1

EXAMINATION OF A SECOND NODE OF TRANSLATIONAL CONTROL IN THE

UNFOLDED PROTEIN RESPONSE

Amanda M. Preston1,# and Linda M. Hendershot1

1Department of Genetics & Tumor Cell Biology, St. Jude Children’s Research Hospital,

Memphis, TN 38105 1

Current Address: #Neuroscience Institute, University of Tennessee Health Science Center, 875

Monroe Ave, Suite 426, Memphis, TN 38163

Correspondence to: Linda M. Hendershot, 262 Danny Thomas Place, Memphis, TN 38105, Ph:

(901) 595-2475, Fax: (901) 595-2381, linda.hendershot@stjude.org

Running title: 4E-BP1 and translation control in the UPR

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

JCS Advance Online Article. Posted on 10 July 2013

2

SUMMARY

The unfolded protein response (UPR) is a largely cytoprotective signaling cascade that acts

to re-establish homeostasis of the endoplasmic reticulum (ER) under conditions of stress by

inducing an early and transient block in general protein synthesis and by increasing the

folding and degradative capacity of the cell through an extensive transcriptional program.

It is well-established that the mechanism for the early translational attenuation during ER

stress occurs through phosphorylation of eukaryotic initiation factor 2 α (eIF2α) by

activated PERK. Our data demonstrate that when eIF2α is dephosphorylated translation is

not fully restored to pre-stressed levels. We find that this correlates with reduced mTOR

activity and as a result decreased phosphorylation of 4E-BP1, which negatively regulates

assembly of the eIF4F complex and cap-dependent translation. The decrease in mTOR/4E-

BP1 phosphorylation is associated with activation of AMP kinase, a negative regulator of

mTOR, and in the case of some stress conditions, down-regulation of signaling through key

components of the PI3K pathway. Furthermore, we show that there is a subset of mRNAs

that do not recover from UPR-induced translational repression, which include those whose

translation is particularly sensitive to loss of eIF4F, such as cyclin D1, Bcl-2 and MMP9.

Together these data implicate mTOR/4E-BP1 hypophosphorylation as a second, more

restricted mechanism of translational control occurring somewhat later in the UPR.

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

3

INTRODUCTION

The majority of all secreted and membrane-bound proteins of higher eukaryotic cells are co-

translationally translocated into the ER lumen, where they are acquire their native conformation

with assistance from ER-resident folding factors, chaperones and enzymes. Unfavorable

conditions (sub-optimal pH, low ATP levels, and hypoxia), high client protein load, or

expression of mutant proteins can perturb ER function and result in the accumulation of unfolded

proteins in the ER lumen. In response to this stress, the unfolded protein response (UPR) is

triggered; a largely cytoprotective signaling pathway that attempts to ease the effects of ER stress

and restore homeostasis to this organelle through both transcriptional and translational programs

(Ron and Walter, 2007). If these protective measures are unsuccessful, apoptotic pathways are

activated to destroy the compromised cells.

The UPR transcriptional program serves in part to up-regulate resident molecular chaperones

and folding enzymes, thereby preventing the aggregation of unfolded proteins and bolstering ER

folding capacity, while the translational program acts to ease the load of new client proteins

entering the organelle by transiently inhibiting protein synthesis. Of note, the decrease in protein

synthesis is not restricted to ER proteins. The loss of cytosolically-translated cell cycle proteins

causes cells to arrest in the G1 phase of cell cycle, ensuring that cells experiencing ER stress are

not replicated (Brewer et al., 1999). The UPR is signaled through three, ER-localized

transmembrane proteins, inositol-requiring enzyme 1 (IRE-1), activating transcription factor 6

(ATF6), and protein kinase RNA (PKR)-like ER kinase (PERK), which collectively monitor

folding conditions in the ER through their luminally oriented domains and signal the downstream

response through their cytosolic domains (reviewed in (Walter and Ron, 2011)). While the

cellular outcomes of ATF6 and IRE1 activation are largely transcriptional, the PERK arm of the

UPR primarily exerts it effects through transient alterations in translation. In response to ER

stress, PERK dimerizes, leading to trans-autophosphorylation (Liu et al., 2000) and

phosphorylation of the α subunit of eukaryotic initiation factor 2 α (eIF2α) at ser51 (Harding et

al., 1999), resulting in a reduction in global protein translation.

However, certain mRNAs, such as ATF4, are preferentially translated under these conditions

by virtue of the structure of their 5’ regions, which contain multiple small interfering ORFs that

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

4

inhibit its translation under non-stress conditions (Harding et al., 2000a). The ATF4

transcriptional target GADD34 together with protein phosphatase 1 (PP1) acts to de-

phosphorylate eIF2α, providing an elegant negative feedback loop and allowing general

translation to resume (Novoa et al., 2001),(Ma and Hendershot, 2003). The beneficial aspects of

this PERK-mediated translational block are demonstrated by studies showing that cultured cells

(Harding et al., 2000b) and endocrine and exocrine pancreas cells (Harding et al., 2001) lacking

PERK are less likely to survive when subjected to ER stress. However, global translation must

resume so that proteins essential for survival and cellular maintenance can be restored and that

mRNAs up-regulated as part of the transcriptional UPR response can be translated. Indeed, cells

expressing a mutant GADD34 that lacks eIF2α phosphatase activity are unable to restore

translation after PERK activation and exhibit decreased viability when compared to control cells

in response to ER stress (Novoa et al., 2003). Thus, accrued experimental evidence suggests that

translation must be balanced carefully to maximize cell viability under ER stress conditions

(Walter and Ron, 2011).

Recent studies have focused on another translational control axis centered on mTOR. 4E-

BP1, a target of mTOR and negative regulator of eIF4F, was found to be a target of the UPR-

induced transcription factor ATF4 (Yamaguchi et al., 2008), and several other studies provide

evidence that ER stress can impact various elements of the mTOR pathway (Ozcan et al., 2004),

(Salazar et al., 2009), (Di et al., 2009), (Qin et al., 2010), and that alterations in the mTOR

pathway can induce ER stress (Ozcan et al., 2008), (Qin et al., 2010) suggesting that translational

control in the UPR is more complicated than previously indicated.

Regulation of the eIF4F complex formation by the 4E-BPs plays a major role in reducing

protein synthesis under conditions of reduced growth factor signaling, nutrient availability, and

ATP levels; largely via decreased signaling through the PI3K and mTOR pathways (Hay and

Sonenberg, 2004). 4E-BP1 is a direct target of mTOR (Hay and Sonenberg, 2004), (Proud,

2004), and as a result decreases in mTOR signaling lead to the accumulation of

hypophosphophorylated 4E-BP1, which in turns results in decreased formation of the eIF4F

complex and reduced cap-dependent translation. While eIF4F is important for the translation of

all cap-dependent translation, a subset of mRNAs have been identified whose translation is

particularly affected by a reduction in eIF4F complex formation (Hay and Sonenberg, 2004). The

characteristics that cause the translation of these various mRNAs to be particularly dependent on

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

5

eIF4F is not fully understood, but include the presence of long, highly structured 5’ untranslated

regions (Pelletier and Sonenberg, 1985), (Gingras et al., 1999), a terminal oligopyramidine tract

immediately adjacent to the 5’ cap (Hsieh et al., 2012), (Thoreen et al., 2012), or a regulatory

element in the 3’UTR that marks certain mRNAs for eIF4E facilitated nuclear export (Culjkovic

et al., 2006). Of note, cyclin D1 transcripts are highly structured and are known to be dependent

on mTOR signaling (De and Graff, 2004). Thus, we designed experiments to more carefully

examine translational control during an ER stress response and determine how reduced signaling

through the mTOR pathway contributes to this.

