downloaded from on july 14, 2020 by guest · 3/22/2010 · clinical diseases. diarrhea associated...

1

IAI01205-09 Version3

Interactions of Encephalitozoon cuniculi Polar Tube Proteins

Boumediene Bouzahzah 1, FNU Nagajyothi 1, Kaya Ghosh 1, Peter M. Takvorian 1,2, Ann Cali 2,

Herbert B. Tanowitz1,2, Louis M. Weiss 1,3,#

1Department of Pathology, Division of Tropical Medicine and Parasitology, Albert Einstein

College of Medicine, 1300 Morris Park Avenue, Bronx, NY, 10461.

2Department of Biological Science 2, Rutgers University, 195 University Avenue, Boyden Hall,

Rutgers University, Newark, NJ 07102, USA

3Department of Medicine, Division of Infectious Diseases, Albert Einstein College of Medicine,

1300 Morris Park Avenue, Bronx, NY, 10461.

# Corresponding Author:

Louis M. Weiss MD MPH

Albert Einstein College of Medicine

1300 Morris Park Avenue

Room 504 Forchheimer Building

Bronx NY 10461

Tel: 1-718-430-2143

Fax: 1-718-4308543

email: [email protected]

Copyright © 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Infect. Immun. doi:10.1128/IAI.01205-09 IAI Accepts, published online ahead of print on 22 March 2010

on March 14, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

2

ABSTRACT

Microsporidia are eukaryotic, obligate intracellular organisms defined by their small spores

containing a single invasion organelle the polar tube which coils around the interior of the spore.

When the parasite infects host cells the polar tube is discharged from the anterior pole of the

spore where it can pierce the cell and transfer the sporoplasm into the cytoplasm of the host.

Three polar tube proteins (PTP1, PTP2 and PTP3) have been identified in this structure. The

interaction of these proteins in the assembly and function of the polar tube is not known. This

study was undertaken to examine the protein interactions of the Encephalitozoon cuniculi polar

tube proteins (EcPTPs). Immunofluorescence and immuno-electron microscopy confirmed the

co-localization of EcPTP1, EcPTP2 and EcPTP3 to the polar tube. Experiments using cross

linkers indicated that EcPTP1, EcPTP2 and EcPTP3 formed a complex in the polar tube, which

was confirmed by immunoprecipitation using EcPTP1 antiserum. Yeast two hybrid analysis

revealed that full length EcPTP1, EcPTP2 and EcPTP3 interact with each other in vivo. Both

the N- and C- termini of EcPTP1 were involved in these interactions, but not the central region

of this protein which contains a repetitive motif. Further studies of polar tube proteins and their

structural interactions may help elucidate the formation of the polar tube during the invasion

process.

Key Words: Polar tube protein, Encephalitozoon cuniculi, protein interactions, Yeast two hybrid

screening, invasion


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

3

INTRODUCTION

The Microsporidia are obligate intracellular parasitic protists [28]. While historically they

have been considered “primitive” protozoa, molecular phylogenetic analysis has led to the

recognition that these organisms are not “primitive” but degenerate protists, and that they are

most closely related to the fungi and not to protozoa [18]. The Encephalitizoonidae have

genomes under 3.0 Mb, making them among the smallest eukaryotic nuclear genomes

identified [25]. Microsporidian genome data is available at EuPathdB (http://eupathdb.org/

eupathdb/). There is a high degree of gene conservation among the Microsporidia [2].

The Microsporidia are ubiquitous in the environment and infect almost all animal phyla

(invertebrate and vertebrate hosts), including other protists. They can produce a wide range of

clinical diseases. Diarrhea associated with microsporidiosis and HIV infection was first reported

in 1985 [7]. In addition to gastrointestinal tract involvement, it has been recognized that

Microsporidia can infect virtually any organ system; causing encephalitis, ocular infection,

sinusitis, myositis, and disseminated infections [28]. The phylum Microsporidia contains more

than 1200 species distributed into over 150 genera, of which species in the following genera

cause human infections: Nosema, Pleistophora, Encephalitozoon, Enterocytozoon, Septata

(reclassified as Encephalitozoon), Anncaliia, Trachipleistophora, Brachiola (reclassified as

Anncaliia), Vittaforma and Microsporidium [28].

Microsporidia form characteristic unicellular spores that are environmentally resistant

and characteristic of the phylum; however spore size and shape vary depending on the species.

The spore coat consists of an electron-dense, proteinaceous exospore, an electron-lucent

endospore composed of chitin and protein, and an inner membrane or plasmalemma [3, 24].

Spore coat proteins have adhesion domains that may facilitate the binding of spores to either

the cell surface or mucous of the gastrointestinal tract prior to germination [22]. A defining

characteristic of all Microsporidia is an extrusion apparatus that consists of a polar filament that


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

4

coils around the sporoplasm and is attached to the inside of the anterior end of the spore by an

anchoring disk [23]. During germination, the polar filament forms a hollow tube that brings the

sporoplasm into intimate contact with the host cell providing a means of transfer of the

sporoplasm to the host cell without exposure to the extracellular environment [23]. The

mechanism by which the polar tube interacts with the host cell membrane is not known, but it

may require the participation of host cell proteins such as actin [9]. If a spore is phagocytosed

by a host cell germination can occur enabling the polar tube to pierce the phagocytic vacuole

delivering the sporoplasm into a host cell’s cytoplasm [10].

It is probable that the polar tube evolved prior to divergence of Microsporidia into

various genera, and is not the result of the convergence of independently-evolved polar tube

structures in different Microsporidia. The proteins comprising the polar tube are likely to be

members of a protein family that evolved from the same ancestral genes. The polar tube resists

dissociation in detergents, acids and chaotropic agents, but is soluble in reducing agents such

as 2-mercaptoethanol or dithiothreitol [13-18]. These solubility properties have facilitated the

development of a method for the purification of these proteins [18]. Proteomic and genetic

studies have defined some of the proteins of the polar tube and spore wall [31] as well as the

presence of O-mannosylatation on these proteins [30, 32]. Three distinct polar tube proteins

(PTPs) have been identified: PTP1, a proline-rich protein [6, 15]; PTP2, a lysine-rich protein [4],

and PTP3 a large protein over 135 kDa in size [20].

