Download - Exploring Protein Sequences
![Page 1: Exploring Protein Sequences](https://reader035.vdocuments.us/reader035/viewer/2022081520/568159a6550346895dc70a3a/html5/thumbnails/1.jpg)
Exploring Protein Sequences
Tutorial 5
![Page 2: Exploring Protein Sequences](https://reader035.vdocuments.us/reader035/viewer/2022081520/568159a6550346895dc70a3a/html5/thumbnails/2.jpg)
Exploring Protein Sequences
• Multiple alignment– ClustalW
• Motif discovery– MEME– Jaspar
![Page 3: Exploring Protein Sequences](https://reader035.vdocuments.us/reader035/viewer/2022081520/568159a6550346895dc70a3a/html5/thumbnails/3.jpg)
• More than two sequences– DNA– Protein
• Evolutionary relation– Homology Phylogenetic tree– Detect motif
Multiple Sequence Alignment
GTCGTAGTCG-GC-TCGACGTC-TAG-CGAGCGT-GATGC-GAAG-AG-GCG-AG-CGCCGTCG-CG-TCGTA-AC
A
D B
CGTCGTAGTCGGCTCGACGTCTAGCGAGCGTGATGCGAAGAGGCGAGCGCCGTCGCGTCGTAAC
![Page 4: Exploring Protein Sequences](https://reader035.vdocuments.us/reader035/viewer/2022081520/568159a6550346895dc70a3a/html5/thumbnails/4.jpg)
• Dynamic Programming– Optimal alignment– Exponential in #Sequences
• Progressive– Efficient– Heuristic
Multiple Sequence Alignment
GTCGTAGTCG-GC-TCGACGTC-TAG-CGAGCGT-GATGC-GAAG-AG-GCG-AG-CGCCGTCG-CG-TCGTA-AC
A
D B
CGTCGTAGTCGGCTCGACGTCTAGCGAGCGTGATGCGAAGAGGCGAGCGCCGTCGCGTCGTAAC
![Page 5: Exploring Protein Sequences](https://reader035.vdocuments.us/reader035/viewer/2022081520/568159a6550346895dc70a3a/html5/thumbnails/5.jpg)
ClustalW
“CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice”, J D Thompson et al
![Page 6: Exploring Protein Sequences](https://reader035.vdocuments.us/reader035/viewer/2022081520/568159a6550346895dc70a3a/html5/thumbnails/6.jpg)
• Progressive– At each step align two existing alignments or sequences
– Gaps present in older alignments remain fixed
ClustalW
GTCGTAGTCG-GC-TGTC-TAG-CGAGCGTGC-GAAG-AG-GCG-GCCGTCG-CG-TCGT
GTCGTAGTCGGCTCGACGTCTAGCGAGCGTGATGCGAAGAGGCGAGCGCCGTCGCGTCGTAAC
![Page 7: Exploring Protein Sequences](https://reader035.vdocuments.us/reader035/viewer/2022081520/568159a6550346895dc70a3a/html5/thumbnails/7.jpg)
ClustalW - InputScoring matrix
Gap scoring
Input sequences
![Page 8: Exploring Protein Sequences](https://reader035.vdocuments.us/reader035/viewer/2022081520/568159a6550346895dc70a3a/html5/thumbnails/8.jpg)
ClustalW - Output
![Page 9: Exploring Protein Sequences](https://reader035.vdocuments.us/reader035/viewer/2022081520/568159a6550346895dc70a3a/html5/thumbnails/9.jpg)
ClustalW - Output
Input sequences
Pairwise alignment scores
Building alignment
Final score
![Page 10: Exploring Protein Sequences](https://reader035.vdocuments.us/reader035/viewer/2022081520/568159a6550346895dc70a3a/html5/thumbnails/10.jpg)
ClustalW - Output
![Page 11: Exploring Protein Sequences](https://reader035.vdocuments.us/reader035/viewer/2022081520/568159a6550346895dc70a3a/html5/thumbnails/11.jpg)
ClustalW Output
Sequence names Sequence positions
Match strength in decreasing order: * : .
![Page 12: Exploring Protein Sequences](https://reader035.vdocuments.us/reader035/viewer/2022081520/568159a6550346895dc70a3a/html5/thumbnails/12.jpg)
http://http://www.megasoftware.net/
![Page 13: Exploring Protein Sequences](https://reader035.vdocuments.us/reader035/viewer/2022081520/568159a6550346895dc70a3a/html5/thumbnails/13.jpg)
Can we find motifs using multiple sequence alignment?
1 2 3 4 5 6 7 8 9 10
A 0 0 0 0 0 0.5 1/6 1/3 0 0
D 0 0.5 1/3 0 0 1/6 5/6 1/6 0 1/6
E 0 0 2/3 1 0 0 0 0 1 5/6
G 0 1/6 0 0 1 1/3 0 0 0 0
H 0 1/6 0 0 0 0 0 0 0 0
N 0 1/6 0 0 0 0 0 0 0 0
Y 1 0 0 0 0 0 0.5 0.5 0 0
1 3 5 7 9..YDEEGGDAEE....YDEEGGDAEE....YGEEGADYED....YDEEGADYEE....YNDEGDDYEE....YHDEGAADEE.. * :** *:
MotifA widespread pattern with a biological significance
![Page 14: Exploring Protein Sequences](https://reader035.vdocuments.us/reader035/viewer/2022081520/568159a6550346895dc70a3a/html5/thumbnails/14.jpg)
Can we find motifs using multiple sequence alignment?
YES! NO
![Page 15: Exploring Protein Sequences](https://reader035.vdocuments.us/reader035/viewer/2022081520/568159a6550346895dc70a3a/html5/thumbnails/15.jpg)
MEME – Multiple EM for Motif finding
• http://meme.sdsc.edu/• Motif discovery from unaligned sequences
– Genomic or protein sequences• Flexible model of motif presence (Motif can be absent in some sequences or appear several times in one sequence)
![Page 16: Exploring Protein Sequences](https://reader035.vdocuments.us/reader035/viewer/2022081520/568159a6550346895dc70a3a/html5/thumbnails/16.jpg)
MEME - InputEmail address
Multiple input sequences
How many times in each sequence?
How many motifs?
How many sites?
Range of motif lengths
![Page 17: Exploring Protein Sequences](https://reader035.vdocuments.us/reader035/viewer/2022081520/568159a6550346895dc70a3a/html5/thumbnails/17.jpg)
MEME - OutputMotif length
Number of times
Like BLAST
![Page 18: Exploring Protein Sequences](https://reader035.vdocuments.us/reader035/viewer/2022081520/568159a6550346895dc70a3a/html5/thumbnails/18.jpg)
MEME - Output
Probability * 10
‘a’=10, ‘:’=0
![Page 19: Exploring Protein Sequences](https://reader035.vdocuments.us/reader035/viewer/2022081520/568159a6550346895dc70a3a/html5/thumbnails/19.jpg)
MEME - Output
Low uncertainty
=
High information content
![Page 20: Exploring Protein Sequences](https://reader035.vdocuments.us/reader035/viewer/2022081520/568159a6550346895dc70a3a/html5/thumbnails/20.jpg)
MEME - Output
Multilevel Consensus
![Page 21: Exploring Protein Sequences](https://reader035.vdocuments.us/reader035/viewer/2022081520/568159a6550346895dc70a3a/html5/thumbnails/21.jpg)
Sequence names
Reverse complement (genomic input only)
Position in
sequence
Strength of match
Motif within sequence
MEME - Output
![Page 22: Exploring Protein Sequences](https://reader035.vdocuments.us/reader035/viewer/2022081520/568159a6550346895dc70a3a/html5/thumbnails/22.jpg)
Overall strength of motif matches
sequence lengths
Motif instance
MEME - Output
‘-’=Other strand
![Page 23: Exploring Protein Sequences](https://reader035.vdocuments.us/reader035/viewer/2022081520/568159a6550346895dc70a3a/html5/thumbnails/23.jpg)
MAST• Searches for motifs (one or more) in sequence databases:– Like BLAST but motifs for input– Similar to iterations of PSI-BLAST
• Profile defines strength of match– Multiple motif matches per sequence– Combined E value for all motifs
• MEME uses MAST to summarize results: – Each MEME result is accompanied by the MAST result for searching the discovered motifs on the given sequences.
![Page 24: Exploring Protein Sequences](https://reader035.vdocuments.us/reader035/viewer/2022081520/568159a6550346895dc70a3a/html5/thumbnails/24.jpg)
JASPAR• Profiles
– Transcription factor binding sites– Multicellular eukaryotes– Derived from published collections of
experiments
• Open data accesss
![Page 25: Exploring Protein Sequences](https://reader035.vdocuments.us/reader035/viewer/2022081520/568159a6550346895dc70a3a/html5/thumbnails/25.jpg)
JASPAR• profiles
– Modeled as matrices.– can be converted into PSSM for scanning
genomic sequences.
1 2 3 4 5 6 7 8 9 10
A 0 0 0 0 0 0.5 1/6 1/3 0 0
D 0 0.5 1/3 0 0 1/6 5/6 1/6 0 1/6
E 0 0 2/3 1 0 0 0 0 1 5/6
G 0 1/6 0 0 1 1/3 0 0 0 0
H 0 1/6 0 0 0 0 0 0 0 0
N 0 1/6 0 0 0 0 0 0 0 0
Y 1 0 0 0 0 0 0.5 0.5 0 0
![Page 26: Exploring Protein Sequences](https://reader035.vdocuments.us/reader035/viewer/2022081520/568159a6550346895dc70a3a/html5/thumbnails/26.jpg)
Search profile
http://jaspar.cgb.ki.se/
![Page 27: Exploring Protein Sequences](https://reader035.vdocuments.us/reader035/viewer/2022081520/568159a6550346895dc70a3a/html5/thumbnails/27.jpg)
http://jaspar.cgb.ki.se/