RESULTS

ER stress induces an early and transient decrease in global translation that is associated with

eIF2α phosphorylation, however not all proteins recover equally. It is well-established that ER

stress-induced phosphorylation of eIF2α results in a decrease in global protein translation, and

that this block is subsequently relieved by the dephosphorylation of eIF2α by the ATF4

transcriptional target, GADD34 (Novoa et al., 2001), (Ma and Hendershot, 2003). To further

investigate ER stress-induced translational changes associated with the UPR, NIH3T3 cells were

pre-treated with the ER stress inducing drug thapsigargin, which inhibits SERCA pumps in the

ER membrane, rapidly depleting its calcium stores and broadly affecting protein folding in this

organelle. At the indicated times after thapsigargin treatment, cells were pulse-labeled with 35S

methionine and cysteine for a short period of time to monitor translation. Cell lysates were

directly examined on SDS-polyacrylamide gels, and as expected the decrease in protein synthesis

at early time points appeared to be global (Fig. 1A). Similar results were obtained with

tunicamycin, although the kinetics of translation inhibition was slower and the magnitude was

not as great (data not shown). With both stresses, the inhibition of translation correlated with the

phosphorylation of eIF2α. After 2 hr, eIF2α phosphorylation decreased (Fig. 1B) and protein

translation began to resume (Fig. 1A). Intriguingly, closer inspection of the autoradiograph

revealed that not all proteins appeared to recover equally. While the majority of proteins were

translated at levels comparable to pre-stressed cells following dephosphorylation of eIF2α (Fig.

1A, indicated with a circle), other proteins were translated at a higher level and correspond to the

size of known ER chaperones that are targets of the response (Fig. 1A, marked with an asterisk).

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

6

Intriguingly, translation of a subset of proteins did not appear to recover to pre-stress levels (Fig.

1A, marked with a diamond). At least one of the proteins that did not recover was the short-lived

cyclin D1 protein, whose translation has been shown to be blocked by eIF2α-dependent

translational repression (Brewer and Diehl, 2000), (Stockwell et al., 2012). Indeed, in our

experiments cyclin D1 protein levels began decreasing within 0.5 hours of thapsigargin treatment

and were undetectable by 2 hours (Fig. 1B). However, even though eIF2α was dephosphorylated

at later time points (Fig. 1B) and general protein translation had resumed, cyclin D1 protein

levels did not recover within the time frame of this experiment (Fig 1B). The sustained loss of

cyclin D1 protein expression was not limited to a single cell line or method of induction of ER

stress. HeLa cells, 293T and NB1691 cells all showed decreases in cyclin D1 protein expression

when they were examined after 16 hours of treatment with either thapsigarin or tunicamycin

(Fig. 1C).

Incomplete recovery from translational repression under chronic ER stress is associated with

4E-BP1 hypophosphorylation.

To further explore translational control during ER stress, we measured global translation rates in

NB1691 cells over a longer time course (Fig. 2A). Once again, we observed an early and

dramatic decrease in protein synthesis when thapsigargin was used. However, even after 24

hours of treatment, total TCA-precipitable counts only recovered to ~80% of pre-stressed levels

(Fig. 2A), even though there was an increase in the synthesis of molecular chaperones (data not

shown) and UPR target genes like CHOP. We investigated the phosphorylation status of both

eIF2α and 4E-BP1 under these longer periods of ER stress. NB1691 cells were treated with

thapsigargin for the indicated times, and cell lysates were subjected to western blotting analysis

(Fig. 2B). As expected, ER stress caused an initial increase in the phosphorylation of eIF2α,

which decreased to basal levels after 2 hours. When the same membrane was blotted for 4E-BP1,

we found that the majority of 4E-BP1 appeared to be hyperphosphorylated (the γ form) in the

absence of ER stress, a state which allows translation to proceed (Fig. 2B). As the thapsigargin

treatment time increased, there was a modest but progressive shift to the hypophosphorylated α

form of 4E-BP1. To extend our findings to other cell types and different methods of ER stress

induction, we also examined phosphorylation of 4E-BP1 protein in HeLa and 293T cells treated

with either thapsigargin or tunicamycin for 16 hours. In both cell lines, the appearance of the

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

7

hypophosphorylated form of 4E-BP1 could be readily observed, although the relative amounts

varied somewhat (Fig. 2C). Of note, we observed an increase in total 4E-BP1 levels in 293T

cells (Fig. 2C) and mouse embryonic fibroblasts (data not shown) similar to previous studies in

pancreatic cells (Yamaguchi et al., 2008) but not in HeLa or NB1691 cells, suggesting that the

up-regulation of this protein during UPR activation may be cell-type specific.

ER stress-induced 4E-BP1 hypophosphorylation results in decreased eIF4F formation and the

loss of translation of eIF4F target mRNAs. To assess whether the changes in the phosphorylation

status of 4E-BP1 observed under ER stress conditions was sufficient to lead to the binding of 4E-

BP1 to eIF4E and a concomitant loss of eIF-4G on capped mRNA, we used 7M-GTP beads, as a

mimetic of the 5’ cap structure, in a pull down assay. The binding of 4E-BP1 and eIF4G was

determined, and as both bind to eIF4E, blotting for this protein served as a control. NB1691 cells

were treated with either tunicamcyin or thapsigargin for 16 and 24 hours or left untreated (Fig.

3A). Lysates were incubated with 7M-GTP beads and bound proteins were detected by western

blotting for eIF4E, eIF4G and 4E-BP1 (Fig. 3A). While the amount of eIF4E bound to the 7M-

GTP beads was comparable between all groups, there was an increase in 4E-BP1 bound to the

7M-GTP beads with either ER stress inducing drug (consistent with decreased cap-dependent

translation), which corresponded to a reciprocal decrease in the binding of eIF4G (Fig. 3A).

These results indicate that the ER stress-induced reduction in 4E-BP1 phosphorylation is likely

to be functionally significant.

We next examined the steady state levels of several proteins, known to be sensitive to eIF4F

loss, over a time course of thapsigargin treatment spanning 24 hours. NB1691 cells were treated

with this ER stress inducing agent for the indicated time points, and subjected to western blot

analyses. As expected, the short-lived cyclin D1 protein levels decreased at the earliest time

points examined (Fig. 3B), which is consistent with its loss being due to the eIF-2α mediated

translational block (Brewer and Diehl, 2000) and remained undetectable even after global

translation had been restored. We next examined the expression of Bcl-2, which is normally a

rather long-lived protein (Merino et al., 1994) but is known to be sensitive to eIF4 levels

(reviewed in (Graff and Zimmer, 2003)). Somewhat unexpectedly, Bcl-2 levels decreased in

NB1691 cells as early as 2 hours of thapsigargin treatment and remained lower throughout the

time course. Although Bcl-2 has been shown to have a half-life of between 10 and 20 hours

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

8

depending on the cell type (Beck et al., 2002), (Gao and Dou, 2000), (Brunelle et al., 2009),

there are reports of certain stresses like glutathione depletion (Celli et al., 1998) or alterations in

the level of the pro-apoptotic protein Bim (Jorgensen et al., 2007) significantly decreasing its

stability. We also examined MMP9 expression after ER stress, which is also known to be

dependent on eIF4F levels (De and Graff, 2004). Unlike the two previous proteins examined, it is

a secreted protein, so its loss from the cell is a combination of changes in the rate of both

translation and transport through the cell. Correspondingly levels of this protein did not decrease

noticeably until after 16 hours of thapsigargin treatment (Fig. 3B). Although we tried several

antibodies, we were unable to find one that worked for immunoprecipitation assays to more

directly monitor synthesis (data not shown). While these more eIF4F-dependent proteins showed

a dramatic reduction in expression, there was a significant induction of the UPR target CHOP

(Fig. 3B), arguing that only a subset of targets are affected in keeping with the data in Fig. 1A.