To understand the formation of the polar tube and the function of its various components

it is necessary to understand how PTP1, PTP2 and PTP3 interact with each other as well as

any other components of the polar tube. The preservation of cysteine residues in the various

PTP1s suggests that these residues may be involved in inter- and intra-protein linkages and

consequently, in the formation of the tube. As PTP1 is the major protein present in the polar

tube of the Microsporidia, we focused on studying possible interactions between this major

protein (EcPTP1) with itself and EcPTP2 and EcPTP3. In this paper, we demonstrate that


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

5

Encephalitozoon cuniculi (Ec) PTP1, EcPTP2 and EcPTP3 interact with each other using a

yeast two hybrid system, a standard genetic method for exploring protein-protein interactions.

In addition, cross linking experiments confirm the existence of a protein complex containing

EcPTP1, EcPTP2 and EcPTP3.

MATERIAL AND METHODS

Culture and production of microsporidia spores. Encephalitozoon cuniculi were cultured at

37ºC in RK13 (Rabbit Kidney cells CCL37; American Type Culture Collection, Rockville. MD) as

previously described [17]. Infected RK13 cells were maintained in continuous culture in

minimum essential medium (MEM) supplemented with 7% fetal calf serum and 1% penicillin-

sptreptomycin-amphotericin B (Invitrogen, Carlsbad, Calif.). Cultures were subpassaged every 3

weeks. Supernatants from infected flasks containing microsporodian spores were collected

twice weekly and replaced with fresh medium. Spore concentrations were determined by

counting using a hemocytometer (Improved Neubauer).

Polar Tube Protein Isolation Protocol. Polar tube proteins were isolated from other proteins

as previously described [14]. Spores (3x107) in 1% SDS were disrupted with 0.5µm acid washed

glass beads (Sigma, St. Louis, MO) for 4 minutes on a Mini beadbeater (Biospec Products,

Bartlesville,OK). The disrupted spore suspension was separated from the glass beads and

washed 5 times with 1% SDS followed by a brief wash with 9M urea to remove sporoplasm

released from broken spores and soluble spore coat proteins. The pellet was then incubated

with 0.5 ml of 2% DTT in 1xPBS (pH 7.4), 10 µg/ml of aprotinin and leupeptin (Sigma, St. Louis,

MO) and 5 mM EGTA at room temperature for 2 hours to solubilize the polar tubes. Protein

concentration was determined using the Bio-Rad protein assay (Bio-Rad, Hercules, CA).


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

6

Cloning and expression of EcPTP1, 2 and 3. DNA was prepared from E. cuniculi by

disrupting spores with 0.5µm acid washed glass beads (Sigma, St. Louis, MO) for 2 minutes on

a Mini beadbeater (Biospec Products, Bartlesville,OK) followed by routine phenol chloroform

extraction as previously published [15]. EcPTP1, without its signal sequence of 60 bases at the

5’-terminal, was amplified by PCR using the following primers (cloning and/or restriction sites

are underlined): EcPTP1 -Forward (GACGACGACAAGATGTAT TCAGCAACCGCA) and

EcPTP1 -reverse (GAGGAGAAGCCCGGTCTAGCAGCATTGG). EcPTP2 and EcPTP3

(truncated) genes were PCR amplified using primer pairs: EcPTP2-Forward-EcoR1

(GCTGAATTCGTTGTTCCACAGCCCGC), EcPTP2-Reverse- Xho1-

(CTCGAGTTACTCTAGACCCTCGCCG) and EcPTP3-Forward-EcoR1- (GGAATTCAAGC

CGCACAACC), EcPTP3-Reverse-Not1 (ATTTGCGGCCGCCTATTCCTTCTT) respectively.

PCR was performed using PCR supermix (Invitrogen, Carlsbad, CA) and the following

conditions: 40 cycles of 94 oC for 30s, 65 oC for 30s and 72 oC for 1.2 min. The amplified

EcPTP1 gene was cloned into a pET-41 Ek/LIC vector (Novagen, Gibbstown, NJ) at the ligation

independent cloning site, the EcPTP2 gene cloned into the EcoR1-Xho1 site of pGEX-4T1 and

EcPTP3 gene into the EcoR1-Not1 site of pGEX-4T1. All of the resultant vectors were

sequenced to confirm that the correct genes had been cloned and that no mutations had been

introduced by the PCR process. These vectors were transfected into BL21DE3 cells and

recombinant EcPTP1, EcPTP2 and EcPTP3 protein was expressed by overnight induction at

37°C using auto induction medium (Novagen San Diego, CA) for EcPTP1- pET-41 Ek/LIC and

1M IPTG for EcPTP2-pGEX-4T and EcPTP3-pGEX-4T.

Expressed recombinant proteins were purified by GST-affinity sepharose beads using

the manufacturer’s standard conditions following lysis of bacterial cells by sonication in lysis

reagent (50 mM tris Ph7.5, 0.1% NP40, 150 mM NaCl, 0.1 mM DTT and protease inhibitor

cocktail (Pierce Biotechnology, Rockford, IL)). The beads were then incubated with 2X gel

sample buffer in boiling water for 5 min and the eluted proteins run on a 10% SDS PAGE gel.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

7

The gels were electrotransferred to an Immobilon-P membrane (Millipore, Bedford, Mass.) using

standard conditions. Immunoblot analysis was carried out using an anti-GST monoclonal

antibody (gift of Dr. Peter Davis, Albert Einstein College of Medicine) at a 1:1000 dilution, a

peroxidase conjugated anti-mouse secondary antibody at a 1:5000 dilution (Pierce

Biotechnology, Rockford, IL) and the ECL Western Blotting Detection Reagent (Amersham

International, Buckinghamshire, United Kingdom). This confirmed the expression of and

purification of recombinant (r) proteins of the expected size for rEcPTP1, rEcPTP2 and

rEcPTP3.

