C 'I'AI'CG'T'TAACC'TACCTACCA'"I'CICGCC'IG'1'G'rAAACAGATTrCTCCTCTGCG

(*''!(;TCTFCA'ACICCACC:CA'C'AA'-.ACAAf,C-CTAA'I C.A'7' 1'i TA'CGAI'CTAGACTTTC

CAAKIG CT'G'TC C CTTACGAAAAAACATTCCCTGCl'AGCTACTTCTTACA., C,CT'ICAC: -TTCAGCi., '

A.'FGACTCCC(''ATCAAC I'CCGC'AAGT-CTA.';CTTACG'G'I'GT''I'ACAATGACGGCC;.CAAGTT'ITCG

C'TAACACCA('AAGCGTC'I' T'CGCCCAATCAC,T(.CAGTT'I GATATAAT'TCT-'C"IGCTACAA(-

'If''9lAACATTA'C''GCA Af,:'1TGIfA" AAAT-' A M.ACA'I1'TC-AAAAI'AGVIC-rC-fr-r

CTTCTCCC'C"C"I CTCCAFI'Gllr' ''rGCCI CA GICCCTCAI'CA "1 T'i'('CCCT lr'(';'TTI'TCACA('

CtA.6"'OT1;A5'I' (;'C'- Tl' CTA'C'"Ai .A.AIA"'"'1'A.*A)^AAC'!'CIC'( (' G r 'fTAT -A 'T -C

l''.'CAT'TTC 'ITAAC C'CT FTC;TCCATIAS AA. II r CCA -Al ATTTTTT'i' l'AAAT CCCAC'TC

'I 'C(AG)G(;CAl"l"lP'T'TTT'T.'CAAI (,CCTATCAI'I(CCAG'G;lCTGCAGCAACCG'I''i'C;AAATCCCT'A

Proc. Natl. Acad. Sci. USA 90 (1993) 9003

60

120

189

2 4 O

300

360

423

480

540

600

660

720

840

90

60

120

180

246

300

360

423

480

5 4. O

600

660

7211

7 SO

841

9 6()

10 20

1 022

E3-2AA^TACAA-CAC fACIA'A '.A.ArACTGCCTC;ACCT CTTC-r "_(AT(:'AA.C7.TCCT- T('yTCT7

AAGCATICrGGTCGCAATI'AtF(:TCATTAGAC(-TAACAGAA, CAAGTTA FFTTATAA TI f CTA

CGT FlTI'CACACPCCC.Gl"IATr;GACACTGCC.'TAACACT',GC)~..ATTTTC. . !A 1I7IGCT.C GA

CACAGl'OI'TCACTT:'C'rTCA.j,CCCI'GC'- CTG-T 'CA(' C!CC' TA C-( A(lCA

TC CCAAACCGCTGG;G ATI'I'ACAGGCAT'I'AG CACFC CC-C,'T(,GCCCAC AA'(TCAAT'(T'rFJ'IAAC

TTTTGTTTAAAATCATCGC;AA'lT'TTGl'1"ITFC* * TT * * *1'GAGAGCAGG'!''' GZAAAAAC''AIkATAGAC'I'GC'TAACI;''i'CAA (:?A 1('*TA. -A C'AA

* **C****C**T************* *****T'; * * **IF* *A* *A* * * * * *

AAGTTGGATACACTTFrGTGACTTGTACCACACACTCAC(CAI IA'T/CACA' CGC 'I(-TTA'I' iT'l'Fr

CTCAATACCAG-CGCAAGGTGCACTGCCTCGA'TGAI '..2.:AO'.' CACrJ>CA';A.AC' .151(-'A2A

*F** ***** *** *******T*A*A*'rAGT***CAA +**** -C'* **GCTTTCrGCTCTGGTAAGAGGT-GTTCTAAAATG-TIC'l'cGATTTCAC(I' AAACA(-CI' I C

AGACTACAATATAGCTGCTAAGTGCTGTCTTGTCGT'C'Cr'CC.TCT-IAA*AT6AAA'Cr F

TTC'l'IAA,CTATACC'GTCTGCTATTCTCCTGTACCAC- CAGGCC-A,C I' C,CTCTC'CA'I'A(. A

**A***AA******TG**'rGCC'FG****OTATG****A*A*A*********T**(;**I'*T --TTG--ATTAAAATTA------ A-ATA-CCGACCl C(;ACTCCG': CATrTC F"To A *Tl 1,.A(- FT

