exploring protein sequences

27
Exploring Protein Sequences Tutorial 5

Upload: palma

Post on 03-Feb-2016

39 views

Category:

Documents


0 download

DESCRIPTION

Tutorial 5. Exploring Protein Sequences. Exploring Protein Sequences. Multiple alignment ClustalW Motif discovery MEME Jaspar. A. C. D. B. Multiple Sequence Alignment. More than two sequences DNA Protein Evolutionary relation Homology  Phylogenetic tree Detect motif. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: Exploring Protein Sequences

Exploring Protein Sequences

Tutorial 5

Page 2: Exploring Protein Sequences

Exploring Protein Sequences

• Multiple alignment– ClustalW

• Motif discovery– MEME– Jaspar

Page 3: Exploring Protein Sequences

• More than two sequences– DNA– Protein

• Evolutionary relation– Homology Phylogenetic tree– Detect motif

Multiple Sequence Alignment

GTCGTAGTCG-GC-TCGACGTC-TAG-CGAGCGT-GATGC-GAAG-AG-GCG-AG-CGCCGTCG-CG-TCGTA-AC

A

D B

CGTCGTAGTCGGCTCGACGTCTAGCGAGCGTGATGCGAAGAGGCGAGCGCCGTCGCGTCGTAAC

Page 4: Exploring Protein Sequences

• Dynamic Programming– Optimal alignment– Exponential in #Sequences

• Progressive– Efficient– Heuristic

Multiple Sequence Alignment

GTCGTAGTCG-GC-TCGACGTC-TAG-CGAGCGT-GATGC-GAAG-AG-GCG-AG-CGCCGTCG-CG-TCGTA-AC

A

D B

CGTCGTAGTCGGCTCGACGTCTAGCGAGCGTGATGCGAAGAGGCGAGCGCCGTCGCGTCGTAAC

Page 5: Exploring Protein Sequences

ClustalW

“CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice”, J D Thompson et al

Page 6: Exploring Protein Sequences

• Progressive– At each step align two existing alignments or sequences

– Gaps present in older alignments remain fixed

ClustalW

GTCGTAGTCG-GC-TGTC-TAG-CGAGCGTGC-GAAG-AG-GCG-GCCGTCG-CG-TCGT

GTCGTAGTCGGCTCGACGTCTAGCGAGCGTGATGCGAAGAGGCGAGCGCCGTCGCGTCGTAAC

Page 7: Exploring Protein Sequences

ClustalW - InputScoring matrix

Gap scoring

Input sequences

Page 8: Exploring Protein Sequences

ClustalW - Output

Page 9: Exploring Protein Sequences

ClustalW - Output

Input sequences

Pairwise alignment scores

Building alignment

Final score

Page 10: Exploring Protein Sequences

ClustalW - Output

Page 11: Exploring Protein Sequences

ClustalW Output

Sequence names Sequence positions

Match strength in decreasing order: * : .

Page 12: Exploring Protein Sequences

http://http://www.megasoftware.net/

Page 13: Exploring Protein Sequences

Can we find motifs using multiple sequence alignment?

1 2 3 4 5 6 7 8 9 10

A 0 0 0 0 0 0.5 1/6 1/3 0 0

D 0 0.5 1/3 0 0 1/6 5/6 1/6 0 1/6

E 0 0 2/3 1 0 0 0 0 1 5/6

G 0 1/6 0 0 1 1/3 0 0 0 0

H 0 1/6 0 0 0 0 0 0 0 0

N 0 1/6 0 0 0 0 0 0 0 0

Y 1 0 0 0 0 0 0.5 0.5 0 0

1 3 5 7 9..YDEEGGDAEE....YDEEGGDAEE....YGEEGADYED....YDEEGADYEE....YNDEGDDYEE....YHDEGAADEE.. * :** *:

MotifA widespread pattern with a biological significance

Page 14: Exploring Protein Sequences

Can we find motifs using multiple sequence alignment?

YES! NO

Page 15: Exploring Protein Sequences

MEME – Multiple EM for Motif finding

• http://meme.sdsc.edu/• Motif discovery from unaligned sequences

– Genomic or protein sequences• Flexible model of motif presence (Motif can be absent in some sequences or appear several times in one sequence)

Page 16: Exploring Protein Sequences

MEME - InputEmail address

Multiple input sequences

How many times in each sequence?

How many motifs?

How many sites?

Range of motif lengths

Page 17: Exploring Protein Sequences

MEME - OutputMotif length

Number of times

Like BLAST

Page 18: Exploring Protein Sequences

MEME - Output

Probability * 10

‘a’=10, ‘:’=0

Page 19: Exploring Protein Sequences

MEME - Output

Low uncertainty

=

High information content

Page 20: Exploring Protein Sequences

MEME - Output

Multilevel Consensus

Page 21: Exploring Protein Sequences

Sequence names

Reverse complement (genomic input only)

Position in

sequence

Strength of match

Motif within sequence

MEME - Output

Page 22: Exploring Protein Sequences

Overall strength of motif matches

sequence lengths

Motif instance

MEME - Output

‘-’=Other strand

Page 23: Exploring Protein Sequences

MAST• Searches for motifs (one or more) in sequence databases:– Like BLAST but motifs for input– Similar to iterations of PSI-BLAST

• Profile defines strength of match– Multiple motif matches per sequence– Combined E value for all motifs

• MEME uses MAST to summarize results: – Each MEME result is accompanied by the MAST result for searching the discovered motifs on the given sequences.

Page 24: Exploring Protein Sequences

JASPAR• Profiles

– Transcription factor binding sites– Multicellular eukaryotes– Derived from published collections of

experiments

• Open data accesss

Page 25: Exploring Protein Sequences

JASPAR• profiles

– Modeled as matrices.– can be converted into PSSM for scanning

genomic sequences.

1 2 3 4 5 6 7 8 9 10

A 0 0 0 0 0 0.5 1/6 1/3 0 0

D 0 0.5 1/3 0 0 1/6 5/6 1/6 0 1/6

E 0 0 2/3 1 0 0 0 0 1 5/6

G 0 1/6 0 0 1 1/3 0 0 0 0

H 0 1/6 0 0 0 0 0 0 0 0

N 0 1/6 0 0 0 0 0 0 0 0

Y 1 0 0 0 0 0 0.5 0.5 0 0

Page 26: Exploring Protein Sequences

Search profile

http://jaspar.cgb.ki.se/

Page 27: Exploring Protein Sequences

http://jaspar.cgb.ki.se/