1
EXAMINATION OF A SECOND NODE OF TRANSLATIONAL CONTROL IN THE
UNFOLDED PROTEIN RESPONSE
Amanda M. Preston1,# and Linda M. Hendershot1
1Department of Genetics & Tumor Cell Biology, St. Jude Children’s Research Hospital,
Memphis, TN 38105 1
Current Address: #Neuroscience Institute, University of Tennessee Health Science Center, 875
Monroe Ave, Suite 426, Memphis, TN 38163
Correspondence to: Linda M. Hendershot, 262 Danny Thomas Place, Memphis, TN 38105, Ph:
(901) 595-2475, Fax: (901) 595-2381, [email protected]
Running title: 4E-BP1 and translation control in the UPR
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
JCS Advance Online Article. Posted on 10 July 2013
2
SUMMARY
The unfolded protein response (UPR) is a largely cytoprotective signaling cascade that acts
to re-establish homeostasis of the endoplasmic reticulum (ER) under conditions of stress by
inducing an early and transient block in general protein synthesis and by increasing the
folding and degradative capacity of the cell through an extensive transcriptional program.
It is well-established that the mechanism for the early translational attenuation during ER
stress occurs through phosphorylation of eukaryotic initiation factor 2 α (eIF2α) by
activated PERK. Our data demonstrate that when eIF2α is dephosphorylated translation is
not fully restored to pre-stressed levels. We find that this correlates with reduced mTOR
activity and as a result decreased phosphorylation of 4E-BP1, which negatively regulates
assembly of the eIF4F complex and cap-dependent translation. The decrease in mTOR/4E-
BP1 phosphorylation is associated with activation of AMP kinase, a negative regulator of
mTOR, and in the case of some stress conditions, down-regulation of signaling through key
components of the PI3K pathway. Furthermore, we show that there is a subset of mRNAs
that do not recover from UPR-induced translational repression, which include those whose
translation is particularly sensitive to loss of eIF4F, such as cyclin D1, Bcl-2 and MMP9.
Together these data implicate mTOR/4E-BP1 hypophosphorylation as a second, more
restricted mechanism of translational control occurring somewhat later in the UPR.
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
3
INTRODUCTION
The majority of all secreted and membrane-bound proteins of higher eukaryotic cells are co-
translationally translocated into the ER lumen, where they are acquire their native conformation
with assistance from ER-resident folding factors, chaperones and enzymes. Unfavorable
conditions (sub-optimal pH, low ATP levels, and hypoxia), high client protein load, or
expression of mutant proteins can perturb ER function and result in the accumulation of unfolded
proteins in the ER lumen. In response to this stress, the unfolded protein response (UPR) is
triggered; a largely cytoprotective signaling pathway that attempts to ease the effects of ER stress
and restore homeostasis to this organelle through both transcriptional and translational programs
(Ron and Walter, 2007). If these protective measures are unsuccessful, apoptotic pathways are
activated to destroy the compromised cells.
The UPR transcriptional program serves in part to up-regulate resident molecular chaperones
and folding enzymes, thereby preventing the aggregation of unfolded proteins and bolstering ER
folding capacity, while the translational program acts to ease the load of new client proteins
entering the organelle by transiently inhibiting protein synthesis. Of note, the decrease in protein
synthesis is not restricted to ER proteins. The loss of cytosolically-translated cell cycle proteins
causes cells to arrest in the G1 phase of cell cycle, ensuring that cells experiencing ER stress are
not replicated (Brewer et al., 1999). The UPR is signaled through three, ER-localized
transmembrane proteins, inositol-requiring enzyme 1 (IRE-1), activating transcription factor 6
(ATF6), and protein kinase RNA (PKR)-like ER kinase (PERK), which collectively monitor
folding conditions in the ER through their luminally oriented domains and signal the downstream
response through their cytosolic domains (reviewed in (Walter and Ron, 2011)). While the
cellular outcomes of ATF6 and IRE1 activation are largely transcriptional, the PERK arm of the
UPR primarily exerts it effects through transient alterations in translation. In response to ER
stress, PERK dimerizes, leading to trans-autophosphorylation (Liu et al., 2000) and
phosphorylation of the α subunit of eukaryotic initiation factor 2 α (eIF2α) at ser51 (Harding et
al., 1999), resulting in a reduction in global protein translation.
However, certain mRNAs, such as ATF4, are preferentially translated under these conditions
by virtue of the structure of their 5’ regions, which contain multiple small interfering ORFs that
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
4
inhibit its translation under non-stress conditions (Harding et al., 2000a). The ATF4
transcriptional target GADD34 together with protein phosphatase 1 (PP1) acts to de-
phosphorylate eIF2α, providing an elegant negative feedback loop and allowing general
translation to resume (Novoa et al., 2001),(Ma and Hendershot, 2003). The beneficial aspects of
this PERK-mediated translational block are demonstrated by studies showing that cultured cells
(Harding et al., 2000b) and endocrine and exocrine pancreas cells (Harding et al., 2001) lacking
PERK are less likely to survive when subjected to ER stress. However, global translation must
resume so that proteins essential for survival and cellular maintenance can be restored and that
mRNAs up-regulated as part of the transcriptional UPR response can be translated. Indeed, cells
expressing a mutant GADD34 that lacks eIF2α phosphatase activity are unable to restore
translation after PERK activation and exhibit decreased viability when compared to control cells
in response to ER stress (Novoa et al., 2003). Thus, accrued experimental evidence suggests that
translation must be balanced carefully to maximize cell viability under ER stress conditions
(Walter and Ron, 2011).
Recent studies have focused on another translational control axis centered on mTOR. 4E-
BP1, a target of mTOR and negative regulator of eIF4F, was found to be a target of the UPR-
induced transcription factor ATF4 (Yamaguchi et al., 2008), and several other studies provide
evidence that ER stress can impact various elements of the mTOR pathway (Ozcan et al., 2004),
(Salazar et al., 2009), (Di et al., 2009), (Qin et al., 2010), and that alterations in the mTOR
pathway can induce ER stress (Ozcan et al., 2008), (Qin et al., 2010) suggesting that translational
control in the UPR is more complicated than previously indicated.
Regulation of the eIF4F complex formation by the 4E-BPs plays a major role in reducing
protein synthesis under conditions of reduced growth factor signaling, nutrient availability, and
ATP levels; largely via decreased signaling through the PI3K and mTOR pathways (Hay and
Sonenberg, 2004). 4E-BP1 is a direct target of mTOR (Hay and Sonenberg, 2004), (Proud,
2004), and as a result decreases in mTOR signaling lead to the accumulation of
hypophosphophorylated 4E-BP1, which in turns results in decreased formation of the eIF4F
complex and reduced cap-dependent translation. While eIF4F is important for the translation of
all cap-dependent translation, a subset of mRNAs have been identified whose translation is
particularly affected by a reduction in eIF4F complex formation (Hay and Sonenberg, 2004). The
characteristics that cause the translation of these various mRNAs to be particularly dependent on
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
5
eIF4F is not fully understood, but include the presence of long, highly structured 5’ untranslated
regions (Pelletier and Sonenberg, 1985), (Gingras et al., 1999), a terminal oligopyramidine tract
immediately adjacent to the 5’ cap (Hsieh et al., 2012), (Thoreen et al., 2012), or a regulatory
element in the 3’UTR that marks certain mRNAs for eIF4E facilitated nuclear export (Culjkovic
et al., 2006). Of note, cyclin D1 transcripts are highly structured and are known to be dependent
on mTOR signaling (De and Graff, 2004). Thus, we designed experiments to more carefully
examine translational control during an ER stress response and determine how reduced signaling
through the mTOR pathway contributes to this.