Polyclonal antibody production. BALB/c mice were used to produce antibodies using

rEcPTP1, rEcPTP2 and rEcPTP3. Expressed recombinant proteins were purified by GST-

affinity sepharose beads as described above. The beads were then incubated for 5 min in

boiling water with 2X gel sample buffer and the eluted proteins run on a 10% SDS PAGE gel

which was stained with Coomassie Blue. The band containing the expressed protein was cut

out of the SDS-PAGE gel, homogenized in PBS and the polymerized acrylamide removed by

passage of the homogenate through a 0.2 µm Nalgene filter. The average concentration of

protein obtained was 1 mg per ml with a yield of about 300 µl. Purified protein was emulsified

with Hunter's TiterMax Adjuvant (CytRx, Norcross, GA) and injected into groups of 3 mice for

each protein. Each mouse received about 100 µg of recombinant protein. Four weeks later,

animals received a second injection of purified protein. Sera from injected mice were collected

a week after the last injection, aliquoted into 25 µl samples and stored at -20ºC

Immunoblot Analysis. Lysates of E. cuniculi spores were placed in 2X gel sample buffer (100

mM Tris, pH 6.8, 2% SDS, 5% ß- mercaptoethanol, 15% glycerol, 0.01% bromophenol blue)

and then separated using 10% SDS-PAGE. Gels were electrotransferred to Immobilon-P

membranes (Millipore, Bedford, Mass.) using 25 mM Tris, 480 mM glycine and 20% (vol/vol)


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

8

methanol buffer and then blocked with 5% non fat dry milk in PBS. Blots were incubated for 1

hour with antibody to rEcPTP1, rEcPTP2 or rEcPTP3 at a 1:1000 dilution, washed in PBS and

then incubated for 1 hour with alkaline phosphatase conjugated anti-mouse (Pierce

Biotechnology, Rockford, IL) at a 1:5000 dilution, washed in PBS and the reaction detected with

BCIP (bromochloroindolyl phosphate)/NBT (nitro blue tetrazolium) using standard protocols.

Electron Microscopy. E. cuniculi infected host cells were fixed for 20 min at room temperature

in 2% paraformaldehyde and 1% gluteraldehyde in PBS, rinsed 4 times in PBS. The samples

were dehydrated in 50, 70, and 85% ethanol, infiltrated with complete LR white resin, placed

into gelatin capsules with fresh LR white resin and polymerized with UV light at room

temperature for 24 hrs. The sections were collected onto formvar coated Ni grids.

For immunoelectron microscopy the sections were blocked in PBS containing 5% BSA,

5% normal goat serum, 0.001% tween-20 at 4°C overnight. Sections were then incubated in

primary antibody (anti-rEcPTP1, anti-rEcPTP2 or anti-rEcPTP3) at a 1:100 dilution in PBS

containing 5% BSA, 0.001% tween-20 at 37°C for 1 hour. The sections were then rinsed three

times in PBS, blot drying them between rinses and incubated with anti-mouse 6 nm gold

antibody (Jackson ImmunoResearch, West Grove, PA) in PBS containing 5% BSA, 0.001%

Tween-20 at 37°C for 1 hour. The sections were then rinsed three times in PBS, three times in

water and air dried overnight. All sections were then stained with 1% uranyl acetate for 30 min,

rinsed three times in water, air dried and examined using a Techni 12 electron microscope at

80-100KV. Images were recorded on Kodak 4489 film and then scanned into Adobe

Photoshop.

Immunofluorescent staining. A T25 flask of RK 13 cells infected with E. cuniculi were

harvested with Trypsin-EDTA and the cell suspension added to three Nunc two chamber sides.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

9

The slides were incubated at 37ºC for 48 hrs until the cells were 50% confluent, the culture

medium was removed, the cells rinsed in PBS, and then fixed with 4% PBS buffered formalin for

15 min., and then rinsed in PBS. Following this the slides were blocked in 10% fetal bovine

serum (FBS) in PBS for 1hr at 37ºC. The cultures at this point contained spontaneously

germinated spores as well as intact extracellular spores, intracellular proliferative life stages and

mature spores. After blocking, 100 µL of anti-rEcPTP1 diluted (1:500) in (PBS-FBS) was added

to one chamber of slide one, and one chamber of slide two. Anti-rEcPTP2 was added to one

chamber of slide three. The second chamber of slides 1 through 3 were used as controls so no

primary antibody was added to these chambers, instead a 1% solution of BSA fraction V in PBS

diluted 1:500 in PBS-FBS was substituted for the antibody. All the slides were then incubated

for 1hr at 37ºC. The chambers were then rinsed three times with PBS and incubated with goat

anti-mouse antibody labeled with horse radish peroxidase (HRP)-labeled secondary antibody

(Nanoprobes Inc., Yanpank, NY) for 1hr at 37ºC then rinsed three times with PBS. The slides

were then incubated with tyramide signal amplification reagent (Molecular Probes, Eugene, OR)

as per manufacturers instructions. Slides one and two containing anti-rEcPTP1 and their

controls were conjugated with Alexa Fluor 488 (Molecular Probes, Eugene, OR) at a 1:100

dilution for 10 minutes. Slide 3 containing anti-rEcPTP2 and its control were conjugated with

Alexa Fluor 594 (Molecular Probes, Eugene, OR) at a 1:100 dilution for 10 minutes. All the

chambers were then rinsed several times with PBS. After this first antibody staining, all the

chambers were quenched with 1% hydrogen peroxide in PBS for 5 minutes, followed by three

rinses in PBS and then they were blocked as previously described. The same procedures,

dilutions, and incubations were followed for the second antibody incubation. Both chambers of

slide one were incubated with anti-rEcPTP2, and conjugated with Alexa Fluor 594 (Molecular

Probes, Eugene, OR) at a 1:100 dilution for 10 minutes. Slide two was incubated with anti-

rEcPTP3 then conjugated with Alexa Fluor 594 (Molecular Probes, Eugene, OR) at a 1:100

dilution for 10 minutes. Slide three was incubated with anti-rEcPTP3 conjugated with Alexa


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

10

Fluor 488 (Molecular Probes). All the slides were rinsed several times with PBS, drained,

gaskets and chambers removed, and mounted in DABCO (Sigma, St. Louis, MO) and cover

slipped. After the various reactions and rinses were completed, the slides were examined on a

Zeiss Axiovert 200 using 10X, 20X, and 40X objectives in combination with bright field, phase,

and fluorescence illumination. Areas of interest were then identified on each slide and then

examined on a Zeiss LSM 510 scanning confocal microscope with a 40X high resolution

objective (Rutgers-Newark Imaging Center). Samples were illuminated with both 488 nm and

565 nm laser lines. Images were collected on a 12 bit photomultiplier tube. Pinhole settings

were 1 Airy unit for maximum resolution.

Immunoprecipitation. Protein samples were prepared by glass bead disruption of E. cuniculi

spores followed by extraction of polar tube proteins in a 2.5% SDS, 100 mM DTT solution

containing 10 µg/ml of aprotinin and leupeptin. Protein samples were diluted 50 fold in PBS

and then the diluted protein sample was incubated for 30 min on ice with 4 mM of 3,3´-Dithiobis

(sulfosuccinimidylpropionate) (DTSSP; Pierce), a water soluble homobifunctional, thiol-

cleavable and membrane impermeable cross linker. The reaction was quenched by the addition

of 1M Tris, pH 7.5 to a final concentration of 50 mM. Samples were centrifuged at 1000x g, for

30 min and were suspended in SDS sample buffer with or without 2-mercaptoethanol (25% v/v)

for analysis by SDS-PAGE or immunoblotting. As a control, the same reaction was performed

without the addition of DTSSP.