To ensure that the reduced expression of these proteins was the result of decreased biosynthesis

not reduced levels of transcripts available for translation we performed real-time PCR analyses

(Fig. 3C). Indeed, within the time frame of our experiments we did not observe any significant

changes in mRNA transcript levels for any of the proteins examined in Fig. 3B. These data

indicate that the UPR can induce not only the global translational changes that are mediated by

the phosphorylation status of eIF2α, but can also induce more subtle translational changes that

affect at least some eIF4F-sensitive mRNAs.

ER stress treatment results in a decrease in mTOR signaling and growth factor receptor

maturation. One of the best-characterized 4E-BP1 kinases is mammalian Target of Rapamycin

(mTOR), and several groups have reported ER stress induced perturbations in signaling upstream

of mTOR (Ozcan et al., 2004), (Salazar et al., 2009), (Di et al., 2009),(Qin et al., 2010). We

therefore examined mTOR activation status in response to tunicamycin- and thapsigargin-

induced ER stress. Phosphorylation of mTOR at Ser2448, indicative of activation, was very

modestly reduced after 6 hours of thapsigargin treatment, and was further reduced at 16 and 24

hours with both ER stress-inducing drugs (Fig 4A). The different kinetics of the phosphorylation

changes induced by these two pharmacological agents is likely to reflect differences in their

mechanisms of action, which result in thapsigargin inducing an earlier UPR than tunicamycin.

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

9

Next, we monitored effects of UPR activation on the phosphorylation of 4E-BP1, an mTOR

target and include treatment with rapamycin, a well-characterized mTOR inhibitor, for

comparison. We observed a shift from the hyperphosphorylated to less modified forms of 4E-

BP1 after longer times of treatment with both of these UPR inducers, which was similar to what

was observed with rapamycin or even slightly greater in the case of tunicamycin (Fig. 4B). As

the effects on 4E-BP1 even with rapamycin treatment were not particularly dramatic in this line,

we examined a second line. Rh30 cells were treated with rapamycin and tunicamycin, and

effects on 4E-BP1 isoforms were monitored. In this line we observed a more dramatic effect on

4E-BP1 phosphorylation with rapamycin treatment and again observed a similar decrease in the

tunicamycin-treated cells (Fig. 4C). We also performed the 7M-GTP bead binding assay as a

functional measure of cap binding and included varying concentrations of low glucose, as a more

slow acting but also more physiological inducer of the UPR (Fig. 4D). Concentrations of

glucose as high as 6.25 mM were sufficient to both induce the UPR and lead to

hypophosphorylation as levels comparable to rapamycin, whereas neither thapsigargin or

tunicamycin treatment induced hypophosphorylation of 4E-BP1 at the shorter time point used,

even though it was sufficient to activate the UPR, in keeping with data obtained with the

NB1691 cells (Fig. 4A).

To determine how the UPR was affecting mTOR activation, we first examined the PI3K

pathway. We began with the receptor tyrosine kinases (RTK), which are the most up-stream

components of this signaling pathway and are synthesized in the ER and transported to the cell

surface after proper maturation. We reasoned that it was conceivable that ER stress could

interfere with their maturation and thus result in loss of signaling through these receptors.

NB1691 cells were treated with tunicamycin or thapsigargin for the indicated times and

monitored two well-characterized RTK proteins that signal through this pathway. We found that

treatment with the glycosylation inhibitor tunicamcyin resulted in the appearance of an

unglycosylated form and a decrease in mature levels of the beta subunit of both the insulin

receptor (IRβ) (Fig. 5A) and the insulin-like growth factor 1 receptor (IGF1Rβ) (Fig. 5B) as

early as 16 hrs of treatment, which was even more dramatic after 24 hrs. When cells were treated

with thapsigargin, we found that the maturation IRβ was largely unaffected at all treatment

times. Very modest decreases in mature levels of IGF1Rβ were observed after 16 hrs and

became more significant at 24 hours, but were still less dramatic than observed with

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

10

tunicamycin. As RTKs are glycoproteins, it is likely that the loss of glycosylation that occurs

with tunicamycin treatment has greater effects on their maturation than the loss of calcium from

the ER that results with thapsigargin treatment.

ER stress activators do not uniformly inhibit PI3K/Akt pathway signaling in NB1691 cells. To

more globally monitor growth factor receptor signaling, we examined the activation of Akt,

which is downstream of a large number of the RTK, and because changes in Akt activity have

been shown to occur by a variety of mechanisms (Ozcan et al., 2004),(Salazar et al., 2009).

Western blots were performed using antibodies specific for phosphorylated Akt (Thr473), a

residue known to be important for full activation of Akt and its downstream signaling (Sarbassov

et al., 2005). In keeping with two previous studies (Ozcan et al., 2004), (Qin et al., 2010), we

found that tunicamycin induced an observable decrease in phosphorylated Akt after 16 hours of

treatment and much greater decrease after 24 hours of treatment (Fig. 6A), suggesting that the

maturation of many RTKs are likely to be affected by tunicamycin in keeping with the fact that

they are glycoproteins. Thapsigargin had little effect at any time point on Akt activation in these

cells (Fig. 6A), which indicates that similar to IR-β (Fig. 5A) changes in ER calcium levels do

not adversely effect the maturation of the RTKs. Activated Akt phosphorylates TSC2, a negative

regulator of mTOR at Thr1462 (Manning et al., 2002), resulting in an inhibition of TSC2’s

suppressive affect on mTOR (Inoki et al., 2002). Therefore, we next examined the

phosphorylation of TSC2 at the Akt-specific residue Thr1462. We found a very modest decrease

in its phosphorylation, but only in response to tunicamycin treatment, which is in keeping with

our finding that tunicamycin but not thapsigargin diminished Akt activation (Fig. 6A).

