Table S1. Co-expression analysis (http://cressexpress.org/) of suberin genes. Characterized suberin genes were used as the bait set. FACT showed high correlation with all characterized suberin genes. The recently characterized FAR genes, shown to be involved in suberin synthesis (Domergue et al., 2010), also showed high correlation with previously-characterized suberin genes and with FACT. DCF, a BAHD involved in cutin synthesis (Rautengarten et al., 2012) showed low correlation with known suberin genes.

Bait Genes GPAT5 (AT3G11430)

FACT (AT5G63560)

ASFT (AT5G41040)

CYP86A1 (AT5G58860)

CYP86B1 (AT5G23190)

r2 r2 r2 r2 r2

FACT( AT5G63560) 0.63 1.00 0.68 0.89 0.75 FAR1 (AT5G22500) 0.14 0.12 0.17 0.11 0.14 FAR4 (AT3G44540) 0.69 0.89 0.73 0.88 0.77 FAR5 (AT3G44550) 0.64 0.70 0.60 0.75 0.64 DCF (AT3G48720) 0.12 0.07 0.06 0.06 0.08

Table S2. Primers used for mutant isolation, RT-PCR, and PAt5g63560::eYFP plasmid. Primer Sequence FACT F1 TCCTGAAACAAAAATCTGTGGA FACT_R1 TGAAACCAATATCGGACCAAATCC Spm32_R TACGAATAAGAGCGTCCATTTTAGAGTGA FACT_F2 GGAGACTCACGATCAGTCCTG FACT_R2 CATTTCAACGGCTCTTTTGAC L4 TGATCCATGTAGATTTCCCGGACATGAAG FACT_RT_F GTTCTCGTCTCTCCAGCCTCCG FACT_RT_R1 TGTCACCTGAACAACCACTGGAGG FACT_RT_R2 GTGCCGGAGATGTCTTCGAGGTC ELF4A_RT_F CCAGAAGGCACACAGTTTGATGCA ELF4A_RT_R TCATCATCACGGGTCACGAAATTG FACTpro_SalI_F CACACGTCGACAGGTTAAGAGTTTCGTTTTCCTTC FACTpro_BamHI_R CACACGGATCCTTTTAGGGGTTTTGTCAGTGAAG FACTpro_HindIII_F CACACAAGCTTAGGTTAAGAGTTTCGTTTTCCTTC pAN59_eYFP_SacI_R CACACGAGCTCTTACTTGTACAGCTCGTCCATG

Table S3. Comparison of phenylpropanoid methyl ester percent recoveries in base versus acid catalyzed transmethylation reactions. Values are presented as a percentage of the peak area of neat standards from four determinations. Methyl heptadecanoate = 17:0

4-methoxy Cinnamate Coumarate Ferulate Caffeate 17:0 Sinapate

4.5 % NaOMe / MeOH 44 52 51 0 65 44 5% H2SO4 / MeOH 86 92 90 77 97 75

1N MeOH-HCl 108 104 105 88 106 85

Table S4. Effect of aqueous NaCl washing steps on phenylpropanoid methyl ester recovery from dichloromethane organic phases of different acid-catalyzed transmethylation procedures. Values are presented as a percentage of the peak area of neat standards from four determinations. Methyl heptadecanoate = 17:0

5% H2SO4/MeOH % Recovery in Organic Phase 0 washes 1 wash 2 washes 3 washes

4-methoxy Cinnamate 99 100 93 60 Coumarate 103 97 87 103

Ferulate 105 100 90 75 Caffeate 94 58 39 29

17:0 99 98 91 102 Sinapate 71 79 79 79

1N MeoH-HCl % Recovery in Organic Phase 0 washes 1 wash 2 washes 3 washes

4-methoxy cinnamate 108 106 114 89 Coumarate 104 102 106 82

Ferulate 105 104 109 86 Caffeate 88 67 51 26

17:0 106 104 108 87 Sinapate 85 95 96 79

Figure S1. Comparison of Arabidopsis (Col-0) root wax alkyl hydroxycinnamate composition from Li et al. (2007), Molina et al. (2009), and this study (from Figs. 1, 3, and 8). Data are presented as mean mole % of total root wax extracts (fatty acids and alcohols, alkanes, sterols, monoacylglycerols and alkyl hydroxycinnamates) for 3-4 replicates + SD.