RESULTS
ER stress induces an early and transient decrease in global translation that is associated with
eIF2α phosphorylation, however not all proteins recover equally. It is well-established that ER
stress-induced phosphorylation of eIF2α results in a decrease in global protein translation, and
that this block is subsequently relieved by the dephosphorylation of eIF2α by the ATF4
transcriptional target, GADD34 (Novoa et al., 2001), (Ma and Hendershot, 2003). To further
investigate ER stress-induced translational changes associated with the UPR, NIH3T3 cells were
pre-treated with the ER stress inducing drug thapsigargin, which inhibits SERCA pumps in the
ER membrane, rapidly depleting its calcium stores and broadly affecting protein folding in this
organelle. At the indicated times after thapsigargin treatment, cells were pulse-labeled with 35S
methionine and cysteine for a short period of time to monitor translation. Cell lysates were
directly examined on SDS-polyacrylamide gels, and as expected the decrease in protein synthesis
at early time points appeared to be global (Fig. 1A). Similar results were obtained with
tunicamycin, although the kinetics of translation inhibition was slower and the magnitude was
not as great (data not shown). With both stresses, the inhibition of translation correlated with the
phosphorylation of eIF2α. After 2 hr, eIF2α phosphorylation decreased (Fig. 1B) and protein
translation began to resume (Fig. 1A). Intriguingly, closer inspection of the autoradiograph
revealed that not all proteins appeared to recover equally. While the majority of proteins were
translated at levels comparable to pre-stressed cells following dephosphorylation of eIF2α (Fig.
1A, indicated with a circle), other proteins were translated at a higher level and correspond to the
size of known ER chaperones that are targets of the response (Fig. 1A, marked with an asterisk).
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
6
Intriguingly, translation of a subset of proteins did not appear to recover to pre-stress levels (Fig.
1A, marked with a diamond). At least one of the proteins that did not recover was the short-lived
cyclin D1 protein, whose translation has been shown to be blocked by eIF2α-dependent
translational repression (Brewer and Diehl, 2000), (Stockwell et al., 2012). Indeed, in our
experiments cyclin D1 protein levels began decreasing within 0.5 hours of thapsigargin treatment
and were undetectable by 2 hours (Fig. 1B). However, even though eIF2α was dephosphorylated
at later time points (Fig. 1B) and general protein translation had resumed, cyclin D1 protein
levels did not recover within the time frame of this experiment (Fig 1B). The sustained loss of
cyclin D1 protein expression was not limited to a single cell line or method of induction of ER
stress. HeLa cells, 293T and NB1691 cells all showed decreases in cyclin D1 protein expression
when they were examined after 16 hours of treatment with either thapsigarin or tunicamycin
(Fig. 1C).
Incomplete recovery from translational repression under chronic ER stress is associated with
4E-BP1 hypophosphorylation.
To further explore translational control during ER stress, we measured global translation rates in
NB1691 cells over a longer time course (Fig. 2A). Once again, we observed an early and
dramatic decrease in protein synthesis when thapsigargin was used. However, even after 24
hours of treatment, total TCA-precipitable counts only recovered to ~80% of pre-stressed levels
(Fig. 2A), even though there was an increase in the synthesis of molecular chaperones (data not
shown) and UPR target genes like CHOP. We investigated the phosphorylation status of both
eIF2α and 4E-BP1 under these longer periods of ER stress. NB1691 cells were treated with
thapsigargin for the indicated times, and cell lysates were subjected to western blotting analysis
(Fig. 2B). As expected, ER stress caused an initial increase in the phosphorylation of eIF2α,
which decreased to basal levels after 2 hours. When the same membrane was blotted for 4E-BP1,
we found that the majority of 4E-BP1 appeared to be hyperphosphorylated (the γ form) in the
absence of ER stress, a state which allows translation to proceed (Fig. 2B). As the thapsigargin
treatment time increased, there was a modest but progressive shift to the hypophosphorylated α
form of 4E-BP1. To extend our findings to other cell types and different methods of ER stress
induction, we also examined phosphorylation of 4E-BP1 protein in HeLa and 293T cells treated
with either thapsigargin or tunicamycin for 16 hours. In both cell lines, the appearance of the
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
7
hypophosphorylated form of 4E-BP1 could be readily observed, although the relative amounts
varied somewhat (Fig. 2C). Of note, we observed an increase in total 4E-BP1 levels in 293T
cells (Fig. 2C) and mouse embryonic fibroblasts (data not shown) similar to previous studies in
pancreatic cells (Yamaguchi et al., 2008) but not in HeLa or NB1691 cells, suggesting that the
up-regulation of this protein during UPR activation may be cell-type specific.
ER stress-induced 4E-BP1 hypophosphorylation results in decreased eIF4F formation and the
loss of translation of eIF4F target mRNAs. To assess whether the changes in the phosphorylation
status of 4E-BP1 observed under ER stress conditions was sufficient to lead to the binding of 4E-
BP1 to eIF4E and a concomitant loss of eIF-4G on capped mRNA, we used 7M-GTP beads, as a
mimetic of the 5’ cap structure, in a pull down assay. The binding of 4E-BP1 and eIF4G was
determined, and as both bind to eIF4E, blotting for this protein served as a control. NB1691 cells
were treated with either tunicamcyin or thapsigargin for 16 and 24 hours or left untreated (Fig.
3A). Lysates were incubated with 7M-GTP beads and bound proteins were detected by western
blotting for eIF4E, eIF4G and 4E-BP1 (Fig. 3A). While the amount of eIF4E bound to the 7M-
GTP beads was comparable between all groups, there was an increase in 4E-BP1 bound to the
7M-GTP beads with either ER stress inducing drug (consistent with decreased cap-dependent
translation), which corresponded to a reciprocal decrease in the binding of eIF4G (Fig. 3A).
These results indicate that the ER stress-induced reduction in 4E-BP1 phosphorylation is likely
to be functionally significant.
We next examined the steady state levels of several proteins, known to be sensitive to eIF4F
loss, over a time course of thapsigargin treatment spanning 24 hours. NB1691 cells were treated
with this ER stress inducing agent for the indicated time points, and subjected to western blot
analyses. As expected, the short-lived cyclin D1 protein levels decreased at the earliest time
points examined (Fig. 3B), which is consistent with its loss being due to the eIF-2α mediated
translational block (Brewer and Diehl, 2000) and remained undetectable even after global
translation had been restored. We next examined the expression of Bcl-2, which is normally a
rather long-lived protein (Merino et al., 1994) but is known to be sensitive to eIF4 levels
(reviewed in (Graff and Zimmer, 2003)). Somewhat unexpectedly, Bcl-2 levels decreased in
NB1691 cells as early as 2 hours of thapsigargin treatment and remained lower throughout the
time course. Although Bcl-2 has been shown to have a half-life of between 10 and 20 hours
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
8
depending on the cell type (Beck et al., 2002), (Gao and Dou, 2000), (Brunelle et al., 2009),
there are reports of certain stresses like glutathione depletion (Celli et al., 1998) or alterations in
the level of the pro-apoptotic protein Bim (Jorgensen et al., 2007) significantly decreasing its
stability. We also examined MMP9 expression after ER stress, which is also known to be
dependent on eIF4F levels (De and Graff, 2004). Unlike the two previous proteins examined, it is
a secreted protein, so its loss from the cell is a combination of changes in the rate of both
translation and transport through the cell. Correspondingly levels of this protein did not decrease
noticeably until after 16 hours of thapsigargin treatment (Fig. 3B). Although we tried several
antibodies, we were unable to find one that worked for immunoprecipitation assays to more
directly monitor synthesis (data not shown). While these more eIF4F-dependent proteins showed
a dramatic reduction in expression, there was a significant induction of the UPR target CHOP
(Fig. 3B), arguing that only a subset of targets are affected in keeping with the data in Fig. 1A.