***;*************;***A*** w*~***** *F** **TTATTAAT'TTGCAGCATGGTGACATGGACCAGAACGAGAGACATCI1"I'ACATGAI( ;(/;AA'I

TCCGGTCAGGGTCAACTCGTGTTCTCATCACI'ACTCACTTGTTCl-(C1IAAG'CI'CTCT''AA'!'C

G*A**T*---***T*** *A*TTTTTAAAAATCTACCAAAAGTTAGCCT'TTTTGGGCG,CICACG.C'I'TF l' 'AAGI''AAC

160

120

4 0

3C0

4 1 ')941 9

4 109

4 3l

420

421/9480

4 ,934 )8

4 ))9b,', 8

44- ')s,8

4 039

8 f, 84'6) 446'30682

081

B U G CA

.:........

.....

.. ..

FIG. 3. (A) Nucleotide sequences ofhuman genomic clones El-7, E2-1, and E3-2. There is a thin line under the coding regions. Other markingsindicate homologous sequences present in genes for two different snoRNAs. The U residue shown below theDNA sequence, between nucleotidesC18 and G19 of the El-7 coding region, is absent from the El-7 genomic clone and from one HeLa cell cDNA clone and is present in theunfractionated population ofHeLa cell El RNA. We have incubated HeLa cell El RNA with alkaline phosphatase, labeled it with polynucleotidekinase and ['yo32P]ATP, digested it with nuclease P1, fractionated the digest by thin-layer chromatography, and found a U residue at the 5' endof El RNA (data not shown). The figure includes this finding. We have also determined that there is a U residue at the 5' terminus of HeLa cellE2 RNA, and anA residue at the 5' end ofE3 RNA, using the same procedure (data not shown). The nucleotide sequence ofa portion ofthe mousegene for translation initiation factor 4AII is shown above the E3-2 sequence: it is labeled on the right side as nucleotides 4159-4684; an asteriskindicates a nucleotide identical to that in E3-2; a dash indicates an absent residue; and arrows show the boundary between intron 7 and exon 8,exon 8 and intron 8, and intron 8 and exon 9. (B) Segment of the sequence of HeLa cell total El RNA; arrowhead indicates nucleotide U19.

jection oocyte incubation, whereas expression of the E2sequence started after 8-24 hr (Fig. 4D). Precursors largerthan mature-size El and E2 RNAs were not detected evenafter the shortest times of postinjection oocyte incubation(Fig. 4D), suggesting that the delay in appearance of E2transcripts was not caused primarily by slow RNA process-ing. Although the expression of human El and E3 in frogoocytes is inefficient, the specificity of the sequence andlength of the transcripts suggests that they are not artifacts.

Injection ofgenes plus different amounts of a-amanitin intoXenopus laevis oocytes has been used successfully to identifythe RNA polymerase involved in their transcription (17-19).We injected into the oocyte nucleus a mixture ofeach snoRNAgene with a5SRNA maxigene plus a high or low concentrationof a-amanitin; 2 hr later [a-32P]GTP was injected into thecytoplasm of half of these plasmid-containing oocytes, andthen all were incubated for 1 day. This protocol provided

internal controls within the same oocytes for successful de-livery of DNA into the nucleus and effective intracellularconcentrations of a-amanitin, both monitored by the levels oftranscription of the 5S RNA maxigene and the endogenous 5SRNA genes. Expression of the injected human El (Fig. 5A)and E3 (Fig. 5B) DNA sequences was fully resistant to a highlevel of a-amanitin that completely inhibited 5S RNA tran-scription by RNA polymerase Im in the same oocytes. Incontrast, the expression of the human E2 clone was sensitiveto a low level of a-amanitin that did not affect RNA polymer-ase III transcription in the same oocytes (Fig. 5C), suggestingthat the E2 RNA gene is transcribed by RNA polymerase II.

DISCUSSIONAn in vitro transcript ofmouse U14 snoRNA extended at bothends with its genomic flanking sequences was cleaved to yieldmature U14 snoRNA when injected into frog oocytes (16). In

9004 Biochemistry: Nag et al.

A El B E3 CRNase + + z + ;