Our finding that thapsigargin was equally effective as tunicamycin in reducing 4E-BP1

phosphorylation led us to examine other proteins that impinge on the mTOR/4E-BP1 axis.

mTOR activity can also be negatively regulated by phosphorylated AMP-activated protein

kinase (AMPK) (Hardie et al., 2012), which was recently shown to be activated in response to

some ER stress conditions (Pereira et al., 2010). To examine the possible involvement of this

kinase in the reduced mTOR signaling observed with longer treatments with ER stressors,

NB1691 cells were treated with tunicamycin and thapsigargin for the indicated times and the

proteins were assessed via western blot analyses. Thapisgargin treatment resulted in an increase

in AMPK phosphorylation at Thr172 with 6 hours of treatment, and was sustained through 16

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

11

and 24 hours (Fig. 6B). In keeping with the somewhat slower kinetics of UPR activation by

tunicamycin, there was no observable increase in Thr172 phosphorylation at 6 hr, but after 16

and 24 hrs there was a significant increase in Thr172 phosphorylation. To further explore the

significance of this activation to mTOR signaling, we examined the phosphorylation of the

AMPK target TSC2 at Ser1387, which enhances the inhibitory effects of TSC on mTOR (Huang

and Manning, 2008),(Inoki et al., 2003). After 24 hours of treatment with either stressor,

phosphorylation of TSC2 at this residue was increased above control levels (Fig. 6B), indicating

that the observed ER stress-induced AMPK phosphorylation contributes to inhibitory TSC

signaling and thus likely to the decrease in mTOR phosphorylation observed in Fig. 4A.

DISCUSSION

The ability of cells to modify translation in response to both intracellular cues and

extracellular conditions is critical to cell survival, especially under conditions of stress. It is well

established that mammalian cells experiencing ER stress can induce a transient and global block

in translation via phosphorylation of eIF2α, which is achieved by the activation of the ER

transmembrane protein PERK (Harding et al., 1999). We have examined a second mechanism by

which cells experiencing ER stress can fine-tune their translational programs. We found that

translation rates after dephosphorylation of eIF-2α only returned to approximately 80% of that

occurring before thapsigargin-induced stress. Based on the inspection of proteins synthesized

after a short metabolic pulse-labeling, this did not appear to represent a general decrease in the

translational capacity of the post-stressed cells, but instead seemed to be due to changes in the

expression of a specific subset of proteins. The continued translational repression of this group of

proteins correlated with increased hypophosphorylation of 4E-BP1 leading to its increased

binding to eIF4E, which would interfere with the formation of the eIF4F complex at the mRNA

cap. Indeed, we found that the expression of several proteins known to be sensitive to eIF4F

availability were decreased after longer periods of ER stress, including cyclin D1, Bcl-2 and

MMP-9. These data are in keeping with a previous study demonstrating that deletion of 4E-BP1

was required to allow translation to be fully restored after ER stress (Yamaguchi et al., 2008).

There is a growing body of literature describing interactions or crosstalk between the mTOR

pathway and the UPR. Several studies have demonstrated a decrease in Akt signaling in response

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

12

to ER stress leading to reduced mTOR activity. In one case the UPR was induced in human

glioma cells by Δ9-Tetrahydrocannabinol (THC) leading to a CHOP-dependent induction of the

tribbles homologue 3,TRB3, which inhibited Akt and as a result mTOR (Salazar et al., 2009).

Alternatively, another study using Fao liver cells found that Ire1-dependent activation of JNK led

to phosphorylation of insulin receptor substrate 1, IRS-1, which reduced insulin receptor

signaling and activation of Akt (Ozcan et al., 2004). Of note, the decrease in Akt activity in this

and another study (Qin et al., 2010) occurred with both tunicamycin and thapsigargin, suggesting

that our failure to observe decreases in Akt activation with thapsigargin might be somewhat cell

type specific. Our study does suggest that the proper maturation of RTKs, which are glycosylated

on multiple residues, are more adversely affected by some forms of ER stress, like tunicamycin

and likely the more physiological UPR activator, low glucose. These data provide yet another

method for reduced Akt activity during UPR activation and furthermore highlight the often

overlooked fact that the agents used to induce ER stress have cellular effect that lie outside the

signaling pathways that comprise the UPR.

In addition to reduced signaling through Akt, activation of the Tsc1/2 complex represents

another mechanism of inhibiting mTOR. A recent study demonstrated LPS-induced

differentiation of mouse splenic B cells led to a reduction in mTOR activity, which could be

inhibited by genetic ablation of TSC1 (Goldfinger et al., 2011). Importantly, terminal plasma cell

differentiation relies on the activation of a partial UPR (Iwakoshi et al., 2003), (Shaffer et al.,

2004), arguing for a link between the UPR and TSC1/2 regulation of mTOR. Under conditions

of decreased availability of energy, AMP kinase (AMPK) is activated (Hardie et al., 2012),

leading to phosphorylation of TSC2 on Ser1387. This modification inhibits the Rheb protein,

which is another positive regulator of mTOR (Laplante and Sabatini, 2012). We found that

induction of ER stress with either tunicamycin or thapsigargin resulted in the phosphorylation of

both AMPK itself and the residue of TSC2 known to be phosphorylated by AMPK. However,

another study saw no evidence of AMPK activation by tunicamycin in mouse embryonic

fibroblasts (Qin et al., 2010), again suggesting that the mechanisms for inhibiting mTOR activity

during ER stress might vary by both the stressor used and the type of cells examined. In an

attempt to more directly demonstrate that AMPK was the critical culprit, we used the AMPK

inhibitor Compound C. However the combination of this inhibitor with either tunicamycin or

thapsigargin proved to be toxic to our cells (data not shown) preventing us from making this

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

13

point. Interestingly, recent data show reciprocally that mTOR activity can promote ER stress.

Two separate studies (Ozcan et al., 2008),(Qin et al., 2010), revealed that hyperactivation of

mTOR due to loss of Tsc2 led to UPR activation, likely due to increased protein synthesis in the

ER. In both cases, UPR activation was accompanied by decreased Akt activity, establishing this

aspect of the UPR as a feed back loop to control mTOR activity.

The reduced activity of mTOR during ER stress leads to hypophosphorylation of 4E-BP1,

which we and others (Yamaguchi et al., 2008) show reduces the ability of eIF-4G to bind to 7mGTP beads as a mimetic of the binding of the eIF-4F complex binding to the mRNA cap.

Although not examined here, a number of proteins like c-myc, ornithine decarboxylase and

fibroblast growth factor 2 are known to be particularly dependent on eIF4F levels and can be

loosely categorized as “pro-growth” proteins (Graff and Zimmer, 2003), (Mamane et al., 2004)

and are not translated when mTOR is inhibited with rapamycin in a 4E-BP1-dependent manner

(Dowling et al., 2010). Therefore, it is plausible to suggest that the ER stress induced decrease in

4E-BP1 phosphorylation could be a mechanism by which cells limit cell division and growth

during stressful conditions, while at the same time allowing them to continue to produce proteins

that maintain cellular fitness. In this way, cellular growth and division would be limited while

still allowing for the translation of UPR transcriptional targets and those mRNAs required for

cellular maintenance. Indeed, the well-characterized arrest of cells experiencing ER stress in the

G1 phase of cell cycle was shown to be due to loss of cyclin D1 protein, even though D1

transcript levels were not altered (Brewer et al., 1999). This was consequently linked to PERK-

dependent eIF-2α phosphorylation (Brewer and Diehl, 2000), which rapidly led to the depletion

of this very short lived protein. The data presented here are consistent with the PERK/eIF-2α

axis playing an early role in suppressing cyclin D1 biosynthesis, but further reveal that once most

translation has resumed D1 protein remains very low, even though the transcripts are still

present, which is likely regulated by the eIF4 axis of translational control.