To ensure that the reduced expression of these proteins was the result of decreased biosynthesis
not reduced levels of transcripts available for translation we performed real-time PCR analyses
(Fig. 3C). Indeed, within the time frame of our experiments we did not observe any significant
changes in mRNA transcript levels for any of the proteins examined in Fig. 3B. These data
indicate that the UPR can induce not only the global translational changes that are mediated by
the phosphorylation status of eIF2α, but can also induce more subtle translational changes that
affect at least some eIF4F-sensitive mRNAs.
ER stress treatment results in a decrease in mTOR signaling and growth factor receptor
maturation. One of the best-characterized 4E-BP1 kinases is mammalian Target of Rapamycin
(mTOR), and several groups have reported ER stress induced perturbations in signaling upstream
of mTOR (Ozcan et al., 2004), (Salazar et al., 2009), (Di et al., 2009),(Qin et al., 2010). We
therefore examined mTOR activation status in response to tunicamycin- and thapsigargin-
induced ER stress. Phosphorylation of mTOR at Ser2448, indicative of activation, was very
modestly reduced after 6 hours of thapsigargin treatment, and was further reduced at 16 and 24
hours with both ER stress-inducing drugs (Fig 4A). The different kinetics of the phosphorylation
changes induced by these two pharmacological agents is likely to reflect differences in their
mechanisms of action, which result in thapsigargin inducing an earlier UPR than tunicamycin.
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
9
Next, we monitored effects of UPR activation on the phosphorylation of 4E-BP1, an mTOR
target and include treatment with rapamycin, a well-characterized mTOR inhibitor, for
comparison. We observed a shift from the hyperphosphorylated to less modified forms of 4E-
BP1 after longer times of treatment with both of these UPR inducers, which was similar to what
was observed with rapamycin or even slightly greater in the case of tunicamycin (Fig. 4B). As
the effects on 4E-BP1 even with rapamycin treatment were not particularly dramatic in this line,
we examined a second line. Rh30 cells were treated with rapamycin and tunicamycin, and
effects on 4E-BP1 isoforms were monitored. In this line we observed a more dramatic effect on
4E-BP1 phosphorylation with rapamycin treatment and again observed a similar decrease in the
tunicamycin-treated cells (Fig. 4C). We also performed the 7M-GTP bead binding assay as a
functional measure of cap binding and included varying concentrations of low glucose, as a more
slow acting but also more physiological inducer of the UPR (Fig. 4D). Concentrations of
glucose as high as 6.25 mM were sufficient to both induce the UPR and lead to
hypophosphorylation as levels comparable to rapamycin, whereas neither thapsigargin or
tunicamycin treatment induced hypophosphorylation of 4E-BP1 at the shorter time point used,
even though it was sufficient to activate the UPR, in keeping with data obtained with the
NB1691 cells (Fig. 4A).
To determine how the UPR was affecting mTOR activation, we first examined the PI3K
pathway. We began with the receptor tyrosine kinases (RTK), which are the most up-stream
components of this signaling pathway and are synthesized in the ER and transported to the cell
surface after proper maturation. We reasoned that it was conceivable that ER stress could
interfere with their maturation and thus result in loss of signaling through these receptors.
NB1691 cells were treated with tunicamycin or thapsigargin for the indicated times and
monitored two well-characterized RTK proteins that signal through this pathway. We found that
treatment with the glycosylation inhibitor tunicamcyin resulted in the appearance of an
unglycosylated form and a decrease in mature levels of the beta subunit of both the insulin
receptor (IRβ) (Fig. 5A) and the insulin-like growth factor 1 receptor (IGF1Rβ) (Fig. 5B) as
early as 16 hrs of treatment, which was even more dramatic after 24 hrs. When cells were treated
with thapsigargin, we found that the maturation IRβ was largely unaffected at all treatment
times. Very modest decreases in mature levels of IGF1Rβ were observed after 16 hrs and
became more significant at 24 hours, but were still less dramatic than observed with
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
10
tunicamycin. As RTKs are glycoproteins, it is likely that the loss of glycosylation that occurs
with tunicamycin treatment has greater effects on their maturation than the loss of calcium from
the ER that results with thapsigargin treatment.
ER stress activators do not uniformly inhibit PI3K/Akt pathway signaling in NB1691 cells. To
more globally monitor growth factor receptor signaling, we examined the activation of Akt,
which is downstream of a large number of the RTK, and because changes in Akt activity have
been shown to occur by a variety of mechanisms (Ozcan et al., 2004),(Salazar et al., 2009).
Western blots were performed using antibodies specific for phosphorylated Akt (Thr473), a
residue known to be important for full activation of Akt and its downstream signaling (Sarbassov
et al., 2005). In keeping with two previous studies (Ozcan et al., 2004), (Qin et al., 2010), we
found that tunicamycin induced an observable decrease in phosphorylated Akt after 16 hours of
treatment and much greater decrease after 24 hours of treatment (Fig. 6A), suggesting that the
maturation of many RTKs are likely to be affected by tunicamycin in keeping with the fact that
they are glycoproteins. Thapsigargin had little effect at any time point on Akt activation in these
cells (Fig. 6A), which indicates that similar to IR-β (Fig. 5A) changes in ER calcium levels do
not adversely effect the maturation of the RTKs. Activated Akt phosphorylates TSC2, a negative
regulator of mTOR at Thr1462 (Manning et al., 2002), resulting in an inhibition of TSC2’s
suppressive affect on mTOR (Inoki et al., 2002). Therefore, we next examined the
phosphorylation of TSC2 at the Akt-specific residue Thr1462. We found a very modest decrease
in its phosphorylation, but only in response to tunicamycin treatment, which is in keeping with
our finding that tunicamycin but not thapsigargin diminished Akt activation (Fig. 6A).