LDNase ++ + + M + + + +ar030m,372 + + : M UM M15m,22'+ cm * .. cm b JM

S ,.',.j'' ,13S3872603

.310..'281,271I.- 234

-194

I...,t 4118wk ql 4

* 72

12 3 4 56 1 234 56 1 2 3

FIG. 4. Expression of clones for human El (A), E3 (B), and E2 (C) RNAs in frog oocytes; expression after various postinjection oocyteincubation times (D). (A) Polyacrylamide-gel Northern blot analysis of RNA from oocytes that were injected with the El-7 plasmid and thenincubated for 1 day. Their deproteinized nucleic acids were digested with DNase I and/or RNase A for 15 or 30 min (m) as indicated. HeLacell nuclear RNA was loaded in lane 5, lane 5 of B, and lane 8 of D. Fragments of Hae III-digested OX174 DNA (M) were loaded in lane 6 andin lanes 6, 3, and 9 of B, C, and D, respectively; the 118-bp fragment is indicated by a small arrowhead. Lanes 1-5 were hybridized with a32P-labeled El DNA probe. (B) Northern blot as in A, except that the E3-2 plasmid was injected, and the blot was probed with E3 DNA. (C)Polyacrylamide gel electrophoresis of radiolabeled RNA from oocytes that were injected with the E2-1 plasmid plus [a-32P]GTP; the oocyteswere incubated for 1 day, and theirRNA was hybrid-selected with E2 DNA (lane 2) and plasmid vector only (lane 1). The electrophoretic mobilityof human E2 RNA in lane 2 is indicated by a dot. (D) Northern blot analysis ofRNA from oocytes that were injected with the El-7 (lanes 1-3)or E2-1 (lanes 4-7) plasmids and then were incubated for the number of hours indicated above the lanes. The blots were probed with El (lanes1-3) and E2 (lanes 4-8) DNA. The electrophoretic mobilities of HeLa cell El RNA (dot, lane 1) and E2 RNA (large arrowhead, lane 8) areindicated. The number of cell equivalents loaded on the gel was not necessarily the same in each lane.

vitro transcripts of human El, E2, and E3 RNAs extended atboth termini with their genomic flanking sequences did notyield mature-size El, E2, or E3 RNA after injection intoXenopus oocytes (I. P. Roudykh, R. Pascucci, and G.L.E.,unpublished results). This suggests that the specificity of the

human El, E2, and E3 RNAs detected in frog oocytes injectedwith human snoRNA genes does not depend exclusively onRNA processing. The synthesis of human El, E2, or E3snoRNA of correct size observed in frog oocytes might becaused eitherby nonspecific transcription followed by specific

B E3A 0KHM N 0 Ll

i..*'.

bY

ElOLH M

C E2M O L H N R

.: -

A4 *. ,.A 4,

4.

123 4 5 6 7 1 2 34 5 6789

FIG. 5. Effect of a-amanitin on the expression of genes for human El (A), E3 (B), and E2 (C) RNAs injected into frog oocytes. (A)Polyacrylamide-gel Northern blot analysis (lanes 1-3) of RNA from oocytes that had been injected with a mixture of the El-7 plasmid and a5S RNA maxigene plasmid, plus a high (H) or low (L) level of a-amanitin, or without a-amanitin (0). Oocytes were incubated for 1 day. Thedeproteinized nucleic acids were digested with DNase I before electrophoresis. The blot was hybridized with El DNA. The electrophoreticmobility of human El RNA is indicated by a dot at left. Fragments of Hae III-digested 4X174 DNA (M) were loaded in lanes 4 and 7, lane 5ofB, and lanes 1 and 10 of C. After 2 hr of oocyte incubation, [a-32P]GTP was injected into the cytoplasm of half of the oocytes, and they wereincubated for 1 day. The radioactive RNA was analyzed by polyacrylamide gel electrophoresis (lanes S and 6). The dot indicates the transcriptfrom the 5S RNA maxigene in lane 5. (B) Lanes 1-4 show Northern blot analysis of an experiment as in lanes 1-3 ofA, except that the E3-2plasmid was iujected and the blot was probed with E3 DNA. HeLa nuclear RNA (N) was loaded in lane 1 here and in lane 5 of C. As in lanes5 and 6 ofA, half of the oocytes were injected with [a-32P]GTP 2 hr after the first injection, and their radioactive RNA pattern is seen in lanes6-8. In lane 6, the upper dot indicates the transcript from the 5S RNA maxigene, and the lower dot shows the endogenous 5S RNA band. Lane9 (M) shows Hae III-cut DNA fragments of pBR322 that are 64 to 587 bp long. (C) Lanes 2-6 show Northern blot analysis of an experimentas in lanes 1-3 of A, except that the E2-1 plasmid was injected and the blot was probed with E2 DNA. Another aliquot of the sample loadedin lane 2 (oocytes injected without a-amanitin) (0) was incubated with DNase-free RNase A before loading in lane 6 (R). As in lanes 5 and 6of A, half of the oocytes were injected with [a-32P]GTP 2 hr after the first injection, and their radiolabeled RNA pattern is shown in lanes 7-9.