Crosslinked polar tube protein extracts prepared from E. cuniculi PTP lysates as

described above, were immunoprecipitated using anti-EcPTP1 antibody. To create the

immunoaffinity reagent, 10 µl of anti-EcPTP1 or mouse IgG was incubated overnight at 4ºC with

30 µl of protein A in 500 µl (final volume) of PBS, with agitation. The antibody-protein A affinity

reagent was then isolated by centrifugation, washed with PBS and then incubated overnight at

4ºC with 100 µg of E. cuniculi cross-linked protein lysate, with agitation. The antigen-antibody-


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

11

protein A complexes were then centrifuged, washed three times with PBS, added to 2X gel

sample buffer in boiling water for 5 min and used for SDS-PAGE. Immuoblot analysis was then

performed using anti-rEcPTP1, anti-rEcPTP2 and anti-rEcPTP3 as described above.

Yeast Two-Hybrid Analysis. Coding regions for Ec-PTP1 full length were amplified from E.

cuniculi DNA using the following primers for each construct,

Ec-PTP1-Full length-Forward-EcoRI (GTCGAATTCTATTCAGCAACCGCACTGTG);

Ec-PTP1-Full length -Reverse-XhoI (CCGCTCGAGCTAGCAGCATTGGACAGC).

EcPTP1-N-terminus-Forward- EcoRI (CGGAATTCTCAGCAACCGCACTGTGCAG); Reverse-

EcPTP1-N-terminus-SalI (ACGCGTCGACTCCCTGACACAAAGTGGCT).

Ec-PTP1-C-Terminus- Forward -EcoRI (CGGAATTCCAGGCCATGCCTAGCACTC);

Ec-PTP1-C-Terminus- Reverse –SalI (ACGCGTCGACCTAGCAGCATTGGACAGCAGT).

EcPTP1-Central: Forward - EcoRI (CCGGAATTCGGAACATCCGGTATTCCTG);

EcPTP1-Central: Reverse -SalI (ACGCGTCGACCTGTCCCTGCTGTCCAG).

Coding regions for EcPTP2 and EcPTP3 were amplified using the following constructs

Ec-PTP2-Full length-Forward-EcoRI (GTCGAATTCGTTGTTCCACAGCCCGC);

Ec-PTP2-Full length-Reverse-XhoI (CCGCTCGAGTTACTCTAGACCCTCGCGG).

Ec-PTP3-Full length: Forward-EcoRI (GGAATTCTCAAGCTCGCATGCCGTC);

Ec-PTP2-Full length-Forward-EcoRI Reverse-SalI (GTCGACCTAACGGGCTACCTTTCC).

Following amplification, each PCR product was then digested with its corresponding enzymes

and inserted into the corresponding sites in the yeast two-hybrid vectors, pAD and pBD (BD

Biosciences Clontech, San Jose, CA). The identity of all clones was confirmed by sequencing

the completed constructs.

For interaction studies, YRG-2 yeast competent cells were transformed simultaneously

with bait and prey constructs and cultured under high stringency screen according to the

manufacturer’s protocol (Strategene, LaJolla, CA). Briefly, 100 µl of competent yeast cells, 100


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

12

ug of Herring sperm DNA, 10µg of each pBD construct and pAD construct were added into a

microcentrifuge tube and gently mixed. Following this, 600 µl of TE–LiAc–PEG solution was

added, the solution was mixed by vortexing, the tube was incubated at 30ºC for 30 min with

shaking at 200 rpm, and then 70 µl of DMSO were added. The samples were then subjected to

heat-shock at 42ºC for 15 min and placed on ice for 10 min. Yeast cells were pelleted by

centrifugation at 3000 rpm for 10 seconds, resuspended in 0.5ml TE buffer and plated onto 150

mm SD-selective plates (250 µl each plate) that do not contain Leucine, Tryptophan and

Histidine. The plates were incubated at 30ºC for 2 to 4 days until colonies appeared. Constructs,

pADwt with pBDwt, were used as positive control and pADwt with pLaminC as negative control.

Several independent colonies from each interaction screen (i.e. EcPTP1:EcPTP2,

EcPTP1:EcPTP2, EcPTP2:EcPTP3 etc) were chosen and cultured on -Leu -Trp -His Ade- SD

plates at 30ºC fro 30 hours. Those colonies that grew up from Leu-, Trp-, His-, Ade- SD plates

were sequenced to confirm interacting vectors contained the genes of interest.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

13

RESULTS

Protein expression and polyclonal antibody production

EcPTP1, EcPTP2 and EcPTP3 (truncated) were expressed as fusion proteins as noted

in the material and methods section (data not shown) and polyclonal murine antibodies were

prepared using these recombinant proteins. These antisera were able to detect bands

corresponding to EcPTP1, EcPTP2 and EcTPTP3 in E. cuniculi lysate (Figure 1 top panel). No

reactivity was seen in pre-immune sera (data not shown). All of these antisera, anti-EcPTP1,

anti-EcPTP2 and anti-EcPTP2, reacted with the E. cunciuli polar tube by immuno-electron

microscopy (Figure 1 bottom panel, polar tubes indicated by arrows). By IFA, anti-EcPTP1

(figure 2A, 2G), anti-EcPTP2 (figure 2D, 2H) and anti-EcPTP3 (figure 2B, 2E) reacted with

spontaneously extruded polar tubes from E. cuniculi. These sera also reacted with polar tubes

from E. cuniculi spores germinated by exposure to 1% H2O2. The IFA staining seen with anti-

rEcPTP1, anti-rEcPTP2 and anti-rEcPTP3 overlapped suggesting that these proteins were

found at similar locations on the polar tubes (Figure 2C, 2F, 2I). In extruded spores reactivity of

these sera could sometimes be demonstrated to also occur in the residual spores and

sporoplasms, which may represent cross reactive antigens or residual PTPs in these structures.

None of the sera had reactivity to the surface of intact non-germinated spores (data not shown).

PTP1, PTP2 and PTP3 interact to form a large protein complex

When polar tube extract was cross linked using DTSSP, a water soluble chemical cross-

linker, an aggregate was formed at the top of an SDS-PAGE gel which disappeared with β-

mercaptoethanol (25% v/v) treatment which breaks the S-S bond of the cross linker (Figure 3A).

Immunoblot analysis of cross-linked proteins, immunoprecipitated with anti-rEcPTP1

demonstrates that EcPTP1, EcPTP2 and EcPTP3 are detected (Figure 3B). These data

suggest that anti-EcPTP1 was able to pull down a cross linked protein complex that included


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

14

EcPTP1, EcPTP2 and EcPTP3. We, therefore, sought to investigate which of these proteins

could associate with each other.

Yeast two hybrid studies of PTP interactions

The possibility of an interaction among the various PTPs (i.e. EcPTP1, EcPTP2 and

EcPTP3) was investigated using yeast two hybrid analysis. In these experiments, the EcPTPs

were analyzed in all possible pairwise combinations, fused to either the bait vector or prey

vector. EcPTP1, EcPTP2 and EcPTP3 full length (FL) genes were used as the bait and

EcPTP1-FL, EcPTP2-FL and EcPTP3-FL as the prey to determine if these proteins interacted in

vivo using a yeast two-hybrid system. These interactions were repeated by switching the prey

and the bait vectors. Figure 4 demonstrates that the full length EcPTP1 protein interacts, in

vivo, with full length EcPTP1, EcPTP2 and EcPTP3 and that full length EcPTP2 and EcPTP3

also interact with each other in all possible combinations. This is consistent with the hypothesis

that EcPTP1 can interact with itself in the formation of the polar tube as well as with other polar

tube proteins. It also suggests that PTP2 and PTP3 can also interact with themselves as well

as with other PTPs.

When EcPTP1 is compared to other microsporidian PTP1s including those of E. hellem

and E. intestinalis the areas of highest similarity are seen in the N-terminal and C-terminal

regions [31]. These N- and C- terminal regions contain multiple cysteines which are probably

involved in the ability of EcPTP1 to form the polar tube, as evidenced by the ability of reducing

agents, such as DTT, to solubilize this structure. The central region of the proteins which has a

repetitive motif is very different among these and the few other Microsporidia in which this gene

has been cloned. We, therefore, sought to determine if the observed interactions of EcPTP1

with itself occurs at the N- or C-terminal region of this protein. Figure 5 demonstrates that like

the full length EcPTP1, the truncated N- and C-terminal regions of EcPTP1 were able to

interact, in vivo, with each other in all possible combinations.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

15

The central region of EcPTP1, amino acids 174 to 289, contains a region with a

repeated amino acid motif. Although a repetitive motif is present in E. cuniculi, E. intestinalis

and E. hellem, it is different in each of these closely related organisms. We have hypothesized

that this region may be involved in antigenic masking of the polar tube and would not be

involved in protein-protein interactions in this structure [30, 31]. Therefore, a construct was

produced expressing the EcPTP1 central gene sequence and this was studied for its ability to

interact with the full length, N-terminal and C-terminal region of Ec-PTP1. As demonstrated in

Figure 6, the protein encoded by the central region of EcPTP1 did not interact with any of the

other constructs used in this experiment (i.e. it did not interact with EcPTP1-FL, EcPTP1-Nterm,

EcPTP1-C term, EcPTP2-FL or EcPTP3-FL). These interactions were confirmed by switching

the prey and the bait vectors. In addition, EcPTP1-central did not react with itself (Supplemental

Figure 1).

While both N-terminal and C-terminal constructs of EcPTP1 were able to interact with

each other and with full length EcPTP1 we sought to determine if each of these constructs was

able to interact with full length EcPTP2 or EcPTP3 as we had already demonstrated for full

length EcPTP1 (figure 4). As shown in figure 6, neither the N-terminal or C-terminal EcPTP1

construct interacted with EcPTP2 or EcPTP3.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

16

DISCUSSION

When it is within the spore the polar filament (tube) contains electron dense material, but

after germination it forms a hollow tube through which the sporoplasm and nucleus travels to

infect a host cell [12, 25]. It is not known if the formation of this tube is due to polymerization of

PTPs during germination at the growing tip of the polar tube or due to conformational changes

in PTPs as the polar tube unfolds at its growing tip. Understanding the formation of the polar

tube apparatus and the function of its components is essential for our understanding of spore

germination and cell invasion in the Microsporidia.

The major polar tube protein gene (ptp1) of E. cuniculi, E. hellem and E. intestinalis has

been cloned and the corresponding protein (PTP1) expressed in vitro [5-7,15]. Clones have

also been obtained for the ptp1 of several different isolates of E. hellem, G. americanus and

Anncaliia (B.) algerae [11, 19, 27, 29 and Weiss LM unpublished data]. E. hellem ptp1 is 1362

bp encoding a 453 amino acid protein with a predicted molecular mass of 43 kDa, the ptp1 of E.

cuniculi is 1188 bp encoding a 395 amino acid protein with a predicted molecular mass of 37

kDa [6, 15]; however, these proteins have post translational modifications which increase their

apparent molecular mass on electrophoresis. These two Microsporidia are in the same genus,

cannot be distinguished ultrastructurally, their polar tubes have functional identity and their

native PTP1s have similarities in overall amino acid composition, hydrophobicity, mass and

immunologic epitopes [26]; despite this their translated PTP1s have only limited identity in their

amino acid sequences. Further comparison does, however, reveal similarities. Both translated

proteins have a high number of proline and glycine residues, a similar percentage of cysteine,

and lack arginine, tryptophane and phenylalanine. The spatial distribution of both the cysteine

and proline residues is conserved in both proteins. This suggests that conservation of function

of these proteins may be provided by conservation of secondary structural motifs [26]. The N

and C-terminus of these proteins display conservation suggesting that these areas may have


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

17

important structural or functional domains. In the Encephalitzoonidae PTP1s the C-terminus is

high in cysteine residues and the last amino acid is a cysteine, which may be important for

interaction between proteins. It has been hypothesized that the interactions of PTP1 with itself

were sufficient for formation of the polar tube during germination of the spore. The data

presented in the current paper demonstrate that EcPTP1 is capable of interacting with itself and

that both the N-terminal and C-terminal regions of EcPTP1 have domains capable of interacting

with full length and truncated versions of EcPTP1.

While PTP1 is the major component of the polar tube, several other putative PTPs have

been identified. For example, PTPs of 23, 27 and 34 kDa have been identified in G.

americanus using mAbs produced to the DTT solubilized polar tube [13] and by 2D

electrophoresis several proteins can be seen in DTT solubilized E. hellem polar tube

preparations [27]. Polyclonal and monoclonal antibodies that localized to the polar tube by IFA

and immune-electron microscopy have identified putative PTPs of 34, 75, and 170 kDa in G.

atherinae, 35, 52/55, and 150 kDa in E. cuniculi, 60 and 120 kDa in E. intestinalis and 46, 34, 21

and 15 kDa in Nosema grylli [1, 4, 8]. Of these the genes for, ptp2 [5], encoding a 35-kDa E.

cuniculi protein seen on SDS-PAGE, and ptp3 [20], encoding a ∼150 kDa protein seen on SDS-

PAGE have been cloned. The N-terminal sequence of EcPTP2 has a characteristic signal

peptide (for Golgi-ER processing similar to EcPTP1), the central region contains a lysine-rich

octapeptide motif (KPKKKKSK) and the C-terminal region of 27 residues is devoid of any basic

residues and possesses 4 aspartate and 5 glutamate residues forming an acidic tail. EcPTP2

has one putative N-glycosylation site and one RGD motif (possibly involved in a protein-protein

interaction). EcPTP3 is synthesized as a 1256-amino acid precursor with a cleavable signal

peptide and is encoded by a single transcription unit (3990 bp) located on the chromosome XI of

E. cuniculi [20]. Unlike EcPTP1 and EcPTP2, EcPTP3 can be solubilized in the presence of

SDS alone without the need for a reducing agent such as DTT [20]. It has been hypothesized

that PTP3 may act as scaffolding protein for polar tube formation during development.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

18

In this paper we examined in detail the interactions of EcPTP1, EcPTP2 and EcPTP3

using yeast two hybrid analysis to verify if these polar tube proteins interact with each other and

to further define the complex of proteins present in the polar tube. As PTP1 is the major protein

present in the polar tube of the Microsporidia, we focused on studying possible interactions

between this major protein (EcPTP1) with itself and EcPTP2 and EcPTP3. Full length Ec-PTP1,

Ec-PTP2 and Ec-PTP3 were analyzed in all possible pair wise combinations, as bait or prey.

Results indicated that full length EcPTP1 interacts, in vivo, with other EcPTPs and with itself. In

addition, we demonstrated that in mature spores EcPTP1, EcPTP2 and EcPTP3 interact with

each other as demonstrated by co- immunoprecipitation. DTSSP, a chemical cross-linker,

creating disulfide linkage between proteins, was used to facilitate crosslinking. Data from SDS-

PAGE and immunoblotting (not shown) demonstrated that DTSSP caused the formation of large

protein aggregates in unreduced samples (which barely entered the gel). Once such cross

linked samples were reduced with 25% 2-mercaptoethanol separate bands were identified by

immunoblot analysis reacting with antiserum to rEcPTP1, rEcPTP2 and rEcPTP3. This

indicated the presence of all EcPTPs when the protein samples were pulled down using

antibody to EcPTP1. In addition, immunofluorescence techniques verified that EcPTP1,

EcPTP2 and EcPTP3 are located at similar positions on extruded polar tubes.

The N-terminus and C-terminus, as well as central region of PTP1 were tested in order

to determine if they might interact with full length PTP1 and with each other. The N and C-

terminus PTP1 appears to be more conserved among the various Microsporidia examined than

the central repeat region of this protein. It has been hypothesized that this indicates that the N-

and C-terminus may, therefore, contain interacting domains. Yeast 2 hybrid analyses confirmed

that both the N-and C-terminus contained domains that interacted with full length and the N- and

C terminal constructs of PTP1; however, neither the N- nor C- terminus constructs were

sufficient to allow PTP1 to interact with either PTP2 or PTP3. Full length PTP1 was able to

interact with both PTP2 and PTP3. This suggests that the interaction of the full length EcPTP1


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

19

with these other polar tube proteins may require a motif found in both the N and C terminus of

EcPTP1 or that these interactions depend on a conformational epitope only seen when the full

length EcPTP1 is expressed.

All of the cloned microsporidian PTP1s have central amino acid repeat regions that are

predominantly hydrophilic. However, the repeats are different in composition and number

among the Microsporidia. It is possible that this region is not important for the assembly of the

polar tube and may function as an immunologic mask. Analysis of ptp1 from several isolates of

E. hellem supports this view as the number of repeats in the central region of their ptp1 is

variable [11, 19, 27, 29]. In the process of evolution a similar duplication of internal sequences

has been noted in malaria and other protozoan genes and this mechanism may be operative in

the Microsporidia ptp1 [21]. Consistent with this hypothesis we could not demonstrate any

interactions of the central region of EcPTP1 with EcPTP2, EcPTP3 or with the N- or C-terminal

constructs of EcPTP1.

This study presents the first detailed examination of the interaction of the three identified

polar tube proteins (PTP1, PTP2 and PTP3) from a Microsporidia. It provides the necessary

data for more detailed analysis of these interactions by mutagenesis or other studies.

Determination of the structure of these proteins would also prove useful in understanding how

these various polar tube proteins interact to produce the versatile invasion apparatus used by

this widely disseminated parasitic protist group. As direct genetic manipulation of these

organisms has not been developed, such biochemical approaches to the analysis of these

protein interactions and the structure of the polar tube are crucial for improving our

understanding of these important pathogens.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

20

ACKNOWLEDGMENT

This work was supported by National Institutes of Health Grants AI31788 and 5R44GM064257

from the National Institute of Allergy and Infectious Diseases.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

21

FIGURE LEGENDS

Figure 1: Analysis of rPTP antisera

Top Panel: Immunoblot analysis. Protein lysates were prepared from E. cuniculi run on 10%

SDS-PAGE, transferred to nitrocellulose and examined using anti-rPTP. Anti-rEcPTP1 (1:5000

dilution), anti-rEcPTP2 (1 :5000 dilution) and anti-rEcPTP3 (1:1000 dilution). Bands

corresponding to EcPTP1, EcPTP2 and EcPTP3 were seen in the corresponding immunoblots.

No bands were seen in pre-immune sera (data not shown).

Bottom Panel: Immunoelectron microscopy. E. cuniculi spores (see materials and methods

for fixation details). (A) anti-rEcPTP1 (1:100 dilution), (B) anti-rEcPTP2 (1:100 dilution), insert is

an enlarged section of the image, and (C) anti-rECPTP3 (1:100 dilution). All of the antisera

react with the polar tube (arrows). Bar length is 600 nm. Gold particles are 6 nm.

(D) Representative negative control (pre-immune serum at 1:100 dilution), No gold labeling is

seen, EN=endospore, Ex = Exospore, ANT = anterior portion of polar filament, R = ribosomes,

Polar tube (arrows). Bar length 500 nm.

Figure 2: Immunofluorescent analysis of rPTP antibodies.

Confocal images of extruded polar tubes of E. cuniculi that were initially incubated with one of

the three polar tube antibodies anti-rPTP1, anti-rEcPTP2, or anti-rEcPTP3. After their initial

incubation with their respective antibody and tyramide signal amplified fluorescent label the

polar tubes were dual labeled with a second polar tube antibody and a tyramide fluorescent

label (see materials and methods). Control pre-immune sera did not display any reactivity in

this assay.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

22

Panel A, B, C. Merged image of an E. cuniculi polar tube incubated with anti-rEcPTP-1 (panel

A) labeled with Alexa Fluor 488 (green) and anti-rEcPTP3 (panel B) labeled with Alexa Fluor

594 (red). Panel C demonstrates the merged image. Note the presence of both red and green

signal along the polar tube and areas of yellow signal where they overlap. Bar length for the

group as shown in the first panel is 5µm.

Panel D, E, F. Merged image of an E. cuniculi polar tube incubated with anti-rEcPTP-2 (panel

D) labeled with Alexa Fluor 488 (green) and anti-rEcPTP3 (panel E) labeled with Alexa Fluor

594 (red). Panel F demonstrates the merged image. Note the presence of both red and green



Panel G, H, I. Merged image of an E. cuniculi polar tube incubated with anti-rEcPTP-1 (panel

G) labeled with Alexa Fluor 488 (green) and anti-rEcPTP2 (panel H) labeled with Alexa Fluor

594 (red). Panel I demonstrates the merged image. Note the presence of both red and green



Figure 3. EcPTP1, EcPTP2 and EcPTP3 form a protein complex.

Panel A: SDS PAGE analysis. Coomassie blue stained gel of protein samples made from E.

cuniculi spores, cross-linked with 4 mM DTSSP, without (-) or with (+) treatment with β-

mercaptoethanol (25% v/v). Protein markers are in kDA. A large complex (arrow) at the top of

the gel disappears with mercaptoethanol treatment.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

23

Panel B Immunoprecipitation analysis. Protein samples were extracted from E. cuniculi,

cross-linked with DTSSP, then immunoprecipitated with a control anti-mouse IgG (lane 2) or

with anti-rEcPTP1 (lane 3). Lane 1 is the protein markers (kDa standards). Immunoprecipitates

were treated with gel sample buffer (containing reducing agents) and run on 12% SDS-PAGE,

transferred to nitrocellulose and probed with anti-rEcPTP1 (1:2000), anti-rEcPTP2 (1:2000) or

anti-rEcPTP3 (1:2000). Reactions were detected with an alkaline phosphatase conjugated anti-

mouse IgG (1:5000) and detected with BCIP/NBT. Anti-rEcPTP1 was able to precipitate a

complex which contained EcPTP1, EcPTP2 and EcPTP3. The control antiserum did not

precipitate this complex.

Figure 4: Yeast two hybrid analysis of PTP interactions. This demonstrates the interactions

of pAD and p BD (bait and prey) constructs containing full length EcPTP1, full length Ec-PTP2

and full length Ec-PTP3. The negative control pBDwt/pADplasminC and positive control

pBDwt/pADwt reactions are provided. This demonstrates that all three EcPTPs can interact

with themselves and each other, although the domains responsible for this interaction remain to

be determined.

Figure 5: Yeast two hybrid analysis of the interaction of EcPTP1 N-terminal and C-

terminal domains. This demonstrates the interactions of pAD and p BD (bait and prey)

constructs containing full length EcPTP1 (EcPTP-FL), N terminal Ec-PTP1 (EcPTP-NT) and C

terminal Ec-PTP1 (EcPTP-CT). The negative control pBDwt/pADplasminC and positive control

pBDwt/pADwt reactions are provided. This demonstrates that both the N- and C-terminal

regions of EcPTP1 can interact with each other and themselves.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

24

Figure 6: Yeast two hybrid analysis of the interactions of the EcPTP1 N-terminal, C-

terminal and central repeat domains with EcPTP2 and EcPTP3.

Panel A. Interactions between EcPTP1-FL as a bait, and EcPTP1-FL (1), EcPTP1-NT (2),

EcPTP1-Cent (3), EcPTP1-CT (4) as a prey.

Panel B Interactions between EcPTP2-FL, as a bait and EcPTP1-FL (1), EcPTP1-NT (2),

EcPTP1-Cent (3), EcPTP1-CT (4) as a prey

Panel C. Interactions between EcPTP3-FL, as a bait and EcPTP1-FL (1), EcPTP1-NT (2),

EcPTP1-Cent (3), EcPTP1-CT (4) as a prey

A positive control (pBDwt/pADwt), (P) and a Negative control (pBDwt/pADplasminC) (N) are

shown in each group.

This demonstrates that the central region of EcPTP1 (EcPTP1-Cent) does not contain any

interacting domains. In addition, while EcPTP1FL can interact with either EcPTP3FL or

EcPTP2FL, neither the N-terminal or C-terminal domains are sufficient for this interaction to

occur.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

26

REFERENCES

1. Beckers, P.J., Derks, G.J., Gool, T., Rietveld, F.J., and R. W. Sauerwein. 1996.

Encephalitozoon intestinalis-specific monoclonal antibodies for laboratory diagnosis of

microsporidiosis. J Clin Microbiol 34, 282-285.

2. Corradi, N., Akiyoshi, D.E., Morrison, H.G., Feng, X., Weiss, L.M., Tzipori, S., and

P.J. Keeling. 2007. Patterns of genome evolution among the microsporidian parasites

Encephalitozoon cuniculi, Antonospora locustae and Enterocytozoon bieneusi. PLoS

ONE. 2:e1277.

3. Cali, A., Weiss, L.M., and P.M. Takvorian. 2002. Bracheola algerae spore membrane

systems, their activity during extrusion, and a new structural entity, the multilayered

interlaced network, associated with the polar tube and the sporoplasm. J. Eukaryot.

Microbiol. 49, 164-174.

4. Delbac, F., Duffieux, F., David, D., Metenier, G., and C. P. Vivares. 1998.

Immunocytochemical identification of spore proteins in two microsporidia, with emphasis

on extrusion apparatus. J Eukaryot Microbiol 45, 224-231.

5. Delbac, F., Peuvel, I., Metenier, G., Peyretaillade, E.,and C. P. Vivares. 2001.

Microsporidian invasion apparatus: identification of a novel polar tube protein and

evidence for clustering of ptp1 and ptp2 genes in three Encephalitozoon species. Infect

Immun 69, 1016-1024.

6. Delbac, F., Peyret, P., Metenier, G., David, D., Danchin, A., and C.P. Vivares, C.P.

1998. On proteins of the microsporidian invasive apparatus: complete sequence of a

polar tube protein of Encephalitozoon cuniculi. Mol Microbiol 29, 825-834.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

27

7. Desportes, I., Le Charpentier, Y., Galian, A., Bernard, F., Cochand-Priollet, B.,

Lavergne, A., Ravisse, P., and R. Modigliani. 1985. Occurrence of a new

microsporidian: Enterocytozoon bieneusi n. g., n. sp., in the enterocytes of a human

patient with AIDS. J Protozool 32:250-245.

8. Dolgikh, V.V. and P.B. Semenov, P.B., 2003. The spore wall and polar tube proteins of

the microsporidian Nosema grylli: the major spore wall protein is released before spore

extrusion. Tsitologiia 45, 324-329.

9. 34. Foucault, C., and M. Drancourt. 2000. Actin mediates Encephalitozoon intestinalis

entry into the human enterocyte-like cell line, Caco-2. Microb Pathog 28:51-58

10. .Franzen C. 2005. How do microsporidia invade cells? Folia Parasitol (Praha). 52:36-

40.

11. Haro, M., Del Aguila, C., Fenoy, S., and N. Henriques-Gil. 2003. Intraspecies

genotype variability of the microsporidian parasite Encephalitozoon hellem. J Clin

Microbiol 41, 4166-4171

12. Ishihara, R. 1968. Some observations on the fine structure of sporoplasm discharged

from spores of a microsporodia, Nosema bombycis. J. Invert. Pathol. 12; 245-258.

13. Keohane, E., Takvorian, P.M., Cali, A., Tanowitz, H.B., Wittner, M., and L. M. Weiss.

1994. The identification and characterization of a polar tube reactive monoclonal

antibody. J Eukaryot Microbiol 41, 48S.

14. Keohane, E.M., Takvorian, P.M., Cali, A., Tanowitz, H.B., Wittner, M., and L. M.

Weiss. 1996. Identification of a microsporidian polar tube protein reactive monoclonal

antibody. J Eukaryot Microbiol. 43:26-31.

15. Keohane, E.M., Orr, G.A., Zhang, H.S., Takvorian, P.M., Cali, A., Tanowitz, H.B.,

Wittner, M., and L. M. Weiss. 1998. The molecular characterization of the major polar

tube protein gene from Encephalitozoon hellem, a microsporidian parasite of humans.

Mol Biochem Parasitol 94, 227-236.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

28

16. Keohane, E.M., and L. M. Weiss, L.M. 1998. Characterization and function of the

microsporidian polar tube: a review. Folia Parasitol 45, 117-127.

17. Keohane, E.M., Orr, G.A., Takvorian, P.M., Cali, A., Tanowitz, H.B., Wittner, M., and

L. M. Weiss. 1999. Polar tube proteins of microsporidia of the family

.Encephalitozoonidae. J Eukaryot Microbiol 46, 1-5.

18. Lee, S.C., Corradi, N., Byrnes, E.J. 3rd, Torres-Martinez, S., Dietrich, F.S., Keeling,

P.J., and J. Heitman. 2008. Microsporidia evolved from ancestral sexual fungi. Curr

Biol. 18:1675-9.

19. Peuvel, I., Delbac, F., Metenier, G., Peyret, P., and C. P. Vivares. 2000.

Polymorphism of the gene encoding a major polar tube protein PTP1 in two

microsporidia of the genus Encephalitozoon. Parasitology 121 Pt 6, 581-587.

20. Peuvel, I., Peyret, P., Metenier, G., Vivares, C.P., and F. Delbac. 2002. The

microsporidian polar tube: evidence for a third polar tube protein (PTP3) in

Encephalitozoon cuniculi. Mol Biochem Parasitol 122, 69-80.

21. Rich, S.M., and F. J. Ayala. 2000. Population structure and recent evolution of

Plasmodium falciparum. Proc Natl Acad Sci U S A 97, 6994-7001.

22. Takvorian, P., Weiss L.M., and A. Cali. 2005. The early events of Brachiola algerae

(Microsporidia) infection: spore germination, sporoplasm structure, and development

within host cells. Folia Parasitologica 52, 118-129.

23. Southern, T.R., Jolly, C.E., Lester, M.E., and J. R. Hayman. 2007. EnP1, a

microsporidian spore wall protein that enables spores to adhere to and infect host cells

in vitro.Eukaryot Cell. 6:1354-1362

24. Vavra J. 1976. Structure of the microsporidia. In: Bulla LA Jr, Cheng TC, eds.,

Comparative Pathobiology, v. 1. New York: Plenum Press; 1-85.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

29

25. Vivares, C.P., and G. Metenier. 2000. Towards the minimal eukaryotic parasitic

genome. Curr Opin Microbiol 3:463-467.

26. Weidner, E. 1972. Ultrastructural study of microsporidian invasion into cells. Z.

Parasitenkd. 40:227-242

27. Weiss, L.M., 2001. Microsporidia: emerging pathogenic protists. Acta Trop 78, 89-102.

28. Wittner, M., and L.M. Weiss. 1999. The microsporidia and microsporidiosis. ASM

Press, Washington, D.C. 1-553.

29. Xiao, L., Li, L., Visvesvara, G.S., Moura, H., Didier, E.S., and A. A. Lal. 2001.

Genotyping Encephalitozoon cuniculi by multilocus analyses of genes with repetitive

sequences. J Clin Microbiol 39, 2248-2253.

30. Xu, Y., Takvorian, P.M., Cali, A., Orr, G., and L. M. Weiss. 2004. Glycosylation of the

major polar tube protein of Encephalitozoon hellem, a microsporidian parasite that

infects humans.Infect Immun. 72:6341-6350

31. Xu, Y., and L. M. Weiss. 2005. The microsporidian polar tube: a highly specialised

invasion organelle. Int J Parasitol. 35:941-53.

32. Xu, Y., Takvorian, P., Cali, A., Wang, F., Zhang, H., Orr, G., and L. M. Weiss. 2006.

Identification of a new spore wall protein from Encephalitozoon cuniculi .Infect Immun.

74:239-247


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

downloaded from on july 14, 2020 by guest · 3/22/2010 · clinical diseases. diarrhea associated...

Documents