Our finding that thapsigargin was equally effective as tunicamycin in reducing 4E-BP1
phosphorylation led us to examine other proteins that impinge on the mTOR/4E-BP1 axis.
mTOR activity can also be negatively regulated by phosphorylated AMP-activated protein
kinase (AMPK) (Hardie et al., 2012), which was recently shown to be activated in response to
some ER stress conditions (Pereira et al., 2010). To examine the possible involvement of this
kinase in the reduced mTOR signaling observed with longer treatments with ER stressors,
NB1691 cells were treated with tunicamycin and thapsigargin for the indicated times and the
proteins were assessed via western blot analyses. Thapisgargin treatment resulted in an increase
in AMPK phosphorylation at Thr172 with 6 hours of treatment, and was sustained through 16
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
11
and 24 hours (Fig. 6B). In keeping with the somewhat slower kinetics of UPR activation by
tunicamycin, there was no observable increase in Thr172 phosphorylation at 6 hr, but after 16
and 24 hrs there was a significant increase in Thr172 phosphorylation. To further explore the
significance of this activation to mTOR signaling, we examined the phosphorylation of the
AMPK target TSC2 at Ser1387, which enhances the inhibitory effects of TSC on mTOR (Huang
and Manning, 2008),(Inoki et al., 2003). After 24 hours of treatment with either stressor,
phosphorylation of TSC2 at this residue was increased above control levels (Fig. 6B), indicating
that the observed ER stress-induced AMPK phosphorylation contributes to inhibitory TSC
signaling and thus likely to the decrease in mTOR phosphorylation observed in Fig. 4A.
DISCUSSION
The ability of cells to modify translation in response to both intracellular cues and
extracellular conditions is critical to cell survival, especially under conditions of stress. It is well
established that mammalian cells experiencing ER stress can induce a transient and global block
in translation via phosphorylation of eIF2α, which is achieved by the activation of the ER
transmembrane protein PERK (Harding et al., 1999). We have examined a second mechanism by
which cells experiencing ER stress can fine-tune their translational programs. We found that
translation rates after dephosphorylation of eIF-2α only returned to approximately 80% of that
occurring before thapsigargin-induced stress. Based on the inspection of proteins synthesized
after a short metabolic pulse-labeling, this did not appear to represent a general decrease in the
translational capacity of the post-stressed cells, but instead seemed to be due to changes in the
expression of a specific subset of proteins. The continued translational repression of this group of
proteins correlated with increased hypophosphorylation of 4E-BP1 leading to its increased
binding to eIF4E, which would interfere with the formation of the eIF4F complex at the mRNA
cap. Indeed, we found that the expression of several proteins known to be sensitive to eIF4F
availability were decreased after longer periods of ER stress, including cyclin D1, Bcl-2 and
MMP-9. These data are in keeping with a previous study demonstrating that deletion of 4E-BP1
was required to allow translation to be fully restored after ER stress (Yamaguchi et al., 2008).
There is a growing body of literature describing interactions or crosstalk between the mTOR
pathway and the UPR. Several studies have demonstrated a decrease in Akt signaling in response
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
12
to ER stress leading to reduced mTOR activity. In one case the UPR was induced in human
glioma cells by Δ9-Tetrahydrocannabinol (THC) leading to a CHOP-dependent induction of the
tribbles homologue 3,TRB3, which inhibited Akt and as a result mTOR (Salazar et al., 2009).
Alternatively, another study using Fao liver cells found that Ire1-dependent activation of JNK led
to phosphorylation of insulin receptor substrate 1, IRS-1, which reduced insulin receptor
signaling and activation of Akt (Ozcan et al., 2004). Of note, the decrease in Akt activity in this
and another study (Qin et al., 2010) occurred with both tunicamycin and thapsigargin, suggesting
that our failure to observe decreases in Akt activation with thapsigargin might be somewhat cell
type specific. Our study does suggest that the proper maturation of RTKs, which are glycosylated
on multiple residues, are more adversely affected by some forms of ER stress, like tunicamycin
and likely the more physiological UPR activator, low glucose. These data provide yet another
method for reduced Akt activity during UPR activation and furthermore highlight the often
overlooked fact that the agents used to induce ER stress have cellular effect that lie outside the
signaling pathways that comprise the UPR.
In addition to reduced signaling through Akt, activation of the Tsc1/2 complex represents
another mechanism of inhibiting mTOR. A recent study demonstrated LPS-induced
differentiation of mouse splenic B cells led to a reduction in mTOR activity, which could be
inhibited by genetic ablation of TSC1 (Goldfinger et al., 2011). Importantly, terminal plasma cell
differentiation relies on the activation of a partial UPR (Iwakoshi et al., 2003), (Shaffer et al.,
2004), arguing for a link between the UPR and TSC1/2 regulation of mTOR. Under conditions
of decreased availability of energy, AMP kinase (AMPK) is activated (Hardie et al., 2012),
leading to phosphorylation of TSC2 on Ser1387. This modification inhibits the Rheb protein,
which is another positive regulator of mTOR (Laplante and Sabatini, 2012). We found that
induction of ER stress with either tunicamycin or thapsigargin resulted in the phosphorylation of
both AMPK itself and the residue of TSC2 known to be phosphorylated by AMPK. However,
another study saw no evidence of AMPK activation by tunicamycin in mouse embryonic
fibroblasts (Qin et al., 2010), again suggesting that the mechanisms for inhibiting mTOR activity
during ER stress might vary by both the stressor used and the type of cells examined. In an
attempt to more directly demonstrate that AMPK was the critical culprit, we used the AMPK
inhibitor Compound C. However the combination of this inhibitor with either tunicamycin or
thapsigargin proved to be toxic to our cells (data not shown) preventing us from making this
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
13
point. Interestingly, recent data show reciprocally that mTOR activity can promote ER stress.
Two separate studies (Ozcan et al., 2008),(Qin et al., 2010), revealed that hyperactivation of
mTOR due to loss of Tsc2 led to UPR activation, likely due to increased protein synthesis in the
ER. In both cases, UPR activation was accompanied by decreased Akt activity, establishing this
aspect of the UPR as a feed back loop to control mTOR activity.
The reduced activity of mTOR during ER stress leads to hypophosphorylation of 4E-BP1,
which we and others (Yamaguchi et al., 2008) show reduces the ability of eIF-4G to bind to 7mGTP beads as a mimetic of the binding of the eIF-4F complex binding to the mRNA cap.
Although not examined here, a number of proteins like c-myc, ornithine decarboxylase and
fibroblast growth factor 2 are known to be particularly dependent on eIF4F levels and can be
loosely categorized as “pro-growth” proteins (Graff and Zimmer, 2003), (Mamane et al., 2004)
and are not translated when mTOR is inhibited with rapamycin in a 4E-BP1-dependent manner
(Dowling et al., 2010). Therefore, it is plausible to suggest that the ER stress induced decrease in
4E-BP1 phosphorylation could be a mechanism by which cells limit cell division and growth
during stressful conditions, while at the same time allowing them to continue to produce proteins
that maintain cellular fitness. In this way, cellular growth and division would be limited while
still allowing for the translation of UPR transcriptional targets and those mRNAs required for
cellular maintenance. Indeed, the well-characterized arrest of cells experiencing ER stress in the
G1 phase of cell cycle was shown to be due to loss of cyclin D1 protein, even though D1
transcript levels were not altered (Brewer et al., 1999). This was consequently linked to PERK-
dependent eIF-2α phosphorylation (Brewer and Diehl, 2000), which rapidly led to the depletion
of this very short lived protein. The data presented here are consistent with the PERK/eIF-2α
axis playing an early role in suppressing cyclin D1 biosynthesis, but further reveal that once most
translation has resumed D1 protein remains very low, even though the transcripts are still
present, which is likely regulated by the eIF4 axis of translational control.