On the other hand, a number of pro-survival proteins are also among those that are

significantly dependent on eIF4F levels, including Bcl2 and survivin (Konicek et al., 2008). The

balance between cytoprotective and cytodestructive aspects of the UPR is quite complex and the

timing varies by cell type and cellular conditions (Tabas and Ron, 2011). Indeed, decreases in

Bcl2 mRNA levels can occur downstream of the CHOP transcription factor (McCullough et al.,

2001). However, within the time frame of our experiments Bcl2 transcript levels were not

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

14

diminished and in fact were very slightly increased by tunicamycin treatment. It is well

established that many of these proteins, including MMP9, are critical for tumor growth and/or

metastasis, and a growing number of studies have documented UPR activation in a variety of

tumor types leading investigators to suggest it could be a target for therapeutic intervention

(reviewed in (Wang and Kaufman, 2012), (Li et al., 2011), (Healy et al., 2009)). This would

suggest that the loss of these proteins in tumors experiencing ER stress would be

counterproductive to tumor growth and survival. Thus it is noteworthy that eIF4E, the rate-

limiting step in cap-dependent translation, and the target of hypophosphorylated 4E-BP1, is often

up-regulated in tumors and is considered to be essential for their survival (De and Graff, 2004).

Here, we have examined a second node of translational control in the UPR, centered around

4E-BP1, which exerts its effects after eIF-2α-mediated translation inhibition. In our model, we

observed that translation of eIF4F-sensitive proteins do not recover from the eIF2α-induced

translational block upon eIF2α dephosphorylation. Instead, translation of these proteins remains

repressed, which is likely due to the UPR-induced negative regulation of the mTOR pathway and

the resulting hypophosphorylation of the eIF4F repressor, 4E-BP1. This repression appears to be

achieved in our cells, at least in part, via UPR-induced AMPK activation; a negative regulator of

the mTOR pathway and reduction in signaling through the PI3K/AKT pathway. Unlike the more

global inhibition of protein synthesis mediated by eIF-2α, the translational targets of this

secondary node appear to be restricted to a sub-group of proteins that are potent activators of

growth and survival.

MATERIALS AND METHODS

Cell Culture - NIH3T3, HeLa and 293T cells were cultured in DMEM supplemented with 10%

heat inactivated fetal bovine serum, 2 mM glutamine and 1% antibiotic-antimycotic at 37°C in a

5% CO2 incubator. NB1691 neuroblastoma and Rh30 rhabdomyosarcoma human cell lines were

cultured in RPMI 1640 supplemented with 10% fetal bovine serum and 2 mM glutamine. Cells

were plated and left untreated (control) or treated with thapsigargin (2 μM, Sigma-Aldrich, St.

Louis, MO, USA), tunicamycin (2.5 μg/ml, Sigma-Aldrich, St. Louis, MO, USA) for the

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

15

indicated times, or rapamycin (100 nM, 4 hours).

Metabolic labeling - Following indicated experimental treatments, cells were washed with

phosphate buffered saline and then pulsed for 5 minutes in methionine- and cysteine-free DMEM

labeling medium containing 10% dialyzed FBS and 100 μCi 35S-methionine and cysteine (35S-

TransLabel; MP Biomedicals, Santa Ana, CA, USA). Cells were lysed in CHAPS lysing buffer

(pH 7.4 (40 mM HEPES, 120 mM NaCl, 1 mM EDTA, 10 mM sodium pyrophosphate, 10 mM

sodium ß-glycerophosphate, 50 mM NaF, 1.5 mM Na3VO4, 0.3% CHAPS), sonicated and

centrifuged at 12,000rpm for 10 min at 4°C to remove nuclei and cellular debris. Total protein

was quantified by Bradford assay (BIO-RAD, Hercules, CA, USA), and samples were equalized

for total protein. For experiments were the translation of individual proteins was to be studied,

lysates were analyzed by SDS-PAGE and radiographic signals were visualized by incubating gel

with Amplify (GE Healthcare, Fairfield, CT, USA) and exposing gel to x-ray film. For

experiments where total incorporation of radiolabeled amino acids was quantified, 2 μl of each

lysate was spotted onto filter paper squares, allowed to dry, and then precipitated by boiling in

10% TCA for 10 minutes, followed by water, ethanol, and acetone rinses. Dry filters were then

subjected to scintillation counting. Counts were normalized to protein quantity and counts

calculated as a percentage of control.

7methyl-GTP bead pull down - Following indicated experimental treatments, cells were lysed in

CHAPS lysing buffer, supplemented with complete protease inhibitor tablet (Roche, Pleasanton,

CA, USA) and PhoSTOP phosphatase inhibitor tablet (Roche, Pleasanton, CA, USA). Lysates

were sonicated, clarified by centrifugation at 14,000 rpm for 10 minutes at 4°C, and protein

content was quantified. The 7methyl-GTP bead binding assay was performed as previously

described (Inoki et al., 2003). Briefly, lysates were diluted in CHAPS buffer to a concentration

of 20ug total protein in a total volume of 170μl. 30 μl of a 33% slurry of 7methyl-GTP

conjugated Sepharose beads (GE Healthcare, Fairfield, CT, USA) was added to the diluted

lysates. The mixture was rotated for 2 hours at 4°C. Following this incubation, Sepharose bead

pellets were washed 3 times with 500 μl of washing buffer (pH 7.5 (50mM HEPES, 150 mM

NaCl). Bound proteins were eluted with 20 μl Laemmli loading buffer and boiled, after which

samples were analyzed by SDS-PAGE and western blotting.

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

16

Western blotting - For whole cell western blotting, lysates were diluted to achieve equal protein

concentrations and subjected to SDS-PAGE and western blotting. Antibodies used to detect

specific proteins for Western blots were as follows: phospho-eIF2α (S51), Akt (total), phospho-

Akt (S473), AMPKα (total), phospho-AMPK (T172), Bcl-2, eIF4E, eIF4G, 4E-BP1 (total),

IGF1 receptor β, Insulin receptor β, mTOR (total), phospho-mTOR (S2448), phospho-TSC2

(S1387), phospho-TSC2 (T1462) antibodies all from Cell Signaling Technology (Danvers, MA,

USA); β-actin antibody from Sigma-Aldrich (St. Louis, MO, USA); MMP antibody from

Millipore (Billerica, MA, USA) and cyclin D1 was from Santa Cruz Biotechnology (Dallas,

Texas, USA). Blots were incubated with the appropriate HRP-conjugated secondary antibody,

and proteins were visualized using the Pierce enhanced chemiluminescent substrate (Thermo

Scientific; Waltham, MA, USA).

mRNA Quantification by qRT-PCR - Total RNA was extracted using the RNeasy Qiagen mini-

prep kit according to the manufacturer's protocol. cDNA was produced using 1μg total RNA and

reverse transcriptase reactions were performed using a high capacity cDNA reverse transcription

kit (Applied Biosystems, Carlsbad, CA, USA). Amplification of the indicated genes was carried

out using Power SYBR Green PCR Master Mix (Applied Biosystems, Carlsbad, CA, USA) with

specific primers (Bcl2 acggggtgaactgggggagga, tccacaaaggcatcccagcctc; MMP-9

agccgggacgcagacatcgt, ttggaaccacgacgcccttgc; cyclin D1 caagtgtgacccggactgcctc,

cgccctcagatgtccacgtcc) and measured continuously using an ABI 7900 HTI Detection System.