Figure S2. Chromatogram (A) and EI mass spectrum (B) from GC-MS analysis of purified tridecyl ferulate standard. Molecular structure and diagnostic ions are indicated above the mass spectrum.

A

B

Figure S3. Chromatogram (A) and EI mass spectrum (B) from GC-MS analysis of purified heptadecyl coumarate standard. Molecular structure and diagnostic ions are indicated above the mass spectrum.

A

B

Figure S4. RT-PCR analysis of At5g63560 transcript from 3-week-old roots of Columbia-0 and fact mutant plants. The fact-1 allele displayed no transcript when either exon-spanning or 1st-exon-specific primers were used. The fact-2 allele showed reduced transcript with exon-spanning primers and elevated transcript abundance when 1st-exon-specific primers were used; as such, fact-2 appears to knocked-down for the entire FACT transcript and expressing a truncated transcript. The elF4A1 gene was used as a loading/internal control.

Figure S5. Lignin content and composition of fact-1 versus WT (A) roots and (B) seeds. Inset graphs show percent Acetyl Bromide-Soluble Lignin (%ABSL). Roots from 7-week-old plants were used. Data are presented as the mean of (A) 4 biological replicates or (B) quadruplicate determinations + SD.

Figure S6. fact-1 seeds are unaffected in their surface wax composition. Surface waxes were extracted by a 30 s submersion in chloroform. Waxes were analyzed as their TMSi derivatives by GC-MS. Data are presented as the mean of quadruplicate determinations ± SD.

Figure S7. Effect of alkan-1-ol carbon chain length on (A) FACT and (B) ASFT activity, and (C) of CHAPS detergent on ASFT activity. Caffeic acid was used with FACT (A) and ferulic acid with ASFT (B,C). Coupled cell-free assays were performed using different acyl-CoA donors. Recombinant 4-COUMARATE LIGASE (4CL) was used to generate corresponding CoAs of different phenylpropanoids (i.e. ferulate or coumarate) in vitro via a pre-incubation step. FACT/ASFT activity was measured in a second step by the addition of total protein extracts from BL21 E. Coli expressing recombinant BAHD enzyme. Data represent the means of quadruplicate assays + SD. No alkyl hydroxycinnamate products were detected in reactions using total protein extracts from wild-type (non-transgenic) BL21 cells. CHAPS detergent has a nominal critical micelle concentration of 0.49% (w/v), but shows little effect on ASFT activity above or below this value.

Figure S8. Root wax composition of 200 mM NaCl-treated Col-0 and fact mutant plants. Entire roots were extracted by rapid submersion in chloroform (1.5 min). Data are presented as the means from four biological replicates + SD. FFAs = free fatty acids, MAGs = mono-acylglycerides, Alkn = alkane.

SUPPLEMENTAL MATERIALS AND METHODS

Synthesis of Phenylpropanoid Methyl Ester Standards 4-Methyoxycinnamate, coumarate, caffeate, ferulate and sinapate methyl esters were

prepared from their free acids (Sigma-Aldrich) via acid-catalyzed transmethylation with 5%

H2SO4 in methanol. Briefly, ~1 g of each phenylpropanoic acid was heated in 30 mL of 5%

H2SO4/MeOH with 15 mL of toluene and a few crystals of butylated hydroxytoluene (BHT)

overnight (~16 h) under N2. Reactions were allowed to cool to room temperature and transferred

to separatory funnels. 15 mL 0.9% (w/v) aqueous NaCl and 35 ml CH2Cl2 were added to affect

phase partitioning. Organic phases were removed. Aqueous phases were back extracted with

35 mL of CH2Cl2. Organic phases were pooled and evaporated under N2, recovered as

crystalline solids, desiccated for 2 days, and dry weights collected. Yields were typically > 90%

with the exception of methyl caffeate (67%). Purities as determined by GC-MS of silylated

products were > 95%.