On the other hand, a number of pro-survival proteins are also among those that are
significantly dependent on eIF4F levels, including Bcl2 and survivin (Konicek et al., 2008). The
balance between cytoprotective and cytodestructive aspects of the UPR is quite complex and the
timing varies by cell type and cellular conditions (Tabas and Ron, 2011). Indeed, decreases in
Bcl2 mRNA levels can occur downstream of the CHOP transcription factor (McCullough et al.,
2001). However, within the time frame of our experiments Bcl2 transcript levels were not
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
14
diminished and in fact were very slightly increased by tunicamycin treatment. It is well
established that many of these proteins, including MMP9, are critical for tumor growth and/or
metastasis, and a growing number of studies have documented UPR activation in a variety of
tumor types leading investigators to suggest it could be a target for therapeutic intervention
(reviewed in (Wang and Kaufman, 2012), (Li et al., 2011), (Healy et al., 2009)). This would
suggest that the loss of these proteins in tumors experiencing ER stress would be
counterproductive to tumor growth and survival. Thus it is noteworthy that eIF4E, the rate-
limiting step in cap-dependent translation, and the target of hypophosphorylated 4E-BP1, is often
up-regulated in tumors and is considered to be essential for their survival (De and Graff, 2004).
Here, we have examined a second node of translational control in the UPR, centered around
4E-BP1, which exerts its effects after eIF-2α-mediated translation inhibition. In our model, we
observed that translation of eIF4F-sensitive proteins do not recover from the eIF2α-induced
translational block upon eIF2α dephosphorylation. Instead, translation of these proteins remains
repressed, which is likely due to the UPR-induced negative regulation of the mTOR pathway and
the resulting hypophosphorylation of the eIF4F repressor, 4E-BP1. This repression appears to be
achieved in our cells, at least in part, via UPR-induced AMPK activation; a negative regulator of
the mTOR pathway and reduction in signaling through the PI3K/AKT pathway. Unlike the more
global inhibition of protein synthesis mediated by eIF-2α, the translational targets of this
secondary node appear to be restricted to a sub-group of proteins that are potent activators of
growth and survival.
MATERIALS AND METHODS
Cell Culture - NIH3T3, HeLa and 293T cells were cultured in DMEM supplemented with 10%
heat inactivated fetal bovine serum, 2 mM glutamine and 1% antibiotic-antimycotic at 37°C in a
5% CO2 incubator. NB1691 neuroblastoma and Rh30 rhabdomyosarcoma human cell lines were
cultured in RPMI 1640 supplemented with 10% fetal bovine serum and 2 mM glutamine. Cells
were plated and left untreated (control) or treated with thapsigargin (2 μM, Sigma-Aldrich, St.
Louis, MO, USA), tunicamycin (2.5 μg/ml, Sigma-Aldrich, St. Louis, MO, USA) for the
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
15
indicated times, or rapamycin (100 nM, 4 hours).
Metabolic labeling - Following indicated experimental treatments, cells were washed with
phosphate buffered saline and then pulsed for 5 minutes in methionine- and cysteine-free DMEM
labeling medium containing 10% dialyzed FBS and 100 μCi 35S-methionine and cysteine (35S-
TransLabel; MP Biomedicals, Santa Ana, CA, USA). Cells were lysed in CHAPS lysing buffer
(pH 7.4 (40 mM HEPES, 120 mM NaCl, 1 mM EDTA, 10 mM sodium pyrophosphate, 10 mM
sodium ß-glycerophosphate, 50 mM NaF, 1.5 mM Na3VO4, 0.3% CHAPS), sonicated and
centrifuged at 12,000rpm for 10 min at 4°C to remove nuclei and cellular debris. Total protein
was quantified by Bradford assay (BIO-RAD, Hercules, CA, USA), and samples were equalized
for total protein. For experiments were the translation of individual proteins was to be studied,
lysates were analyzed by SDS-PAGE and radiographic signals were visualized by incubating gel
with Amplify (GE Healthcare, Fairfield, CT, USA) and exposing gel to x-ray film. For
experiments where total incorporation of radiolabeled amino acids was quantified, 2 μl of each
lysate was spotted onto filter paper squares, allowed to dry, and then precipitated by boiling in
10% TCA for 10 minutes, followed by water, ethanol, and acetone rinses. Dry filters were then
subjected to scintillation counting. Counts were normalized to protein quantity and counts
calculated as a percentage of control.
7methyl-GTP bead pull down - Following indicated experimental treatments, cells were lysed in
CHAPS lysing buffer, supplemented with complete protease inhibitor tablet (Roche, Pleasanton,
CA, USA) and PhoSTOP phosphatase inhibitor tablet (Roche, Pleasanton, CA, USA). Lysates
were sonicated, clarified by centrifugation at 14,000 rpm for 10 minutes at 4°C, and protein
content was quantified. The 7methyl-GTP bead binding assay was performed as previously
described (Inoki et al., 2003). Briefly, lysates were diluted in CHAPS buffer to a concentration
of 20ug total protein in a total volume of 170μl. 30 μl of a 33% slurry of 7methyl-GTP
conjugated Sepharose beads (GE Healthcare, Fairfield, CT, USA) was added to the diluted
lysates. The mixture was rotated for 2 hours at 4°C. Following this incubation, Sepharose bead
pellets were washed 3 times with 500 μl of washing buffer (pH 7.5 (50mM HEPES, 150 mM
NaCl). Bound proteins were eluted with 20 μl Laemmli loading buffer and boiled, after which
samples were analyzed by SDS-PAGE and western blotting.
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
16
Western blotting - For whole cell western blotting, lysates were diluted to achieve equal protein
concentrations and subjected to SDS-PAGE and western blotting. Antibodies used to detect
specific proteins for Western blots were as follows: phospho-eIF2α (S51), Akt (total), phospho-
Akt (S473), AMPKα (total), phospho-AMPK (T172), Bcl-2, eIF4E, eIF4G, 4E-BP1 (total),
IGF1 receptor β, Insulin receptor β, mTOR (total), phospho-mTOR (S2448), phospho-TSC2
(S1387), phospho-TSC2 (T1462) antibodies all from Cell Signaling Technology (Danvers, MA,
USA); β-actin antibody from Sigma-Aldrich (St. Louis, MO, USA); MMP antibody from
Millipore (Billerica, MA, USA) and cyclin D1 was from Santa Cruz Biotechnology (Dallas,
Texas, USA). Blots were incubated with the appropriate HRP-conjugated secondary antibody,
and proteins were visualized using the Pierce enhanced chemiluminescent substrate (Thermo
Scientific; Waltham, MA, USA).
mRNA Quantification by qRT-PCR - Total RNA was extracted using the RNeasy Qiagen mini-
prep kit according to the manufacturer's protocol. cDNA was produced using 1μg total RNA and
reverse transcriptase reactions were performed using a high capacity cDNA reverse transcription
kit (Applied Biosystems, Carlsbad, CA, USA). Amplification of the indicated genes was carried
out using Power SYBR Green PCR Master Mix (Applied Biosystems, Carlsbad, CA, USA) with
specific primers (Bcl2 acggggtgaactgggggagga, tccacaaaggcatcccagcctc; MMP-9
agccgggacgcagacatcgt, ttggaaccacgacgcccttgc; cyclin D1 caagtgtgacccggactgcctc,
cgccctcagatgtccacgtcc) and measured continuously using an ABI 7900 HTI Detection System.