The value for untreated cells was set to 1, and the value for the various treatments was presented

as a fraction of this number.

ACKNOWLEDGEMENTS

This work was supported by NIH Grant P01CA023099 (LMH), the Cancer Center CORE Grant

CA21765, and the American Lebanese Syrian Associated Charities of St. Jude Children's Research

Hospital.

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

17

REFERENCES

1. Beck, M. T., Peirce, S. K. and Chen, W. Y. (2002). Regulation of bcl-2 gene expression in human breast cancer cells by prolactin and its antagonist, hPRL-G129R.

Oncogene 21, 5047-5055.

2. Brewer, J. W. and Diehl, J. A. (2000). PERK mediates cell-cycle exit during the mammalian unfolded protein response. Proc. Natl. Acad. Sci. U. S. A 97, 12625-12630.

3. Brewer, J. W., Hendershot, L. M., Sherr, C. J. and Diehl, J. A. (1999). Mammalian unfolded protein response inhibits cyclin D1 translation and cell-cycle

progression. Proc. Natl. Acad. Sci. U. S. A 96, 8505-8510.

4. Brunelle, J. K., Ryan, J., Yecies, D., Opferman, J. T. and Letai, A. (2009). MCL-1-dependent leukemia cells are more sensitive to chemotherapy than BCL-2-

dependent counterparts. J. Cell Biol. 187, 429-442.

5. Celli, A., Que, F. G., Gores, G. J. and LaRusso, N. F. (1998). Glutathione depletion is associated with decreased Bcl-2 expression and increased apoptosis in

cholangiocytes. Am. J. Physiol 275, G749-G757.

6. Culjkovic, B., Topisirovic, I., Skrabanek, L., Ruiz-Gutierrez, M. and Borden, K. L. (2006). eIF4E is a central node of an RNA regulon that governs cellular

proliferation. J. Cell Biol. 175, 415-426.

7. De, B. A. and Graff, J. R. (2004). eIF-4E expression and its role in malignancies and metastases. Oncogene 23, 3189-3199.

8. Di, N. A., Kramvis, I., Cho, N., Sadowski, A., Meikle, L., Kwiatkowski, D. J. and Sahin, M. (2009). Tuberous sclerosis complex activity is required to control neuronal stress responses in an mTOR-dependent manner. J. Neurosci. 29, 5926-5937.

9. Dowling, R. J., Topisirovic, I., Alain, T., Bidinosti, M., Fonseca, B. D., Petroulakis, E., Wang, X., Larsson, O., Selvaraj, A., Liu, Y. et al. (2010). mTORC1-mediated

cell proliferation, but not cell growth, controlled by the 4E-BPs. Science 328, 1172-1176.

10. Gao, G. and Dou, Q. P. (2000). G(1) phase-dependent expression of bcl-2 mRNA and protein correlates with chemoresistance of human cancer cells. Mol. Pharmacol.

58, 1001-1010.

11. Gingras, A. C., Raught, B. and Sonenberg, N. (1999). eIF4 initiation factors: effectors of mRNA recruitment to ribosomes and regulators of translation. Annu. Rev.

Biochem. 68, 913-963.

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

18

12. Goldfinger, M., Shmuel, M., Benhamron, S. and Tirosh, B. (2011). Protein synthesis in plasma cells is regulated by crosstalk between endoplasmic reticulum stress and

mTOR signaling. Eur. J. Immunol. 41, 491-502.

13. Graff, J. R. and Zimmer, S. G. (2003). Translational control and metastatic progression: enhanced activity of the mRNA cap-binding protein eIF-4E selectively enhances

translation of metastasis-related mRNAs. Clin. Exp. Metastasis 20, 265-273.

14. Hardie, D. G., Ross, F. A. and Hawley, S. A. (2012). AMPK: a nutrient and energy sensor that maintains energy homeostasis. Nat. Rev. Mol. Cell Biol. 13, 251-262.

15. Harding, H. P., Novoa, I., Zhang, Y., Zeng, H., Wek, R., Schapira, M. and Ron, D. (2000a). Regulated translation initiation controls stress-induced gene expression

in mammalian cells. Mol. Cell 6, 1099-1108.

16. Harding, H. P., Zeng, H., Zhang, Y., Jungries, R., Chung, P., Plesken, H., Sabatini, D. D. and Ron, D. (2001). Diabetes mellitus and exocrine pancreatic dysfunction in perk-/- mice reveals a role for translational control in secretory cell survival. Mol.

Cell 7, 1153-1163.

17. Harding, H. P., Zhang, Y., Bertolotti, A., Zeng, H. and Ron, D. (2000b). Perk is essential for translational regulation and cell survival during the unfolded protein response.

Mol. Cell 5, 897-904.

18. Harding, H. P., Zhang, Y. and Ron, D. (1999). Protein translation and folding are coupled by an endoplasmic-reticulum-resident kinase. Nature 397, 271-274.

19. Hay, N. and Sonenberg, N. (2004). Upstream and downstream of mTOR. Genes Dev. 18, 1926-1945.

20. Healy, S. J., Gorman, A. M., Mousavi-Shafaei, P., Gupta, S. and Samali, A. (2009). Targeting the endoplasmic reticulum-stress response as an anticancer strategy.

Eur. J. Pharmacol. 625, 234-246.

21. Hsieh, A. C., Liu, Y., Edlind, M. P., Ingolia, N. T., Janes, M. R., Sher, A., Shi, E. Y., Stumpf, C. R., Christensen, C., Bonham, M. J. et al. (2012). The translational

landscape of mTOR signalling steers cancer initiation and metastasis. Nature 485, 55-61.

22. Huang, J. and Manning, B. D. (2008). The TSC1-TSC2 complex: a molecular switchboard controlling cell growth. Biochem. J. 412, 179-190.

23. Inoki, K., Li, Y., Zhu, T., Wu, J. and Guan, K. L. (2002). TSC2 is phosphorylated and inhibited by Akt and suppresses mTOR signalling. Nat. Cell Biol. 4, 648-657.

24. Inoki, K., Zhu, T. and Guan, K. L. (2003). TSC2 mediates cellular energy response to control cell growth and survival. Cell 115, 577-590.

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

19

25. Iwakoshi, N. N., Lee, A. H. and Glimcher, L. H. (2003). The X-box binding protein-1 transcription factor is required for plasma cell differentiation and the unfolded

protein response. Immunol. Rev. 194, 29-38.

26. Jorgensen, T. N., McKee, A., Wang, M., Kushnir, E., White, J., Refaeli, Y., Kappler, J. W. and Marrack, P. (2007). Bim and Bcl-2 mutually affect the expression of the

other in T cells. J. Immunol. 179, 3417-3424.

27. Konicek, B. W., Dumstorf, C. A. and Graff, J. R. (2008). Targeting the eIF4F translation initiation complex for cancer therapy. Cell Cycle 7, 2466-2471.

28. Laplante, M. and Sabatini, D. M. (2012). mTOR signaling in growth control and disease. Cell 149, 274-293.

29. Li, X., Zhang, K. and Li, Z. (2011). Unfolded protein response in cancer: the physician's perspective. J. Hematol. Oncol. 4, 8.

30. Liu, C. Y., Schroder, M. and Kaufman, R. J. (2000). Ligand-independent dimerization activates the stress-response kinases IRE1 and PERK in the lumen of the

endoplasmic reticulum. J. Biol. Chem.

