establishment of human embryonic brain cell lines

In Vitro Cell. Dev. Biol.--Animal 37:259 262, May 2001 �9 2001 Society for In Vitro Biology 1071-2690/01 $10.00+0.00

Letter to the Editor

ESTABLISHMENT OF HUMAN EMBRYONIC BRAIN CELL LINES

Dear Editor: Allogeneic mesencephalic fetal tissues are used for transplanta-

tion into the striata of patients with advanced Parkinson's disease (PD), and of animals with chemical-induced PD. There are, however, several problems, including legality (in some countries), eth- ics, paucity of available tissue, heterogeneity of cell populations, presence of antigen-presenting ceils responsible for allogeneic graft rejection, and unregulated production of dopamine (DA). Therefore, the establishment of permanent cell lines of human brain neurons with specific neuronal phenotypes may be useful in neural transplants, for ameliorating some of the symptoms of advanced neuro- degenerative diseases such as PD and Alzheimer's disease. Such cell lines may also be valuable for the study of genes regulating growth, transformation, differentiation, and degeneration of nerve cells. A few normal human cell lines, such as stem ceils, capable of differentiating into various cell types are available for neural- transplant studies (Ryder et al., 1990; Reynolds and Weiss, 1992; Azizi et al., 1998; Villa et al., 2000), but they have not shown any significant promise in the treatment of advanced PD. Our previous studies have shown that it is feasible to establish immortalized rat DA neurons in culture by transfeeting fetal brain cells with a plasmid vector, pSV3 ..... cala'ying the SV40 virns large T antigen (LTa) (Prasad et al., 1994; Adams et al., 1996). These immortalized DA neurons are nonimmunogenic and nontumorigenic. The transplantation of these DA neurons into the striata of 6-hydroxydopaminc (6-OHDA)-lesioned rats improved some of the neurological deficits (Clarkson et al., 1998). These encouraging results led us to apply similar plasmid-veetor technology to establish human embryonic DA neurons in culture.

Three human embryos of varying lengths 0.7, 0.93, and 1.1 cm, designated as HC4, HC10, and HC20, respectively, and obtained at different times, were used in this study. Single-cell suspensions were prepared and transfeeted with 100 Ixg of plasmid vector, pSV5,eo carrying the LTa gene from the polyoma virus or pSV3,,o carrying the LTa gene from the SV40 virus (American Type Culture Collection, Rockville, MD), as described earlier (Prasad et al., 1994). The modified MCDB-153 medium with 10% fetal bovine serum, the F12 medium containing 10% agammaglobulin newborn bovine serum, and the Roswell Park Memorial Institute medium with 10% fetal bovine serum were tested to identify a growth medium in which the proliferation of cells was optimal.

Clones were isolated from normal and transfected embryonic brain cells by plating one cell per chamber in a 96-chamber plate. After 2-3 wk, the chambers having ceils were marked, and then the cells were removed and plated into new dishes by a standard procedure. Each surviving clone was recloned as described above. Clones showing a predominant neuronal phenotype (small cells with varying sizes) were selected for characterization with growth and cell-specific markers.

Normal human embryonic brain cells from three separate brain tissues (HC4, HC10, and HC20) were established. These cells grew optimally in the MCDB-153 containing 10% fetal bovine serum. The single-cell cloning method yielded a cloning efficiency of 4-10% for HC20. HC4 and HC10 cell lines were not cloned. Ceils of HC4P10, HC10P9, and HC20A2P4 exhibited neuronal- and glial-specific markers (Fig. 1). Repeated cloning of HC20A2P4 failed to yield pure neurons or pure glia cells. The neuronal phenotype was evident by the presence of cells which were positively stained with the prinmry antibody to the dopamine transporter (DAT), neu- rofilament-200 (NF-200), and neuron-specific enolase (NSE), whereas the glial phenotype was evident by the presence of glial fibnllary acidic protein (GFAP)-positive ceils in the culture. Cells did not stain with the primary antibody to tyrosine hydroxylase (TH) or choline acetyhransferase (CHAT). Reverse transcriptase-polyme1~ ase chain reaction (RT-PCR) showed the presence of TH messenger ribonucleic acid (mRNA); however, the level was less than that found in differentiated neuroblastoma (NB) ceils (Fig. 2).

All untransfected cells and cells transfected with pSV3,,eo died within 22 d after geneticin treatment, but some cells transfected with pSV5,,~o survived. The neoresistant survivors did not express LTa. These cells were cloned by a single-cell cloning method. The cloning efficiency was about 10-12%. Several clones were isolated and 10 of them characterized with respect to neuronal and gliat phenotypes. All clones contained both neuronal and glia cells. The repeated single-cell cloning failed to yield pure neurons or pure glia cuhures. The presence of neurons was evident by positive staining with DAT, NF-200, and NSE, whereas the presence of glia cells was evident by positive staining of ceils with GFAE Cells did not stain with the primary antibody to TH or CHAT. RT-PCR demon- strated the presence of TH mRNA (Fig. 2). The level of TH mRNA in transfected human embryonic ceils, as determined by the RT- PCR technique, was higher that that found in untransfected cells, but lower than in differentiated NB cells.

One of the selected transfected clones (HC20V5A20P10) did not express the LTa protein of the polyoma virus as determined by the immunostaining, using primary antibody to the LTa of the polyoma virus according to a procedure described earlier (Prasad et al., 1994). Western blotting, using polyoma LTa antibody (ab-1) rat IgG2bk monoclonal anti-polyoma LTa (Oncogene Res. product) also failed to detect Lta protein in these cells (data not shown).

To determine if the polyoma Lta gene is expressed in HC20SVSA20 cells, RT-PCR was done using either total RNA isolated from HC20SV5A20 P l l cells or the pSV5,oo ptasmid, as a positive control Polyoma virus LTa-specific oligonucleotide primer sets (synthesized by GIBCO-BRL, Grand Island, NY) that amplify small and middle T antigen, or smalt and middle T antigen, were used. We found that HC20V5A20P11 cells did not contain detectable levels of the polyoma virus T antigen mRNA (data not shown).

259

260 KUMAR ET AL.

FIG. l. hnnmnostaining of human embryonie brain cells with the primary antibody to neuronal and glial-specifie antibodies (all antibodies are from Chemieon International, Temeeula, CA, except where indicated). Cells were stained tor neuronal markers: rabbit anti-TH (monoelonal, dilution 1:100), mouse anti-ChAT (monoclonal, dilution 1:100), rabbit anti-DAT (polyelonal, dilution 1:50), rabbit anti-NF-200 (polyelonal, dilution 1:100; Sigma Chemical Co., St. Louis, MO), rabbit anti-NSE (polyelonal, dilution 1:100), and mouse anti-microtuble-assoeiated protein-2 (MAP2) (monoelonal, dilution 1:35; Boehringer Mannheim, Indianapolis, IN). Glial markers included a rabbit anti-GFAP (polyehmal, dilution 1:100). The secondary antibody fluorescein isothiocyanate (FITC) rabbit anti-goat IgG was used for all antibodies except for MAP2. FITC goat anti-mouse IgG for antibody to MAP2 was also used in order to show specificity of staining with the individual primary antibody. We have used this procedure in previous publications (La Rosa et al., 1996; Hovland et al., 1999). HC4PIO cell line: cells without the primary antibody did not stain (u). Faint staining was detected with anti-TH (a) and DAT (e). Cells were strongly stained with anti-NF-200 (i). HC10P9 cell line: cells were faintly stained with anti-TH (b) and anti-MAP2 (v), and were strongly stained with anti DAT {/'), anti-NF- 200 (/), anti-NSE (n), and anti-GFAP (r). HC20A2P4 cell line (HC20P): cells did not stain with anti-TH (c), but were strongly stained with anti-DAT (g), anti-NF-200 (k), and anti-NSE (o). They were weakly stained with anti-MAP2 (w) and anti-GFAP (s). HC20V5A20P12 cell line (HC20V5I~'): cells were not stained with anti-TH (d), but were strongly stained with anti-DAT (h), anti-NF-200(/), and anti-NES (p); but they were only weakly stained with anti-MAP2 (x) and anti-GFAP (t). Magnification: •

EMBRYONIC BRAIN CELL LINES 261

FIG. 2. RT-PCR analysis of TH mRNA expression in human embryonic brain cells (HC20A2P9, HC20V5A20P10) and murine neuroblastoma (NBP2) cells. RT-PCR was done using total RNA derived from the above cell lines and from maximally differentiated NB cells (P2), expressing high levels of TH, which were used as a positive control (Qiagen's RNeasy ~ Midi kit; Qiagen, Chatsworth, CA). RNA was quantitated by ultraviolet spectroscopy. Complementary deoxyribonucleic acid (eDNA) synthesis was done using total RNA (2 p,g), oligo(dT),2 ,a primers (0.5 txg), a mixture of deoxynueleotide triphosphates (dNTPs) (0.5 u~l final concentration), dithiothreitol (5 ndl'/final concentration), ribonuelease inhibitor (cloned, 10 units), and moloney murine leukenfia virus (M-MLV) RT (200 units) in the presence of 1• First Strand buffer as per protocol (GIBCO-BRL). PCR reactions were done using human TH-specifie oligonueleotide primers (synthesized by GIBCO-BRL). The TH forward primer is CGCCAGCGCAGGAAGCTGATTGC (nueleotides 619- 641) and the reverse TH primer is CTGAAGCTCTCAGACACGAAGTA (nu- cleotides 1335-1313). PCR was done using eDNA generated from approxi- mately 50 ng of total RNA and a mixture of." dNTPs (0.09 nkM final concentration), MgCI~ (1.25 mM final concentration), the TH primers (1.7 txM final eoneentration), and Taq DNA polynmrase (1 unit) in 60 Ixl of 1 • PCR buffer (GIBCO-BRL). After 2 min of denatm'ing at 96 ~ C, the mixture was subjected to 35 cycles with the fallmving settings: 96 ~ C for 40 s, 63 ~ C for 40 s, and 72 ~ C for 60 s. Aliquots (5 /xl) were removed at cycles 25 and 30 to ensure that amplification was in the linear range. A final extension at 72 ~ C for 5 min was dune, then reactions were held at 4 ~ C. The TH-specific primers used generate a produet of 718 bp. The 1 kbp plus DNA ladder (GIBCO- BRL) was used to verify" the PCR-product size. At cycle 35, low levels of TH mRNA were observed in huumn embryonic cell lines in comparison to the dift}erentiated NB cells, hnages of the gels were digitized using the Alpha- Imager 2000 (Alpha Innoteeh Cm'p., San Leandro, CA), and PCR products were quantitated using the NIH Image 1.62 soflwm'e.

Since it was clear that the polyoma Lta gene was not being ex-

pressed, we wanted to verify if the neomycin resistance gene (neo)

was being expressed. To this end, RT-PCR analysis was done using total RNA derived from either HC20 parental cells (HC20P12) or

transfected cells (HC20V5A20 P12). The pSV5noo plasmid was used

as a positive control. No PCR product was detectable from the untransfected cell (HC20P12) RNA. In contrast, a product of the ex-

pec ted size was clearly de tec ted in the t rans fec ted cel ls

(HC20V5A20P12) (Fig. 3). This product also migrated exactly with

the product derived from the amplification of the pSV5noo positive- control template. We concluded, therefore, that the neo gene was

intact in the HC20V5A20P12 (HCv5) cells, and was well expressed. The doubling time of a clone (HC20A2P12) derived fi'om normal

human embryonic brain cells showing a predominant neuronal phe-

notype was about 2.74 d, whereas the doubling time of a neomycin-

resistant gene-express ing clone (HC20V5A20P13) was about

1.97 d. The morphology of both clones between passages 4 and 18 was similar. However, after the 18th passage, normal brain cells

showed signs of senescence, as evidenced by reduced growth rate,

enlargement of cell size, and fragmentation of cytoplasmic and nu-

clear materials. In contrast, the cells expressing the neomycin-re-

FIG. 3. Confirmation of neo mRNA expression in HC20v5 by RT-PCR analysis. RT-PCR was done using total RNA derived from HC20 (HC) pa rental cells, HC20 cells transfected with the pSV5~ vector (HCv5), or the pSV5n~o plasnfid, as a positive eontrol. The neo-specific primers used generate a product of -480 bp. The 1 kbp plus DNA ladder (GIBCO-BRL) was used to verify the PCR product size. The forward primer sequence for neo is GTGGAGAGGCTAGGCTA (nueleotides 1700-1719), and the reverse primer sequence for neo is CTTGAGCCTGGCGAACAGTT (nueleotides 2180-2161) (synthesized by GIBCO-BRL). The PCR cycling conditions for neo were as ibllows: 96 ~ C for 2 rain, 30 cycles of 96 ~ C for 40 s, 65 ~ C for 40 s, and 72 ~ C for 60 s; final extension of 72 ~ C for 5 rain and held at 4 ~ C. TeA nanograms of the pSV5 "~0 plasmid was used as a positive control. Images of the gels were digitized using the Alphahnager 2000 (Alpha Innoteeh Corp.). PCR products were quantitated using the NIH Image 1.62 software.

sistant gene continued to proliferate up to passage 28 without showing any sign of senescence.

Cells expressing neomycin-resistant genes, when injected sub- cutaneously into athymie mice, did not form tumors within 60 d of injection, suggesting that they were nontumorigenic.

This study shows that normal human embl3mnic brain cells can be maintained in culture for a certain period of time, while main- taining neuronal and glial phenotypes. The fact that repeated single- cell cloning failed to yield purified neurons or glia cells suggests the existence of precursor cells capable of differentiating into neurons and glia eeIIs. Although TH activity was not detectable by immunostaining, TH mRNA was demonstrable by RT-PCR. These cells show senescence after the 18th passage.

This study also shows that transfected cells do not express the

LTa of the polyoma virus despite their selection in the presence of geneticin. This suggests that the incorporation of a neomycin-resistant gene into selected cells occurs without simultaneous incorporation of the LTa gene. The reasons for the uncoupling in incorpo-

ration of the neomycin-resistant gene and the LTa gene into host- cell genome are not known. It is interesting to note that while the

Lta gene does not appear to be expressed, insertion of the neomycin-resistant gene is sufficient to induce genetic alterations that increase the l ife-span of human embryonic brain cells in culture by one-third of the parent cell line. The nature of these genetic changes

is unknown. Both untransfected and transfeeted cultures contain cells exhibiting TH mRNA and DAT. Such cells represent undif- ferentiated DA neurons.

These normal and transfected human embryonic brain cell lines

may be useful in the study of neural transplants as well as in the regulation of growth, differentiation, degeneration, and transforma-

tion of nerve and glia cells.

2 6 2 KUMAR ET AL.

ACKNOWLEI)GMENTS

This study was supported by US Public Health Service Grant NS29982 and AG18285. The human fetal tissue was used according to Federal guide- lines and with the prior approval of our IRB.

REFERENCES

Adams, E S.; La Rosa, E G.; Kmnar, S.; Edwards-Prasad, J.; Kentroti, S.; Vemadakis, A.; Freed, C. R.; Prasad, K. N. Characterization and transplantation of two neuronal cell lines with dopaminergic properties. Neurochem. Res. 21:619~27; 1996.

Azizi, S. A.; Stokes, D.; Augelli, B. J.; DiGirolamo, C.; Prockop, D. J. En- graftment and migration of hmnan bone marrow stromal cells implant- ed in the brains of albino rats--similarities to astrocyte grafts. Proc. Natl. Acad. Sci. USA 95:3908-3913; 1998.

Clarkson, E. D., Rosa, E G. L.; Edwards-Prasad, J.; Weiland, D. A.; Witta, S. E.; Freed, C. R.; Prasad, K. N. Improvement of neurological deficits in 6-hydroxydopamine-lesioned rats after transplantation with allogeneic simian virus 40 large tumor antigen gene-induced immortalized dopamine cells. Proc. Natl. Acad. Sci. USA 95:1265-1270; 1998.

Hovland, A. R.; La Rosa, E G.; Hovland, P. G.; Cole, W. C.; Kumar, A.; Prasad, J. E.; Prasad, K. N. Cyclosporin A regulates the levels of cyelophilin A in neuroblastoma cells in culture. Neurochem. Int. 35:229-235; 1999.

La Rosa, E G.; Kumm, S.; Prasad, K. N. Increased expression of ubiquitin during adenosine 3',5'-cyclic monophosphate-induced differentiation of neuroblastoma cells in culture. J. Neurochem. 66:1845-1850; 1996.

Prasad, K.; Carvalho, E.; Kentroti, S.; Edwards-Prasad, J.; Freed, C.; Ver- nadakis, A. Establishment and characterization of immortalized clon- al cell lines from fetal rat mesencephalic tissue. In Vitro Cell. Dev. Biol. 30A:596-603; 1994.

Reynolds, B. A.; Weiss, S. Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science 255:1707-1710; 1992.

Ryder; E. E; Snyder, E. Y.; Cepko, C. L. Establishnlent and characterization of multipotent neural cell lines using retrovirus vector-mediated oncogene transfer. J. Neurobiol. 21:356-375; 1990.

Villa, A.; Snyder, E. Y.; Vescovi, A.; Martinez-Serrano, A. Establishment and properties of a growth factor-dependent, peq?etual neural stem cell line from human CNS. Exp. Neurol. 161:67-84; 2000.

Bipin Kumar Alieia R. Hovland Judith E. Prasad Edward Clarkson

William C. Cole Piruz Nahreini Curt R. Freed Kedar N. Prasad 1

Center for Vitamins and Cancer Research

Department of Radiology (B. K., A. R. H., J. E. P., W. C. C., P. N., K. N. P.)

Department of Medicine (E. C., C. R. E) University of Colorado Health Sciences Center

Denver, Colorado 80262

(Received 22 August 2000)

' To whom correspondence should be addressed at Center for Vitamins and Cancer Research, Department of Radiology, University of Colorado Health Sciences Center, Campus Box C 278, 4200 E. 9th Avenue, Denver, Colorado 80262. E-mail: [email protected]

establishment of human embryonic brain cell lines

Documents