Phenylpropanoid Methyl Ester Standard Recoveries in Base versus Acid Catalyzed Transmethylation

Acid-catalyzed transmethylation conditions are described in the materials and methods

of the main text.

Base catalyzed transmethylation reactions (NaOMe/MeOH) consisted of: 4.5% sodium

methoxide (NaOMe) and 7.5% methyl acetate in methanol in a total volume of 6 mL. Reaction

mixtures were heated overnight (~16 h) at 60ºC then allowed to cool to room temperature.

Reaction mixtures were acidified with glacial acetic acid to pH 4–5, 2-3 mL saline solution added

(0.5 M NaCl), and products extracted with 7 mL dichloromethane. The organic phase was

washed twice with dilute saline solution (0.9% NaCl, w/v) and dried over anhydrous sodium

sulfate. Extracts were evaporated to dryness under nitrogen gas and the product silylated to

convert hydroxyl groups to their TMSi ethers. Changing the saline solution used to affect phase

partitioning to 0.5 M sodium sulfate (aq.), excluding saline washes of the organic phase, and

back extraction of the aqueous phase did not improve methyl caffeate recovery under base-

catalyzed conditions.

Lignin Analysis Ground delipidated samples were further ground into a fine powder with a ball mill and

treated with solvents to remove pigments, proteins, lipids, and DNA from the material to create

the alcohol insoluble residue (AIR) (York et al., 1986). The starch was removed from the residue

with an amylase treatment, resulting in only cell wall material.

For acetyl-bromide soluble lignin content, the biomass was treated with an acetyl

bromide mixture to render the lignin acetic acid soluble. The reaction products were

quantitatively transferred to 2.0 mL volumetric flasks then volumetrically diluted with glacial

acetic acid and assayed using a UV spectrometer. Results are reported as percent acetyl

bromide soluble lignin based on the dry weight of the AIR material (Fukushima et al., 1991).

The AIR material was weighed into glass screw-cap tubes for the thioacidolysis reaction.

The biomass was treated with a solution of dioxane, boron trifluoride diethyl etherate, and

ethanethiol to extract the lignin monomers. The material was extracted with ethyl acetate and

water then TMS derivatized for GC-MS analysis. Bisphenol E was used as an internal standard

for quantification.

Literature Cited

Li Y, Beisson F, Ohlrogge J, Pollard M (2007) Monoacylglycerols are components of root waxes and can be produced in the aerial cuticle by ectopic expression of a suberin-associated acyltransferase. Plant Physiology 144: 1267-1277

Molina I, Li-Beisson Y, Beisson F, Ohlrogge JB, Pollard M (2009) Identification of an arabidopsis

feruloyl-coenzyme a transferase required for suberin synthesis. Plant Physiol 151: 1317-1328 Domergue F, Vishwanath SJ, Joubès J, Ono J, Lee JA, Bourdon M, Alhattab R, Lowe C, Pascal S,

Lessire R, Rowland O (2010) Three Arabidopsis Fatty Acyl-Coenzyme A Reductases, FAR1, FAR4, and FAR5, Generate Primary Fatty Alcohols Associated with Suberin Deposition. Plant Physiology 153: 1539-1554

Fukushima RS, Dehority BA, Loerch SC (1991) Modification of a colorimetric analysis for lignin and its use in studying the inhibitory effects of lignin on forage digestion by ruminal microorganisms. Journal of Animal Science 69: 295-304

Rautengarten C, Ebert B, Ouellet M, Nafisi M, Baidoo EEK, Benke P, Stranne M, Mukhopadhyay A, Keasling JD, Sakuragi Y, Scheller HV (2012) Arabidopsis Deficient in Cutin Ferulate encodes a transferase required for feruloylation of w-hydroxy fatty acids in cutin polyester. Plant Physiology 158: 654-665

York WS, Darvill AG, McNeil M, Stevenson TT, Albersheim P (1986) Isolation and characterization of plant cell walls and cell wall components. In HW Arthur Weissbach, ed, Methods in Enzymology, Vol Volume 118. Academic Press, pp 3-40