31. Ma, Y. and Hendershot, L. M. (2003). Delineation of the negative feedback regulatory loop that controls protein translation during ER stress. J. Biol. Chem. 278, 34864-

34873.

32. Mamane, Y., Petroulakis, E., Rong, L., Yoshida, K., Ler, L. W. and Sonenberg, N. (2004). eIF4E--from translation to transformation. Oncogene 23, 3172-3179.

33. Manning, B. D., Tee, A. R., Logsdon, M. N., Blenis, J. and Cantley, L. C. (2002). Identification of the tuberous sclerosis complex-2 tumor suppressor gene product

tuberin as a target of the phosphoinositide 3-kinase/akt pathway. Mol. Cell 10, 151-162.

34. McCullough, K. D., Martindale, J. L., Klotz, L. O., Aw, T. Y. and Holbrook, N. J. (2001). Gadd153 sensitizes cells to endoplasmic reticulum stress by down-

regulating Bcl2 and perturbing the cellular redox state. Mol. Cell Biol. 21, 1249-1259.

35. Merino, R., Ding, L., Veis, D. J., Korsmeyer, S. J. and Nunez, G. (1994). Developmental regulation of the Bcl-2 protein and susceptibility to cell death in B lymphocytes.

EMBO J. 13, 683-691.

36. Novoa, I., Zeng, H., Harding, H. P. and Ron, D. (2001). Feedback inhibition of the unfolded protein response by GADD34-mediated dephosphorylation of

eIF2alpha. J. Cell Biol. 153, 1011-1022.

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

20

37. Novoa, I., Zhang, Y., Zeng, H., Jungreis, R., Harding, H. P. and Ron, D. (2003). Stress-induced gene expression requires programmed recovery from translational

repression. EMBO J. 22, 1180-1187.

38. Ozcan, U., Cao, Q., Yilmaz, E., Lee, A. H., Iwakoshi, N. N., Ozdelen, E., Tuncman, G., Gorgun, C., Glimcher, L. H. and Hotamisligil, G. S. (2004). Endoplasmic

reticulum stress links obesity, insulin action, and type 2 diabetes. Science 306, 457-461.

39. Ozcan, U., Ozcan, L., Yilmaz, E., Duvel, K., Sahin, M., Manning, B. D. and Hotamisligil, G. S. (2008). Loss of the tuberous sclerosis complex tumor

suppressors triggers the unfolded protein response to regulate insulin signaling and apoptosis. Mol. Cell 29, 541-551.

40. Pelletier, J. and Sonenberg, N. (1985). Insertion mutagenesis to increase secondary structure within the 5' noncoding region of a eukaryotic mRNA reduces

translational efficiency. Cell 40, 515-526.

41. Pereira, E. R., Liao, N., Neale, G. A. and Hendershot, L. M. (2010). Transcriptional and post-transcriptional regulation of proangiogenic factors by the unfolded protein

response. PLoS. ONE. 5.

42. Proud, C. G. (2004). mTOR-mediated regulation of translation factors by amino acids. Biochem. Biophys. Res. Commun. 313, 429-436.

43. Qin, L., Wang, Z., Tao, L. and Wang, Y. (2010). ER stress negatively regulates AKT/TSC/mTOR pathway to enhance autophagy. Autophagy. 6, 239-247.

44. Ron, D. and Walter, P. (2007). Signal integration in the endoplasmic reticulum unfolded protein response. Nat. Rev. Mol. Cell Biol. 8, 519-529.

45. Salazar, M., Carracedo, A., Salanueva, I. J., Hernandez-Tiedra, S., Lorente, M., Egia, A., Vazquez, P., Blazquez, C., Torres, S., Garcia, S. et al. (2009). Cannabinoid action induces autophagy-mediated cell death through stimulation of ER stress in

human glioma cells. J. Clin. Invest 119, 1359-1372.

46. Sarbassov, D. D., Guertin, D. A., Ali, S. M. and Sabatini, D. M. (2005). Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science 307, 1098-

1101.

47. Shaffer, A. L., Shapiro-Shelef, M., Iwakoshi, N. N., Lee, A. H., Qian, S. B., Zhao, H., Yu, X., Yang, L., Tan, B. K., Rosenwald, A. et al. (2004). XBP1, downstream of Blimp-1, expands the secretory apparatus and other organelles, and increases

protein synthesis in plasma cell differentiation. Immunity. 21, 81-93.

48. Stockwell, S. R., Platt, G., Barrie, S. E., Zoumpoulidou, G., Te Poele, R. H., Aherne, G. W., Wilson, S. C., Sheldrake, P., McDonald, E., Venet, M. et al. (2012).

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

21

Mechanism-based screen for G1/S checkpoint activators identifies a selective activator of EIF2AK3/PERK signalling. PLoS. ONE. 7, e28568.

49. Tabas, I. and Ron, D. (2011). Integrating the mechanisms of apoptosis induced by endoplasmic reticulum stress. Nat. Cell Biol. 13, 184-190.

50. Thoreen, C. C., Chantranupong, L., Keys, H. R., Wang, T., Gray, N. S. and Sabatini, D. M. (2012). A unifying model for mTORC1-mediated regulation of mRNA

translation. Nature 485, 109-113.

51. Walter, P. and Ron, D. (2011). The unfolded protein response: from stress pathway to homeostatic regulation. Science 334, 1081-1086.

52. Wang, S. and Kaufman, R. J. (2012). The impact of the unfolded protein response on human disease. J. Cell Biol. 197, 857-867.

53. Yamaguchi, S., Ishihara, H., Yamada, T., Tamura, A., Usui, M., Tominaga, R., Munakata, Y., Satake, C., Katagiri, H., Tashiro, F. et al. (2008). ATF4-

mediated induction of 4E-BP1 contributes to pancreatic beta cell survival under endoplasmic reticulum stress. Cell Metab 7, 269-276.

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

22

FIGURE LEGENDS Figure 1. Not all proteins recover equally from the early and transient block in protein translation induced by ER stress. A. NIH3T3 cells were treated with thapsigargin (Tg) for the indicated times. Cells were pulse-labeled with 35S labeled methionine and cysteine during the last five minutes of treatment. Lysates were prepared, equalized by protein concentration and analyzed by SDS-PAGE. Coomassie Blue staining serves as a loading control (upper panel), and 35S signal was detected by audioradiography (lower panel). Examples of stress-induced changes in levels of various proteins are indicated with symbols. Diamond (♦) indicates several proteins whose translation rate is less than pre-stressed levels at later time points, whereas asterisk (*) indicates several proteins that are synthesized above pre-stressed levels, and circle (•) indicates several proteins whose levels appear to return to pre-stressed levels. B. NB1691 cells were treated with Tg for the indicated times, lysates were prepared and analysed by SDS-PAGE followed by immunoblotting with phospho-eIF2α (Ser 51), cyclin D1 and beta-actin, as indicated. C. HeLa and 293T cells were treated with Tg and Tunicamycin (Tm) for 16 hours, lysates were prepared and subjected to SDS-PAGE followed by immunoblotting with cyclin D1 and beta-actin antibodies.