The value for untreated cells was set to 1, and the value for the various treatments was presented
as a fraction of this number.
ACKNOWLEDGEMENTS
This work was supported by NIH Grant P01CA023099 (LMH), the Cancer Center CORE Grant
CA21765, and the American Lebanese Syrian Associated Charities of St. Jude Children's Research
Hospital.
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
17
REFERENCES
1. Beck, M. T., Peirce, S. K. and Chen, W. Y. (2002). Regulation of bcl-2 gene expression in human breast cancer cells by prolactin and its antagonist, hPRL-G129R.
Oncogene 21, 5047-5055.
2. Brewer, J. W. and Diehl, J. A. (2000). PERK mediates cell-cycle exit during the mammalian unfolded protein response. Proc. Natl. Acad. Sci. U. S. A 97, 12625-12630.
3. Brewer, J. W., Hendershot, L. M., Sherr, C. J. and Diehl, J. A. (1999). Mammalian unfolded protein response inhibits cyclin D1 translation and cell-cycle
progression. Proc. Natl. Acad. Sci. U. S. A 96, 8505-8510.
4. Brunelle, J. K., Ryan, J., Yecies, D., Opferman, J. T. and Letai, A. (2009). MCL-1-dependent leukemia cells are more sensitive to chemotherapy than BCL-2-
dependent counterparts. J. Cell Biol. 187, 429-442.
5. Celli, A., Que, F. G., Gores, G. J. and LaRusso, N. F. (1998). Glutathione depletion is associated with decreased Bcl-2 expression and increased apoptosis in
cholangiocytes. Am. J. Physiol 275, G749-G757.
6. Culjkovic, B., Topisirovic, I., Skrabanek, L., Ruiz-Gutierrez, M. and Borden, K. L. (2006). eIF4E is a central node of an RNA regulon that governs cellular
proliferation. J. Cell Biol. 175, 415-426.
7. De, B. A. and Graff, J. R. (2004). eIF-4E expression and its role in malignancies and metastases. Oncogene 23, 3189-3199.
8. Di, N. A., Kramvis, I., Cho, N., Sadowski, A., Meikle, L., Kwiatkowski, D. J. and Sahin, M. (2009). Tuberous sclerosis complex activity is required to control neuronal stress responses in an mTOR-dependent manner. J. Neurosci. 29, 5926-5937.
9. Dowling, R. J., Topisirovic, I., Alain, T., Bidinosti, M., Fonseca, B. D., Petroulakis, E., Wang, X., Larsson, O., Selvaraj, A., Liu, Y. et al. (2010). mTORC1-mediated
cell proliferation, but not cell growth, controlled by the 4E-BPs. Science 328, 1172-1176.
10. Gao, G. and Dou, Q. P. (2000). G(1) phase-dependent expression of bcl-2 mRNA and protein correlates with chemoresistance of human cancer cells. Mol. Pharmacol.
58, 1001-1010.
11. Gingras, A. C., Raught, B. and Sonenberg, N. (1999). eIF4 initiation factors: effectors of mRNA recruitment to ribosomes and regulators of translation. Annu. Rev.
Biochem. 68, 913-963.
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
18
12. Goldfinger, M., Shmuel, M., Benhamron, S. and Tirosh, B. (2011). Protein synthesis in plasma cells is regulated by crosstalk between endoplasmic reticulum stress and
mTOR signaling. Eur. J. Immunol. 41, 491-502.
13. Graff, J. R. and Zimmer, S. G. (2003). Translational control and metastatic progression: enhanced activity of the mRNA cap-binding protein eIF-4E selectively enhances
translation of metastasis-related mRNAs. Clin. Exp. Metastasis 20, 265-273.
14. Hardie, D. G., Ross, F. A. and Hawley, S. A. (2012). AMPK: a nutrient and energy sensor that maintains energy homeostasis. Nat. Rev. Mol. Cell Biol. 13, 251-262.
15. Harding, H. P., Novoa, I., Zhang, Y., Zeng, H., Wek, R., Schapira, M. and Ron, D. (2000a). Regulated translation initiation controls stress-induced gene expression
in mammalian cells. Mol. Cell 6, 1099-1108.
16. Harding, H. P., Zeng, H., Zhang, Y., Jungries, R., Chung, P., Plesken, H., Sabatini, D. D. and Ron, D. (2001). Diabetes mellitus and exocrine pancreatic dysfunction in perk-/- mice reveals a role for translational control in secretory cell survival. Mol.
Cell 7, 1153-1163.
17. Harding, H. P., Zhang, Y., Bertolotti, A., Zeng, H. and Ron, D. (2000b). Perk is essential for translational regulation and cell survival during the unfolded protein response.
Mol. Cell 5, 897-904.
18. Harding, H. P., Zhang, Y. and Ron, D. (1999). Protein translation and folding are coupled by an endoplasmic-reticulum-resident kinase. Nature 397, 271-274.
19. Hay, N. and Sonenberg, N. (2004). Upstream and downstream of mTOR. Genes Dev. 18, 1926-1945.
20. Healy, S. J., Gorman, A. M., Mousavi-Shafaei, P., Gupta, S. and Samali, A. (2009). Targeting the endoplasmic reticulum-stress response as an anticancer strategy.
Eur. J. Pharmacol. 625, 234-246.
21. Hsieh, A. C., Liu, Y., Edlind, M. P., Ingolia, N. T., Janes, M. R., Sher, A., Shi, E. Y., Stumpf, C. R., Christensen, C., Bonham, M. J. et al. (2012). The translational
landscape of mTOR signalling steers cancer initiation and metastasis. Nature 485, 55-61.
22. Huang, J. and Manning, B. D. (2008). The TSC1-TSC2 complex: a molecular switchboard controlling cell growth. Biochem. J. 412, 179-190.
23. Inoki, K., Li, Y., Zhu, T., Wu, J. and Guan, K. L. (2002). TSC2 is phosphorylated and inhibited by Akt and suppresses mTOR signalling. Nat. Cell Biol. 4, 648-657.
24. Inoki, K., Zhu, T. and Guan, K. L. (2003). TSC2 mediates cellular energy response to control cell growth and survival. Cell 115, 577-590.
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
19
25. Iwakoshi, N. N., Lee, A. H. and Glimcher, L. H. (2003). The X-box binding protein-1 transcription factor is required for plasma cell differentiation and the unfolded
protein response. Immunol. Rev. 194, 29-38.
26. Jorgensen, T. N., McKee, A., Wang, M., Kushnir, E., White, J., Refaeli, Y., Kappler, J. W. and Marrack, P. (2007). Bim and Bcl-2 mutually affect the expression of the
other in T cells. J. Immunol. 179, 3417-3424.
27. Konicek, B. W., Dumstorf, C. A. and Graff, J. R. (2008). Targeting the eIF4F translation initiation complex for cancer therapy. Cell Cycle 7, 2466-2471.
28. Laplante, M. and Sabatini, D. M. (2012). mTOR signaling in growth control and disease. Cell 149, 274-293.
29. Li, X., Zhang, K. and Li, Z. (2011). Unfolded protein response in cancer: the physician's perspective. J. Hematol. Oncol. 4, 8.
30. Liu, C. Y., Schroder, M. and Kaufman, R. J. (2000). Ligand-independent dimerization activates the stress-response kinases IRE1 and PERK in the lumen of the
endoplasmic reticulum. J. Biol. Chem.
31. Ma, Y. and Hendershot, L. M. (2003). Delineation of the negative feedback regulatory loop that controls protein translation during ER stress. J. Biol. Chem. 278, 34864-
34873.
32. Mamane, Y., Petroulakis, E., Rong, L., Yoshida, K., Ler, L. W. and Sonenberg, N. (2004). eIF4E--from translation to transformation. Oncogene 23, 3172-3179.
33. Manning, B. D., Tee, A. R., Logsdon, M. N., Blenis, J. and Cantley, L. C. (2002). Identification of the tuberous sclerosis complex-2 tumor suppressor gene product
tuberin as a target of the phosphoinositide 3-kinase/akt pathway. Mol. Cell 10, 151-162.
34. McCullough, K. D., Martindale, J. L., Klotz, L. O., Aw, T. Y. and Holbrook, N. J. (2001). Gadd153 sensitizes cells to endoplasmic reticulum stress by down-
regulating Bcl2 and perturbing the cellular redox state. Mol. Cell Biol. 21, 1249-1259.
35. Merino, R., Ding, L., Veis, D. J., Korsmeyer, S. J. and Nunez, G. (1994). Developmental regulation of the Bcl-2 protein and susceptibility to cell death in B lymphocytes.
EMBO J. 13, 683-691.
36. Novoa, I., Zeng, H., Harding, H. P. and Ron, D. (2001). Feedback inhibition of the unfolded protein response by GADD34-mediated dephosphorylation of
eIF2alpha. J. Cell Biol. 153, 1011-1022.
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
20
37. Novoa, I., Zhang, Y., Zeng, H., Jungreis, R., Harding, H. P. and Ron, D. (2003). Stress-induced gene expression requires programmed recovery from translational
repression. EMBO J. 22, 1180-1187.
38. Ozcan, U., Cao, Q., Yilmaz, E., Lee, A. H., Iwakoshi, N. N., Ozdelen, E., Tuncman, G., Gorgun, C., Glimcher, L. H. and Hotamisligil, G. S. (2004). Endoplasmic
reticulum stress links obesity, insulin action, and type 2 diabetes. Science 306, 457-461.
39. Ozcan, U., Ozcan, L., Yilmaz, E., Duvel, K., Sahin, M., Manning, B. D. and Hotamisligil, G. S. (2008). Loss of the tuberous sclerosis complex tumor
suppressors triggers the unfolded protein response to regulate insulin signaling and apoptosis. Mol. Cell 29, 541-551.
40. Pelletier, J. and Sonenberg, N. (1985). Insertion mutagenesis to increase secondary structure within the 5' noncoding region of a eukaryotic mRNA reduces
translational efficiency. Cell 40, 515-526.
41. Pereira, E. R., Liao, N., Neale, G. A. and Hendershot, L. M. (2010). Transcriptional and post-transcriptional regulation of proangiogenic factors by the unfolded protein
response. PLoS. ONE. 5.
42. Proud, C. G. (2004). mTOR-mediated regulation of translation factors by amino acids. Biochem. Biophys. Res. Commun. 313, 429-436.
43. Qin, L., Wang, Z., Tao, L. and Wang, Y. (2010). ER stress negatively regulates AKT/TSC/mTOR pathway to enhance autophagy. Autophagy. 6, 239-247.
44. Ron, D. and Walter, P. (2007). Signal integration in the endoplasmic reticulum unfolded protein response. Nat. Rev. Mol. Cell Biol. 8, 519-529.
45. Salazar, M., Carracedo, A., Salanueva, I. J., Hernandez-Tiedra, S., Lorente, M., Egia, A., Vazquez, P., Blazquez, C., Torres, S., Garcia, S. et al. (2009). Cannabinoid action induces autophagy-mediated cell death through stimulation of ER stress in
human glioma cells. J. Clin. Invest 119, 1359-1372.
46. Sarbassov, D. D., Guertin, D. A., Ali, S. M. and Sabatini, D. M. (2005). Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science 307, 1098-
1101.
47. Shaffer, A. L., Shapiro-Shelef, M., Iwakoshi, N. N., Lee, A. H., Qian, S. B., Zhao, H., Yu, X., Yang, L., Tan, B. K., Rosenwald, A. et al. (2004). XBP1, downstream of Blimp-1, expands the secretory apparatus and other organelles, and increases
protein synthesis in plasma cell differentiation. Immunity. 21, 81-93.
48. Stockwell, S. R., Platt, G., Barrie, S. E., Zoumpoulidou, G., Te Poele, R. H., Aherne, G. W., Wilson, S. C., Sheldrake, P., McDonald, E., Venet, M. et al. (2012).
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
21
Mechanism-based screen for G1/S checkpoint activators identifies a selective activator of EIF2AK3/PERK signalling. PLoS. ONE. 7, e28568.
49. Tabas, I. and Ron, D. (2011). Integrating the mechanisms of apoptosis induced by endoplasmic reticulum stress. Nat. Cell Biol. 13, 184-190.
50. Thoreen, C. C., Chantranupong, L., Keys, H. R., Wang, T., Gray, N. S. and Sabatini, D. M. (2012). A unifying model for mTORC1-mediated regulation of mRNA
translation. Nature 485, 109-113.
51. Walter, P. and Ron, D. (2011). The unfolded protein response: from stress pathway to homeostatic regulation. Science 334, 1081-1086.
52. Wang, S. and Kaufman, R. J. (2012). The impact of the unfolded protein response on human disease. J. Cell Biol. 197, 857-867.
53. Yamaguchi, S., Ishihara, H., Yamada, T., Tamura, A., Usui, M., Tominaga, R., Munakata, Y., Satake, C., Katagiri, H., Tashiro, F. et al. (2008). ATF4-
mediated induction of 4E-BP1 contributes to pancreatic beta cell survival under endoplasmic reticulum stress. Cell Metab 7, 269-276.
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
22
FIGURE LEGENDS Figure 1. Not all proteins recover equally from the early and transient block in protein translation induced by ER stress. A. NIH3T3 cells were treated with thapsigargin (Tg) for the indicated times. Cells were pulse-labeled with 35S labeled methionine and cysteine during the last five minutes of treatment. Lysates were prepared, equalized by protein concentration and analyzed by SDS-PAGE. Coomassie Blue staining serves as a loading control (upper panel), and 35S signal was detected by audioradiography (lower panel). Examples of stress-induced changes in levels of various proteins are indicated with symbols. Diamond (♦) indicates several proteins whose translation rate is less than pre-stressed levels at later time points, whereas asterisk (*) indicates several proteins that are synthesized above pre-stressed levels, and circle (•) indicates several proteins whose levels appear to return to pre-stressed levels. B. NB1691 cells were treated with Tg for the indicated times, lysates were prepared and analysed by SDS-PAGE followed by immunoblotting with phospho-eIF2α (Ser 51), cyclin D1 and beta-actin, as indicated. C. HeLa and 293T cells were treated with Tg and Tunicamycin (Tm) for 16 hours, lysates were prepared and subjected to SDS-PAGE followed by immunoblotting with cyclin D1 and beta-actin antibodies.
