TECHNICAL NOTE

Eleven novel microsatellite markers for the Chinese alligator(Alligator sinensis)

Wei Jing Æ Xiao-Liang Wang Æ Hong Lan ÆSheng-Guo Fang

Received: 8 March 2008 / Accepted: 11 March 2008 / Published online: 22 March 2008

� Springer Science+Business Media B.V. 2008

Abstract Chinese alligator (Alligator sinensis) is a criti-

cally endangered species endemic to China. In this study,

we developed 11 novel microsatellite loci for this rare

species and applied them to examine genetic variation of

indigenous alligators from Changxing Nature Reserve and

America-born Chinese alligators. The 11 polymorphic

microsatellites presented a total of 31 alleles among 57

individuals scored, yielding an average of 2.82 alleles per

locus. One allele was unique to the American population

but four private alleles were detected in the Changxing

population. The average expected and observed hetero-

zygosities were 0.400 and 0.482 for the Changxing

alligators and 0.520 and 0.621 for the America-born indi-

viduals, respectively. These microsatellite markers would

be useful tools in the genetic examination of this endan-

gered species.

Keywords Chinese alligator � Microsatellite �Genetic diversity � Heterozygosity � Allele

Chinese alligator (Alligator sinensis) is a critically endan-

gered species endemic to China and currently categorized

as Accessory I in CITES. Historically, this species was

widely distributed in the large expanses of wetland habitats

in the lower Yangzi and Shaoxing River valleys (Chen

1990). As a result of habitat loss and serious illegal hunt-

ing, the wild population has been close to extinct during the

past decades. The field investigation indicated that the

number of wild Chinese alligators has decreased from 500

in the 1980s to less than 150 current individuals (Thorb-

jarnarson et al. 2002). At present, the wild alligators

merely existed in Xuanzhou County of Anhui Province and

Changxing County of Zhejiang Province (Thorbjarnarson

and Wang 1999). Therefore, there is a clear requirement to

employ highly variable markers to investigate genetic

status of the Chinese alligators.

Although microsatellite markers have been utilized to

assess genetic diversity of the Chinese alligators (Huang

and Wang 2004; Xu et al. 2005), their microsatellite loci

were all derived from American alligators and demon-

strated that the Chinese alligator possessed a low level of

genetic diversity; Na (the number of alleles) means are 2.38

and 3.25 for the studies of Huang and Wang (2004) and Xu

et al. (2005), respectively. This makes it necessary to

develop more polymorphic microsatellite markers, espe-

cially from the Chinese alligator herself. In this study, we

reported the isolation of 11 novel microsatellite loci from

the Chinese alligator.

A total of 57 samples were collected; 45 umbilical

cord and 3 blood samples were from Changxing Nature

Reserve and Breeding Research Center for Chinese Alli-

gator and other blood samples were obtained from nine

special Chinese alligators: they were born in America in

last decade; their ancestors went to American in the 1950s–

1960s but they came to the ‘‘Changxing Center’’ in 2006.

Genomic DNA was extracted from a blood sample using

standard phenol/chloroform methods (Sambrook et al.

1989). According to the protocols of He et al. (2006) and

Zhao et al. (2007), microsatellite loci were isolated with

W. Jing � X.-L. Wang � H. Lan � S.-G. Fang (&)

College of Life Sciences, State Conservation Center for Gene

Resources of Endangered Wildlife, Zhejiang University,

Hangzhou 310058, P.R. China

e-mail: sgfang@mail.hz.zj.cn

W. Jing � X.-L. Wang � H. Lan � S.-G. Fang

Key Laboratory of Conservation Genetics and Reproductive

Biology for Endangered Wild Animals, Ministry of Education,

Zhejiang University, Hangzhou 310058, P.R. China

123

Conserv Genet (2009) 10:543–546

DOI 10.1007/s10592-008-9561-x

the following specifications and modifications. Fragments

of 200–1,200 bp were recovered from Sau3AI-digested gen-

ome DNA, about 6 lg of which were ligated to 50 pM of

linkers SauF (50-GCG GTA CCC GGG AAG CTT GG-30) and

SauR (50-GAT CCC AAG CTT CCC GGG TAC CGC-30).The ligated fragments were amplified in a PCR using a

single linker SauF as primers. The PCR system contained

60 ng template DNA, 0.5 U of Taq DNA polymerase

(TaKaRa), 1 ll of 109 PCR buffer (TaKaRa), 0.8 ll of

25 mM MgCl2, 0.75 ll of 20 mM dNTPs, 0.1 ll of bovine

serum albumin (BSA) and 1 ll of primer (SauF). The

reaction conditions were composed of 95�C for 5 min, then

30 cycles of 95�C for 30 s, 60�C for 45 s, 72�C for 90 s,

and a final period at 72�C for 10 min. PCR products were

then hybridized to biotinylated (AC)12 or (AG)12 oligonu-

cleotide probes by incubation overnight at 65�C.