Figure 2. Incomplete translational recovery with prolonger ER stress is associated with 4E-BP1 hypophosphorylation. A. NB1691 cells were treated with Tg for the time periods indicated and cells were incubated with 35S labeled methionine and cysteine during the last five minutes of treatment. Lysates were prepared and equal amounts of total protein was spotted and dried onto filter paper. The radioactive signal was quantitated using a scintillation counter and expressed in graphical form as percentage of protein synthesis remaining. The short heavy bar indicates the time of maximal eIF2α phosphorylation, whereas the thin bar represents decreased translation rate after eIF2α phosphorylation returns to pre-stressed levels. B. NB1691 cells were treated with Tg for the indicated times. Lysates were analysed by SDS-PAGE followed by immunoblotting using antibodies directed against 4E-BP1, phospho-eIF2α (Ser 51) and beta-actin. The phospho-forms of 4E-BP1 are indicated with greek letters with γ representing the most phosphorylated form and α the least. C. HeLa and 293T cells were treated with thapsigargin (Tg) and tunicamycin (Tm) for 16 hours. Lysates were prepared and subjected to SDS-PAGE followed by immunoblotting with 4E-BP1 and β-actin antibodies. The phospho-forms of 4E-BP1 are indicated.

Figure 3. ER stress induced 4E-BP1 hypophosphorylation results in decreased eIF4F formation and the loss of translation of known eIF4F target mRNAs. A. NB1691 cells were treated with control conditions (NT) or with Tg or Tm for the indicated times. Lysates were prepared, total protein for each sample was equalized and samples were incubated with 7M-GTP sepharose beads. Bound protein was eluted and subjected to SDS-PAGE followed by immunoblotting using antibodies directed against eIF4G, 4E-BP1 and eIF4E. B. NB1691 cells were treated with Tg for the indicated times, lysates were prepared and subjected to SDS-PAGE followed by immunoblotting with antibodies directed against cyclin D1, Bcl2, MMP-9 and for each blot, β actin as a loading control. C. NB1691 cells were treated with Tg or Tm for either 16 hours (open bars) or 24 hours (hashed bars) as indicated. Total RNA was extracted and qRT-PCR was performed using specific primers to detect levels of mRNA of cyclin D1, MMP-9 and

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

23

Bcl-2. Experiments were performed in triplicate and represented as fold change compared to untreated cells. Values are mean +/- SD.

Figure 4. Prolonged ER stress is associated with a decrease in mTOR signaling. A. NB1691 cells were left untreated or treated with Tg or Tm for the indicated times. Cell lysates were prepared and normalized samples were analysed by SDS-PAGE and immunoblotting using antibodies specific for phospho-mTOR (Ser 2448), mTOR, and β-actin. B. NB1691 cells were treated as in A and with rapamycin as a control for mTOR-dependent effects on 4E-BP1. Lysates were analysed by SDS-PAGE followed by immunoblotting using antibodies directed against 4E-BP1 and β-actin. The phospho-forms of 4E-BP1 are indicated with greek letters with γ representing the most phosphorylated form and α the least. C. Rh30 cells were left untreated or incubated with rapamycin for 4 hr or tunicamycin for 16 hr and lysates were analyzed as in B. D. Rh30 cells were treated with varying concentrations of low glucose, tunicamycin or rapamycin for the indicated times. Lysates were prepared, total protein for each sample was equalized and samples were incubated with 7M-GTP sepharose beads. Bound protein was eluted and subjected to SDS-PAGE followed by immunoblotting with antiserum directed against 4E-BP-1. A portion of the equalized samples were directly analyzed for evidence of UPR activation using the CHOP antiserum. Beta actin serves as a control for loading.

Figure 5. Pharmaceutical agents used to activate ER stress can adversely affect growth factor receptor maturation. NB1691 cells were left untreated or treated with Tg or Tm for the indicated times. Cell lysates were prepared and normalized samples were analysed by SDS-PAGE and immunoblotted using antibodies specific for insulin receptor β, IGF1 receptor β, and β-actin. Various states of receptor maturation are indicated.

Figure 6 Prolonged ER stress treatment is associated with a decrease inPI3K/Akt pathway signaling and an increase in AMPK signaling. NB1691 cells were left untreated or treated with Tg or Tm for the indicated times. Lysates were prepared and analyzed by SDS-PAGE. Immunoblotting was performed using antibodies raised against A. phospho-Akt (Thr473), pan-Akt, and phospho-TSC2 (Thr1462) or B. phospho-AMPK (Thr172), pan AMPK, and phospho-TSC2 (Ser1387), with β-actin serving as a loading control.

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

A. B.

β-actin

β-actin

Phos-eIF2α(Ser51)

Cyclin D1

8Tg (h):

CoomassieBlue

35S label

0 0.5 1 2 3 4 6

*

**

Cyclin D1

β-actin

β-actin

HeLa

293T

NT

Cyclin D1

C.

��

•

•

Figure 1

Tg (h): 0 0.5 1 2 4 6

Tg Tm

24

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

C.

4E-BP1

β-actin

β-actin

HeLa

293T4E-BP1

NT

Incubation with Thapsigargin (hours)

% p

rote

in s

ynth

esis

rem

aini

ng

A.

B.

4E-BP1

0 0.5 1 2 4 6 16 24Tg (h):

β-actin

γβα

γβα

γβα

Figure 2

Tg Tm

Phos-eIF2α(Ser51)

25

0 5 10 15 20 250

20

40

60

80

100

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

4E-BP1

eIF4G

eIF4E

NT

Tm Tg NT Tm Tg

24 hrs16 hrs

A. B.

Cyclin D1

β-actin

MMP-9

β-actin

β-actin

0 0.5 1 2 4 6 16 24Tg (h):

Bcl-2

Figure 3

CHOP

C.

26

Bcl-2

Cont Tg Tm

0

0.5

1

1.5

2

2.5

3

3.5

4

Fol

d in

crea

se

MMP-9

Cont Tg Tm

0

0.5

1

1.5

2

2.5

3

3.5

4

Fol

d in

crea

se

CCND1

Cont Tg Tm0

0.5

1

1.5

2

2.5

3

3.5

4

Fol

d in

crea

se

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

NT Tm Tg

6 hrs 16 hrs 24 hrs

P-mTOR(Ser2448)

mTOR

β-actin

NT Tm Tg NT Tm Tg

Figure 427

NT Tm Tg NT Tm Tg NT Tm Tg

6 hrs 16 hrs 24 hrs4 hrs

Rapa

A.

B.

4E-BP1

γβα

β-actin

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

Unglycos. IGF1R

Mature IGF1R

Pro-IGF1R

Unglycos. IR

Mature IR

Pro-IR

Insulin Receptor beta

β-actin

IGF1Receptor beta

β-actin

Figure 5

A.

B.

29

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t

Phos-AMPKThr172

β-actin

Phos-AktThr473

β-actin

A.

Phos-TSC2(Thr1462)

Phos-TSC2(Ser1387)

B.

β-actin

β-actin

NT Tm Tg

6 hrs 16 hrs 24 hrs

NT Tm Tg NT Tm Tg

24 hrs

NT Tm Tg

NT Tm Tg

6 hrs 16 hrs 24 hrs

NT Tm Tg NT Tm Tg

24 hrs

NT Tm Tg

Figure 6

Total-Akt

Total-AMPK

30

Jour

nal o

f Cel

l Sci

ence

Acc

epte

d m

anus

crip

t