Proc. Natl. Acad. Sci. USA 90 (1993)

D etEl E2 °

hr 4824 4 82448zM

.: :.... :.i..

it,

1 23 4 5 6 7 8 9

O L HM

A__ :

1

Proc. Natl. Acad. Sci. USA 90 (1993) 9005

RNA processing or by specific transcription and RNA pro-cessing. Some observations are compatible with the secondalternative: (a) El and E3 expression was resistant to a highlevel of a-amanitin, whereas E2 expression was sensitive to alow a-amanitin concentration; (b) El, E2, and E3 RNAtranscripts elongated at both ends were not processed properlywhen injected into oocytes; (c) human snoRNA biosynthesiswas easier to detect at picogram levels of plasmid per oocytefor El and E3, and at nanogram levels of plasmid per oocytefor E2; and (d) El expression started within 4 hr of postin-jection oocyte incubation, whereas the onset of E2 expressionrequired 8-24 hr, in the absence of detectable El or E2 RNAprecursors, as would be expected if the slowest step wereassembly of the exogenous DNA into an active chromatinstructure rather than RNA processing.The E2-1 and E3-2 loci are apparently genes for the main E2

and E3 RNA species in HeLa cells. The El-7 locus appears tobe a gene for an El RNA sequence variant that is present inHeLa cells, because we isolated from HeLa cells a cDNAclone that lacks nucleotide U19, matching the El-7 sequence.We have isolated several different human genomic El loci, andnone of them has a T residue in position 19 of the codingregion. It is possible that the gene for the most abundant ElRNA species in HeLa cells has not been isolated yet. Alter-natively, this RNA might be generated by some form of RNAediting of the transcript from El-7. The short transcripts fromthese three snoRNA genes produced in frog oocytes haveessentially the same electrophoretic mobility as the snoRNAspecies isolated from HeLa cells. Basically two models arecompatible with these results. (i) When these human snoRNAgenes are injected into frog oocytes, the formation of 5' and 3'ends occurs at or near the nucleotide positions correspondingto the mature ends of these snoRNAs; (ii) 5' terminus forma-tion in transcripts of one of these genes takes place at anartifactual site in oocytes (e.g., 40 nt upstream of the normalsite) and 3' end formation occurs at another anomalous loca-tion (that in this example would need to be also about 40 nt 5'of the normal site). The first model appears to be far morelikely. In addition, Sl nuclease mapping showed that HeLacell E2 RNA and the human E2 transcript in frog oocytes have5' ends that appear to be identical by polyacrylamide gelelectrophoresis (data not shown). It may be difficult to do thisanalysis with human El and E3 transcripts in frog oocytes,since their levels are substantially lower than those of humanE2 transcripts. The length of the human El, E2, and E3primary transcripts in human cells and in plasmid-injected frogoocytes is unknown. There is no evidence that the largetranscripts bearing E3-like sequences that are synthesized inE3-2-injected frog oocytes (Fig. 4B) are E3 snoRNA precur-sors. We have not detected long El, E2, or E3 transcripts inHeLa cells.

Since the El and E3 genes appear to be located in intronsof pre-mRNA genes, it would seem unlikely that El and E3RNAs are synthesized by an RNA polymerase I-like activity(as suggested by the a-amanitin results in Fig. 5 A and B).However, (a) injection of a-amanitin into X. laevis oocyteshas identified correctly the RNA polymerases involved in thetranscription of all the vertebrate genes that have been testedthus far (1, 17-19); (b) the human El and E3 genes areexpressed very poorly in frog oocytes, and RNA polymeraseI transcription, unlike synthesis by RNA polymerases II andIII, shows high species specificity (8); and (c) detection ofhuman El and E3 RNA biosynthesis in frog oocytes is betterat picogram levels of DNA per oocyte, as reported for thetranscription of a gene for large rRNAs (20), whereas -10 ngof DNA per oocyte is needed for maximal synthesis of RNApolymerase II and III products (21). El, E2, andE3 RNAs arenot cleavage products of pre-rRNA, since their sequences, aswell as the sequences flanking their genes, are not present in

