developing microsatellite loci for alligator gar and their usefulness in other gar species. greg...

33
eloping Microsatellite Loci for Alligator G and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA Brian Kreiser University of Southern Mississippi

Upload: charlotte-potter

Post on 12-Jan-2016

215 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species.

Greg MoyerU.S. Fish and Wildlife Service - Warm Springs, GA

Brian KreiserUniversity of Southern Mississippi

Page 2: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

OR

Where Are You From

&

Who’s Your Daddy?

Page 3: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

A Brief Introduction

Kreiser & Colleagues

Kevin Feldheim - The Field Museum

Wilfredo Matamoros - USM

Jake Schaefer - USM

Moyer & Colleagues

Brian Sloss – USGS

Josh Rousey – Valdosta State

Justin Sipiorski - SIU

Page 4: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

Samples in Hand

MS Gulf Coast Fishing Rodeo (2002+) - Dennis Riecke (MDWFP)

St. Catherine Creek NWR - Ricky Campbell (UWFWS)

Vicksburg - Jan Hoover (Army Corp)

Oklahoma - Kerry Graves (USFWS)

Louisiana - Allyse Ferrara (Nichols State U.)

Texas - Mark Malfa (bowfishing guide)

Choctawhatchee - Frank Parauka (USFWS)

Other gar species (spotted, longnose, shortnose, Florida)

Page 5: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

Overview

1. Background on conservation genetics, molecular tools and microsatellites

2. Summary of work to date

3. Future directions - your input

Page 6: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

Conservation GeneticsFields of - Ecology, Population Genetics & SystematicsTools of - Molecular Biology & Mathematical Modeling

Page 7: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

Overlapping Questions

Page 8: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

What is genetic variation and why is it important?

• All the variation due to differences in alleles and genes in an individual, population, or species

• Raw material for adaptive evolutionary change– Genetic diversity is required for populations to evolve in response

to environmental changes1

– Heterozygosity levels are linked directly to reduced population fitness via inbreeding depression2

1McNeely et al. 1990; 2Reed and Frankam 2003

Page 9: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

What is genetic variation and why is it important?

• Conservation plans– maintain self sustaining populations– . . . long-term viable populations

• What does viability and self-sustaining actually mean?

• A viable population must be large enough to maintain sufficient genetic variation for adaptation to environmental changes

Page 10: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

The Molecular Markers

Mitochondrial DNA

Microsatellites

Species Boundaries

Population Structure

Within Populations

Page 11: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA
Page 12: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

Screening for Genetic Variation

Microsatellite gel run

Page 13: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

Not Really That Complicated

Kreiser Lab Not the Kreiser Lab

Page 14: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

Why Mitochondria?

“Powerhouse of the cell”; with its own genome

Small, circular genomeHigh mutation rateVariation for population studies

ClonalMaternal inheritance

Page 15: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

Microsatellites - DNA Fingerprinting

Many loci in genome

Highly polymorphic

Page 16: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

Example:- (CA) repeat- 6 alleles

#2 Genotype = 148 bp / 146 bp - one repeat unit difference

#8 Genotype = 144 bp / 156 bp - six repeat units difference

Microsatellites - DNA Fingerprinting

#5 Genotype = same

Page 17: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

Multilocus genotype = the DNA fingerprint

Microsatellites - DNA Fingerprinting

Individual Locus 1 Locus 2 Locus 3 Locus 4 #2 148/146 160/156 220/212 138/130 #5 148/146 158/156 218/210 140/136 #8 144/156 160/158 224/220 142/132

Page 18: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

Microsatellite Marker Development

• Collaborative effort among agencies, universities and laboratories

• Goal – Develop a suite of 12-16 markers for estimating

population genetic parameters

Page 19: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

Microsatellites - Isolating Loci

(GCC)(AT)

(GATA)

DNAExtraction

Enrichment Clone

SequenceClones

SelectLoci Bearing

Clones

Page 20: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

Microsatellites - Isolating Loci

TATTCCAAGGTGCAGCTGTAAGAATGCCATACAAACAAACAAACAAACAAACAAACAAACAAACAAACAAACAAACAACTCACTCTTCTGAGCTAAAATTCTGTGCTGTCTGTTTTGGGTGAAAACTAGGGAGTTTGCAGAACTCTTTGAGAGTTTTTTTAAGGTGCACATAAAAACTTCATCAGGATCTGAAACACCGTCACTGTGCTGGCTTCCCATTAACCAATATCTGTTTCCTC

Atsp 84 - primer design

16 alleles

Atsp 1594 alleles

Atsp 121 allele

Page 21: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

Results

• Moyer lab (lots of work and nothing to show for it!)