Streptavidin-coated magnetic beads (Roche) were added to

the hybridization mixture and incubated for 2–5 h at 43�C

with intermittent agitation. The enriched fragments were

cloned into pMD-18T vector (TaKaRa) and transformed

into DH5a competent cells (TaKaRa). Positive clones were

sequenced on automated ABI3700 DNA sequencer. Pri-

mier 5.0 was used to design primers from the sequences

that contained motif repeats.

The availability of these primers was first tested by PCR

amplification and only the primerpairs yielding consistent

specific PCR products were adopted for genetic examination.

A 50-M13 tail (50-CAC GAC GTT GTA AAA CGA C-30) was

added to the forward primer of each primer pair to allow

fluorescent labeling during amplification reactions. PCR

was carried out in 10 ll reaction system, including

10–20 ng template DNA, 0.5 U of Taq DNA polymerase

(TaKaRa), 1 ll of 109 PCR buffer (TaKaRa), 0.8 ll of

25 mM MgCl2, 0.75 ll of 20 mM dNTPs, 0.1 ll of BSA,

0.4 ll of each 10 lM primer and 1 ll of 1 lM IRD labeled

M13 primer (LI-COR). The PCR conditions were as fol-

lows: 95�C for 5 min, followed by 30 cycles of 30 s at

95�C, 50 s at optimized annealing temperatures (Table 1),

30 s at 72�C and a final extension at 72�C for 7 min.

Polymorphism investigation was only conducted for

those primer pairs giving correct and consistent specific

products. We loaded the PCR products on LI-COR 4200

automated DNA Sequencer to achieve this objective. SA-

GAGT version 3.2 software (LI-COR) was used to size the

alleles accurately. The Cervus 2.0 program (Marshall et al.

1998) was used to calculate the number of alleles and the

observed and expected heterozygosities of each locus.

Deviations from Hardy–Weinberg equilibrium and linkage

Table 1 Eleven polymorphic microsatellite loci from the Chinese alligator (Alligator sinensis)

Locus Repeat motif Primer sequences (50–30) Pruduct size (bp) Ta (�C) Na Accession No. (GenBank)

Alsi01 (AC)21 F: CTTTCTCCTGCGTATGTCG

R: GGTGCTGGTAGTTTGATGC

170–172 57.5 2 EU417825

Alsi02 (GC)2...(AC)28 F: CTCAAAGCACAAGAAATA

R: GACAAGGTCAAAGAACAC

241–257 56.8 3 EU417826

Alsi03 (TG)18 F: TCAGGCAAGCAGGTAAGC

R: ACTGGGAACTGTGCGTAT

138–156 56.5 2 EU417827

Alsi04 (GC)4(AC)25 F:TCTGAGGAAAATCTGGGACA

R: AGGGAAGCCTGGGGTTGG

292–294 56.5 2 EU417828

Alsi05 (TG)30 F: TGTAAGCACCTTTCAGC

R: ACAACATCAAGCCTCCC

139–153 54.5 5 EU417829

Alsi06 (TC)6(AC)34 F: GATCATGTAATTAGCACCTG

R: CCCTGGATTTTAACTCAA

247–263 57.6 4 EU417830

Alsi07 (AC)24...(AC)2 F: TAGGTGCCTTCAATCTTT

R: CCTTTCACTTGCCTCTTC

233–239 58.5 3 EU417831

Alsi08 (AC)18...(AC)4 F:ATTAGGCAGATTGAAACACT

R: CAACTTGACCACCACCC

285–291 58.9 2 EU417832

Alsi09 (AG)12...(AG)14 F: TCAAACCCACATCTCCAC

R: GCTGGCAACGTGATTCTT

278–280 57.5 2 EU417833

Alsi10 (TC)22 F: GGGGTCTTTGAGGTTGTT

R: GCTAAGTAGCTCAGGCAAT

251–261 56.5 3 EU417834

Alsi11 (AG)26(TG)5 F: GCCATACTGAGCATTTGA

R: CATACACGCATGTTCTTT

178–206 57.8 3 EU417835

Ta and Na are the annealing temperature and the number of alleles per locus (n = 57), respectively

544 Conserv Genet (2009) 10:543–546

123

disequilibrium were analyzed using GENEPOP version 3.4

(Raymond and Rousset 1995).

Considering that the America-born Chinese alligators

have been genetically isolated from the Changxing popu-

lation for a half-century, it is possible to shape indigenous

(Changxing-born; Cb) and reintroduced (America-born;

Ab) two populations. As a result, we first performed clus-

tering and admixture analyses using BAPS (Bayesian

Analysis of Population Structure) software (Corander and

Marttinen 2006). The Bayesian-based results highly sup-

ported that these mixed Chinese alligators did be divided

into indigenous and reintroduced two populations, which

showed limited genetic admixture (Fig. 1a). Hence, the

subsequent characterization of novel microsatellite markers

was carried out according to Cb and Ab populations.

Eleven polymorphic microsatellite loci were developed

ultimately, presenting 2–5 alleles per locus (Table 1).

Compared with its congener species Alligator mississippi-

ensis (Glenn et al. 1998), genetic diversity of the Chinese

alligator was relatively low. A total of 31 alleles were

identified from the alligators scored, of which one allele

was specific to the Cb population and four ones were

unique to the Ab population. The average expected and

observed heterozygosities were 0.520 and 0.621 for the Ab

Chinese alligators and 0.400 and 0.482 for in the Cb

individuals, respectively (Fig. 1b). Significant linkage

disequilibrium (P \ 0.001) was detected for four pairs of

loci (Alsi02–Alsi03, Alsi04–Alsi07, Alsi05–Alsi10 and

Alsi07–Alsi10). Two loci (Alsi07 and Alsi11) showed

significant deviation from Hardy–Weinberg equilibrium in

the Changxing population (Fig. 1b) and presented higher

observed heterozygosity than expected, i.e. heterozygotes

excess, probably due to the known bottleneck resulted from

recent captive breeding.

Microsatellite marker system is a useful tool in captive

breeding management, making it important to develop

highly polymorphic microsatellite loci. However, previous

studies (Huang and Wang 2004; Xu et al. 2005) and our

examination all revealed a limited allelic polymorphism

(2–5 alleles per locus) in the Chinese alligator, thus justi-

fying calculation of exclusion probability for all available

microsatellite makers. For this purpose, we examined

genetic variation of previous markers in these Chinese

alligators sampled. The computational results indicated

that overall probabilities of exclusion with both unknown

parents and with only unknown sire for the novel micro-

satellites were relatively low, 0.72 and 0.92, respectively.

Nonetheless, the exclusion probabilities of parentage and

paternity testing went up to 0.91 and 0.99 if calculated in

combination with previous cross-species markers, thus

suggesting that this new set of microsatellite markers

should be used for genetic examination of the Chinese

alligator together with previous microsatellite loci.

Acknowledgements We would like to thank the Changxing Nature

Reserve and Breeding Research Center for Chinese Alligator for

offering all the samples used in this study. This work was supported

by the Major Research plan of the National Natural Science Foun-

dation of China (Grant No. 30730019) and a special grant from the

state forestry administration of China (No. 2005-4-C04).

References

Chen BH (1990) The past and present situation of the Chinese

alligator. Asiat Herpetol Res 3:129–136

Corander J, Marttinen P (2006) Bayesian identification of admixture

events using multi-locus molecular markers. Mol Ecol 15:2833–

2843

Glenn TC, Dessauer HC, Braun MJ (1998) Characterization of

microsatellite DNA loci in American alligators. Copeia 3:591–

601

He LP, Wan QH, Fang SG, Xi YM (2006) Development of novel

microsatellite loci and assessment of genetic diversity in the

endangered Crested Ibis, Nipponia Nippon. Conserv Genet

7:157–160

Fig. 1 Bayesian-based admixture analysis of the Changxing-born

(Cb; No. 1–49) and America-born (Ab; No. 50–58) Chinese alligators

(a) and parameters of genetic diversity of Changxing and America

populations (b)

Conserv Genet (2009) 10:543–546 545

123

Huang L, Wang YQ (2004) SSR Polymorphism of Alligator sinesisand conservation strategy of genetic diversity. Acta Genet Sin

31:143–150

Marshall TC, Slate J, Kruuk LEB, Pemberton JM (1998) Statistical

confidence for likelihood-based paternity inference in natural

populations. Mol Ecol 7:639–655

Raymond M, Rousset F (1995) GENEPOP (version 1.2): population

genetics software for exact tests and ecumenicism. J Hered

86:248–249

Sambrook J, Fritsh EF, Maniatis T (1989) Molecular cloning: a

laboratory manual, 2nd edn. Cold Spring Harbor Laboratory

Press, New York

Thorbjarnarson J, Wang XM (1999) The conservation status of the

Chinese alligator. FFI Oryx 33:152–159

Thorbjarnarson J, Wang XM, Ming S (2002) Wild populations of the

Chinese alligator approach extinction. Biol Conserv 103:93–102

Xu QH, Fang SG, Wang ZP, Wang ZW (2005) Microsatellite analysis

of genetic diversity in the Chinese alligator (Alligator sinensis)

Changxing captive population. Conserv Genet 6:941–951

Zhao SS, Chen X, Fang SG, Wan QH (2007) Development and

characterization of 15 novel microsatellite markers from forest

musk deer (Moschus berezovskii). Conserv Genet. doi:10.1007/

s10592-007-9362-7

546 Conserv Genet (2009) 10:543–546

123