the human 13,348-nt, 47S rRNA precursor. None of theconsensus transcription elements functional in other genes(1-3, 8-10) are present in the coding regions or the 5' and 3'flanking regions of the El, E2, and E3 RNA genes. Wesearched for sequence homologies between clones El-7,E2-1, and E3-2 within 80 nt upstream and downstream fromthe 5' and 3' ends of their coding regions. There are noappreciable sequence homologies (pentamer or longer) lo-cated in identical or similar positions relative to the sites ofthe mature termini of these snoRNAs. Farther away fromthese sites are some sequences that may be possible candi-dates for functional motifs (summarized in Fig. 3A). In the 5'flanking region, they are (a) the sequence GTATTTT, 354 ntupstream of the coding region in clones El-7 and E3-2; (b)ATTTTYATAATTT, 393 and 410 nt 5' to the coding se-quence in El-7 and E3-2, respectively; (c) GCTGGCCC, 243and 248 nt upstream of the coding region in E3-2 and E2-1,respectively; and (d) TGTGGACA, 102 and 78 nt 5' to thecoding sequence of El-7 and E2-1, respectively. The se-quence TCAAGT begins 119 nt downstream of the sitecorresponding to the mature 3' end of the snoRNA, in bothclone El-7 and clone E3-2. The sequence CCACAA ispresent in positions 99-104 of El and E2 RNAs. The identicallocation in different genes of sequences GTATTTT andCCACAA with respect to the mature snoRNA 5' end, and ofTCAAGT relative to the mature snoRNA 3' terminus, iscompatible with their possible involvement in the formationof the corresponding snoRNA ends.We thank B. Sdraphin for telling us about the sequence homology

between E3 RNA and the translation initiation factor gene, D. D.Brown for the Xenopus 5S RNA maxigene plasmid, A. Grainger forcomputer searches, A. Harmon for assistance, C. Pollack for pho-tography, and L. Sheahan for typing the manuscript.1. Dahlberg, J. E. & Lund, E. (1988) in Structure and Function of

Major and Minor Small Nuclear Ribonucleoprotein Particles,ed. Birnstiel, M. L. (Springer, Heidelberg), pp. 38-70.

2. Hernandez, N. (1992) in Transcriptional Regulation, eds. Mc-Knight, S. L. & Yamamoto, K. R. (Cold Spring Harbor Lab.Press, Plainview, NY), pp. 281-313.

3. Kunkel, G. R. (1991) Biochim. Biophys. Acta 1088, 1-9.4. Fourier, M. J. & Maxwell, E. S. (1993) Trends Biochem. Sci.

18, 131-135.5. Ruff, E. A., Rimoldi, 0. J., Raghu, B. & Eliceiri, G. L. (1993)

Proc. Natl. Acad. Sci. USA 90, 635-638.6. Rimoldi, 0. J., Raghu, B., Nag, M. K. & Eliceiri, G. L. (1993)

Mol. Cell. Biol. 13, 4382-4390.7. Sakonju, S., Bogenhagen, D. & Brown, D. D. (1980) Cell 19,

13-25.8. Sollner-Webb, B. & Tower, J. (1986) Annu. Rev. Biochem. 55,

801-830.9. Geiduschek, E. P. & Tocchini-Valentini, G. P. (1988) Annu.

Rev. Biochem. 57, 873-914.10. Reeder, R. H. (1992) in Transcriptional Regulation, eds. Mc-

Knight, S. L. & Yamamoto, K. R. (Cold Spring Harbor Lab.Press, Plainview, NY), pp. 315-347.

11. Furuno, N., Nakagawa, K., Eguchi, U., Ohtubo, M., Nishi-moto, T. & Soeda, E. (1991) Genomics 11, 459-461.

12. Nishimoto, T., Uzawa, S. & Schlegel, R. (1992) Curr. Opin.Cell Biol. 4, 174-179.

13. Roberge, M. (1992) Trends Cell Biol. 2, 277-281.14. Dasso, M. (1993) Trends Biochem. Sci. 18, 96-101.15. Sdraphin, B. (1993) Trends Biochem. Sci., in press.16. Leverette, R. D., Andrews, M. T. & Maxwell, E. S. (1992) Cell

71, 1215-1221.17. Murphy, J. T., Burgess, R. R., Dahlberg, J. E. & Lund, E.

(1982) Cell 29, 265-274.18. Mattaj, I. W. & Zeller, R. (1983) EMBO J. 2, 1883-1891.19. Kazmaier, M., Tebb, G. & Mattaj, I. W. (1987) EMBO J. 6,

3071-3078.20. Moss, T. (1982) Cell 30, 835-842.21. Gurdon, J. B. & Melton, D. A. (1981) Annu. Rev. Genet. 15,

189-218.

Biochemistry: Nag et al.