Figure 2. Incomplete translational recovery with prolonger ER stress is associated with 4E-BP1 hypophosphorylation. A. NB1691 cells were treated with Tg for the time periods indicated and cells were incubated with 35S labeled methionine and cysteine during the last five minutes of treatment. Lysates were prepared and equal amounts of total protein was spotted and dried onto filter paper. The radioactive signal was quantitated using a scintillation counter and expressed in graphical form as percentage of protein synthesis remaining. The short heavy bar indicates the time of maximal eIF2α phosphorylation, whereas the thin bar represents decreased translation rate after eIF2α phosphorylation returns to pre-stressed levels. B. NB1691 cells were treated with Tg for the indicated times. Lysates were analysed by SDS-PAGE followed by immunoblotting using antibodies directed against 4E-BP1, phospho-eIF2α (Ser 51) and beta-actin. The phospho-forms of 4E-BP1 are indicated with greek letters with γ representing the most phosphorylated form and α the least. C. HeLa and 293T cells were treated with thapsigargin (Tg) and tunicamycin (Tm) for 16 hours. Lysates were prepared and subjected to SDS-PAGE followed by immunoblotting with 4E-BP1 and β-actin antibodies. The phospho-forms of 4E-BP1 are indicated.
Figure 3. ER stress induced 4E-BP1 hypophosphorylation results in decreased eIF4F formation and the loss of translation of known eIF4F target mRNAs. A. NB1691 cells were treated with control conditions (NT) or with Tg or Tm for the indicated times. Lysates were prepared, total protein for each sample was equalized and samples were incubated with 7M-GTP sepharose beads. Bound protein was eluted and subjected to SDS-PAGE followed by immunoblotting using antibodies directed against eIF4G, 4E-BP1 and eIF4E. B. NB1691 cells were treated with Tg for the indicated times, lysates were prepared and subjected to SDS-PAGE followed by immunoblotting with antibodies directed against cyclin D1, Bcl2, MMP-9 and for each blot, β actin as a loading control. C. NB1691 cells were treated with Tg or Tm for either 16 hours (open bars) or 24 hours (hashed bars) as indicated. Total RNA was extracted and qRT-PCR was performed using specific primers to detect levels of mRNA of cyclin D1, MMP-9 and
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
23
Bcl-2. Experiments were performed in triplicate and represented as fold change compared to untreated cells. Values are mean +/- SD.
Figure 4. Prolonged ER stress is associated with a decrease in mTOR signaling. A. NB1691 cells were left untreated or treated with Tg or Tm for the indicated times. Cell lysates were prepared and normalized samples were analysed by SDS-PAGE and immunoblotting using antibodies specific for phospho-mTOR (Ser 2448), mTOR, and β-actin. B. NB1691 cells were treated as in A and with rapamycin as a control for mTOR-dependent effects on 4E-BP1. Lysates were analysed by SDS-PAGE followed by immunoblotting using antibodies directed against 4E-BP1 and β-actin. The phospho-forms of 4E-BP1 are indicated with greek letters with γ representing the most phosphorylated form and α the least. C. Rh30 cells were left untreated or incubated with rapamycin for 4 hr or tunicamycin for 16 hr and lysates were analyzed as in B. D. Rh30 cells were treated with varying concentrations of low glucose, tunicamycin or rapamycin for the indicated times. Lysates were prepared, total protein for each sample was equalized and samples were incubated with 7M-GTP sepharose beads. Bound protein was eluted and subjected to SDS-PAGE followed by immunoblotting with antiserum directed against 4E-BP-1. A portion of the equalized samples were directly analyzed for evidence of UPR activation using the CHOP antiserum. Beta actin serves as a control for loading.
Figure 5. Pharmaceutical agents used to activate ER stress can adversely affect growth factor receptor maturation. NB1691 cells were left untreated or treated with Tg or Tm for the indicated times. Cell lysates were prepared and normalized samples were analysed by SDS-PAGE and immunoblotted using antibodies specific for insulin receptor β, IGF1 receptor β, and β-actin. Various states of receptor maturation are indicated.
Figure 6 Prolonged ER stress treatment is associated with a decrease inPI3K/Akt pathway signaling and an increase in AMPK signaling. NB1691 cells were left untreated or treated with Tg or Tm for the indicated times. Lysates were prepared and analyzed by SDS-PAGE. Immunoblotting was performed using antibodies raised against A. phospho-Akt (Thr473), pan-Akt, and phospho-TSC2 (Thr1462) or B. phospho-AMPK (Thr172), pan AMPK, and phospho-TSC2 (Ser1387), with β-actin serving as a loading control.
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
A. B.
β-actin
β-actin
Phos-eIF2α(Ser51)
Cyclin D1
8Tg (h):
CoomassieBlue
35S label
0 0.5 1 2 3 4 6
*
**
Cyclin D1
β-actin
β-actin
HeLa
293T
NT
Cyclin D1
C.
��
•
•
Figure 1
Tg (h): 0 0.5 1 2 4 6
Tg Tm
24
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
C.
4E-BP1
β-actin
β-actin
HeLa
293T4E-BP1
NT
Incubation with Thapsigargin (hours)
% p
rote
in s
ynth
esis
rem
aini
ng
A.
B.
4E-BP1
0 0.5 1 2 4 6 16 24Tg (h):
β-actin
γβα
γβα
γβα
Figure 2
Tg Tm
Phos-eIF2α(Ser51)
25
0 5 10 15 20 250
20
40
60
80
100
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
4E-BP1
eIF4G
eIF4E
NT
Tm Tg NT Tm Tg
24 hrs16 hrs
A. B.
Cyclin D1
β-actin
MMP-9
β-actin
β-actin
0 0.5 1 2 4 6 16 24Tg (h):
Bcl-2
Figure 3
CHOP
C.
26
Bcl-2
Cont Tg Tm
0
0.5
1
1.5
2
2.5
3
3.5
4
Fol
d in
crea
se
MMP-9
Cont Tg Tm
0
0.5
1
1.5
2
2.5
3
3.5
4
Fol
d in
crea
se
CCND1
Cont Tg Tm0
0.5
1
1.5
2
2.5
3
3.5
4
Fol
d in
crea
se
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
NT Tm Tg
6 hrs 16 hrs 24 hrs
P-mTOR(Ser2448)
mTOR
β-actin
NT Tm Tg NT Tm Tg
Figure 427
NT Tm Tg NT Tm Tg NT Tm Tg
6 hrs 16 hrs 24 hrs4 hrs
Rapa
A.
B.
4E-BP1
γβα
β-actin
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
Unglycos. IGF1R
Mature IGF1R
Pro-IGF1R
Unglycos. IR
Mature IR
Pro-IR
Insulin Receptor beta
β-actin
IGF1Receptor beta
β-actin
Figure 5
A.
B.
29
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t
Phos-AMPKThr172
β-actin
Phos-AktThr473
β-actin
A.
Phos-TSC2(Thr1462)
Phos-TSC2(Ser1387)
B.
β-actin
β-actin
NT Tm Tg
6 hrs 16 hrs 24 hrs
NT Tm Tg NT Tm Tg
24 hrs
NT Tm Tg
NT Tm Tg
6 hrs 16 hrs 24 hrs
NT Tm Tg NT Tm Tg
24 hrs
NT Tm Tg
Figure 6
Total-Akt
Total-AMPK
30
Jour
nal o
f Cel
l Sci
ence
Acc
epte
d m
anus
crip
t