– Two libraries constructed (enriched for di and tri repeats)

– 24 primers sets developed and optimized– 14 of 24 loci -- successful and consistent amplification of alligator gar

DNA– Limited variation

• 5 loci limited to 1 allele• 7 loci had 2 alleles• 2 loci had 3 alleles

– Cross species amplification with L. osseus, oculatus, platostomus, tropicus, and platyrhincus

• Similar results

Page 22: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

Results

Kreiser lab - Alligator gar

19 individuals - MS Gulf Coast fishing rodeo

30 loci tested14 - not resolved

16 - amplified5 - monomorphic (one allele)11 - polymorphic (no deviation from HWE or LD)

Page 23: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

Loci TestingLocus # Alleles Ho He

Atsp 7 4 0.263 0.238

Atsp 35 3 0.750 0.627

Atsp 40 4 0.684 0.620

Atsp 54 4 0.316 0.614

Atsp 57 2 0.053 0.051

Atsp 66 4 0.842 0.658

Atsp 84 16 0.947 0.898

Atsp 95 3 0.444 0.545

Atsp 122 3 0.389 0.329

Atsp 159 4 0.526 0.597

Atsp 341 3 0.688 0.506

Average 4.5 0.537 0.517

Page 24: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

Loci Testing

Other gar

L. oculatus (n=14) & L. osseus (n=13) - Pascagoula

30 loci tested12-13 - not resolved

7-8 - amplified2-4 - monomorphic4-5 - polymorphic (no deviation from HWE or LD)

Page 25: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

Loci Testing

# Alleles # Alleles

Locus L. oculatus L. osseus

Atsp 12* 3 2

Atsp 40 1 3

Atsp 54 1 1

Atsp 57 6 7

Atsp 66 13 10

Atsp 95 8 8

Atsp 324* 1 NR

Atsp 339* 1 1

Page 26: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA
Page 27: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

Where do we go from here?

Page 28: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

Restoration Goals• Ecological

– Supplement existing populations– Establish new populations– Ecological functions

• Genetic– Maintain/restore adaptive diversity and evolutionary

processes to promote population persistence.• Adaptive genetic variation within populations• Genetic structure among populations

• Historical– Restore the past?– Ensure the future?

Page 29: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

Strategies for ecological restoration• Wait and see • Restore habitat

– Goal is simply to enhance natural recruitment

– No intended or unintentional genetic impact

• Hatchery-based enhancement– Goal is to increase numbers

– No intentional genetic impacts

– Unintentional impacts depending on the source of brood stock, how it’s managed, and the natural genetic structure

• Genetic Rehabilitation– Goal is to “improve” the genetics of populations

• Manipulate gene flow

• Selectively bred or genetically engineered brood stock

Page 30: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

Conservation Genetics & Hatchery Propagation

• Best choice is local brood stock

• Non local– Risk – outbreeding depression (relative fitness of hybrids and

back crosses < natural population)

– Does genetic similarity = adaptive similarity?

– Can have high gene flow but local adaptation

• Recommendation– Avoid non-local brood stock

– Test for adaptive vs. neutral genetic variation

Page 31: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

Conservation Genetics & Hatchery Propagation• Local brood stock

– Genetic diversity • Hatchery ≈ natural• Risk: inbreeding depression

– Lower relative fitness of hatchery stock• Recommendation – Genetic baseline data

– Large number of unrelated founders – number depends on generation time of organism

– Spawn unrelated– Avoid spawning brood stock more than once– Use brood held in captivity < 1 generation1

– Equalize parent contributions

– Rearing conditions • Hatchery ≈ natural• Risk: artificial selection

– Lower relative fitness of hatchery stock• Recommendation

– Equalize parent contributions1Araki et al. 2007 Science

Page 32: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA

Questions/Suggestions?

Page 33: Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA