downloaded from on april 2, 2020 by guest › content › aem › early › 2012 › 05 › 13 ›...

1

Adhesion and bacteriocin production by Lactobacillus salivarius influence the intestinal 1 epithelial cell transcriptional response. 2 3 4 John O’Callaghan1, 2, Ludovica F. Buttó1, 2, John MacSharry2, Kenneth Nally2, and Paul W. 5 O’Toole1, 2* 6 7 8 Department of Microbiology 1, Alimentary Pharmabiotic Centre 2, University College Cork, 9 Ireland. 10 11 12 * For correspondence. Email: [email protected]; Tel. (+353) 21 490 3997; Fax: (+353) 21 13 4903101. 14 15 16 Running title: Epithelial cell response to Lactobacillus salivarius 17 Keywords: Lactobacillus salivarius, bacteriocin, epithelium, signaling, inflammation, 18 adherence 19 20

Copyright © 2012, American Society for Microbiology. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.00507-12 AEM Accepts, published online ahead of print on 18 May 2012

on July 24, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

http://aem.asm.org/

2

Abstract 21 Lactobacillus salivarius strain UCC118 is a human intestinal isolate that has been extensively 22 studied for its potential probiotic effects in human and animal models. The objective of this 23 study was to determine the effect of Lb. salivarius UCC118 on gene expression responses in 24 the Caco-2 cell line, to improve understanding of how the strain might modulate intestinal 25 epithelial cell phenotypes. Exposure of Caco-2 cells to UCC118 led to the induction of 26 several human genes (TNFAIP3, NFKBIA and BIRC3) that are negative regulators of 27 inflammatory signaling pathways. Induction of chemokines (CCL20, CXCL-1 and CXCL-2) 28 with anti-microbial functions was also observed. Disruption of the UCC118 sortase gene srtA 29 causes reduced bacterial adhesion to epithelial cells. Transcription of three mucin genes was 30 reduced significantly when Caco-2 cells were stimulated with the ΔsrtA derivative of 31 UCC118 compared to cells stimulated with the wild-type, but there was no significant change 32 in the transcription levels of the anti-inflammatory genes. UCC118 genes that were 33 significantly up-regulated upon exposure to Caco-2 cells were identified by bacterial genome 34 microarray and consisted primarily of two groups of genes connected with purine 35 metabolism, and the operon for synthesis of the Abp118 bacteriocin. Following incubation 36 with Caco-2 cells, the bacteriocin synthesis genes were transcribed at higher levels in the 37 wild type than in the ΔsrtA derivative. These data indicate that Lb. salivarius UCC118 38 influences epithelial cells both through modulation of the inflammatory response and by 39 modulation of intestinal cell mucin production. Sortase-anchored cell surface proteins of Lb. 40 salivarius UCC118 have a central role in promoting the interaction between the bacterium 41 and epithelial cells. 42 43


.asm.org/

Dow

nloaded from

http://aem.asm.org/

3

The intestinal microbiota of humans is a dynamic community of several thousand phylotypes 44 that changes in composition throughout the life-span, and also in some disease states 45 (reviewed in ref. (32)). While the link between the microbiota and conditions such as 46 obesity (23), colitis (15) and irritable bowel syndrome (19) is not yet understood at a precise 47 mechanistic level, some elements in the microbiota have been shown to exert direct anti-48 inflammatory activity in animal models (41). Elucidating the mechanistic details of the 49 interaction between the innate immune system and the commensal intestinal microbiota is 50 crucial if the molecular basis for the anti-inflammatory effects of the gut microbiota is to be 51 understood. In addition, in order to rigorously validate the efficacy of putative probiotic 52 bacteria, it is necessary to identify biomarkers for probiotic function that may be used to 53 demonstrate that a particular product is effective (34). 54 The primary site of interaction between the host immune system and the gut 55 microbiota is the intestinal epithelium which is one cell thick, and which forms a physical 56 barrier between the gut contents and the immune cells in the underlying lamina propria (50) . 57 The epithelium consists of several different types of differentiated epithelial cell; the most 58 predominant of which is the enterocyte that forms the structural epithelium in which the other 59 cell types are located. Secreted mucins are a significant factor in restricting access of 60 bacterial cells to the epithelial cells (21). The secreted mucin layer covers the epithelia of the 61 stomach, the small intestine and the colon (26). One of the main functions of the mucin layer 62 is to limit contact between microbes present in the intestinal lumen and the epithelial cells. 63 Sampling of the intestinal bacteria through the epithelium occurs via specialised epithelial M-64 cells and dendritic cells (12). The main function of enterocytes is digestion and barrier 65 function, thus maintaining intestinal homeostasis. The tight junction complexes between 66 neighboring enterocytes are required to maintain this cell-cell barrier function. Increased 67


.asm.org/

Dow

nloaded from

http://aem.asm.org/

4

intestinal permeability, where there is reduced tight junction complexes, is associated with 68 chronic intestinal inflammation in conditions such as Ulcerative colitis (UC) or Crohn’s 69 disease (CD) (20) and these conditions are often characterized by the presence of higher 70 numbers of bacteria in association with the epithelium (17, 44). It has been reported that 71 some probiotic bacteria modulate mucin gene expression, which could enhance the barrier 72 function of the mucus layer (6). 73 The ability to adhere to the intestinal epithelium is critical for probiotic function, and 74 laboratory adhesion assays using cultured epithelial cells are a common means of assessing 75 this putative probiotic functionality of a particular strain (13,28,54). Bacterial surface 76 proteins are reported to have a role in the adhesion of probiotic bacteria to the host intestinal 77 cells (4, 47). One class of bacterial surface proteins are those anchored by the sortase enzyme 78 (29). A srtA deletion mutant of L. salivarius UCC118 adhered to Caco-2 cells (47) and AGS 79 gastric cells (36) at significantly lower levels than the wild-type strain. The sortase dependent 80 proteins of UCC118 have previously been studied in this laboratory (49) and they include two 81 Mucus Binding Proteins, LspA (lsl_0311) and LspC (lsl_1335), and a third (lsl_0152) that is 82 a pseudogene. These gene products, in particular, could contribute to colonization of the 83 intestinal epithelium in vivo through interaction with the epithelial mucus layer. 84 Recent studies have described the effect of Lb. plantarum on intestinal gene 85 transcription in vivo and reported that a number of NF-κB modulation pathways were 86 induced (46). However, the precise nature of the response depended on the growth phase of 87 the cells, with dead or stationary phase bacteria being more efficient at eliciting an anti-88 inflammatory response. Another study compared Lb. acidophilus, Lb. casei and Lb. 89 rhamnosus using a similar infusion and sampling protocol. Each individual species elicited a 90 distinctive immune response, but the differences between the responses elicited by the same 91


.asm.org/

Dow

nloaded from

http://aem.asm.org/

5

species in different subjects were greater than the variation between the response to different 92 strains in the same subject (45). 93 An alternative model is to use cultured epithelial cells. For example, exposure of 94 Caco-2 epithelial cells to Lb. rhamnosus induced NF-κB regulatory pathways (22) and also 95 inhibited IκBα degradation and decreased TNF-α induced IL-8 secretion (53). In the 96 intestinal epithelial cell (IEC) line HT-29, several anti-inflammatory effects were identified 97 including a reduction of TNF-α induced IL-8 secretion by Lb. bulgaricus (1), and modulation 98 of TLR expression together with induction of innate immune system pathways by Lb. 99 plantarum and Lb. rhamnosus GG (49). These and other studies indicate that while being a 100 relatively simplified model (compared to in vivo studies) for studying commensal-epithelium 101 interactions, the use of cultured IECs remains an indispensable method of investigating 102 probiotic-epithelium interaction, particularly where multiple strains are to be screened. 103 Lb. salivarius UCC118 was originally isolated from the terminal ileum of a healthy patient. 104 This strain has been extensively studied as a potential probiotic organism and there have been 105 a number of reports of beneficial effects including anti infectivity (9) anti-inflammation (39) , 106 amelioration of the effects of induced rheumatoid arthritis (RA) in mice (38) and reduction of 107 Helicobacter pylori induced IL-8 secretion by AGS gastric cells (37). To investigate the 108 molecular basis for altered host phenotype, we used microarrays to measure differential gene 109 expression in both epithelial and bacterial cells following exposure of Lb. salivarius UCC118 110 to Caco-2 epithelial cells. 111


.asm.org/

Dow

nloaded from

http://aem.asm.org/

6

MATERIALS AND METHODS. 112 113 Bacterial strains and growth conditions. Lactobacillus salivarius UCC118 and its 114 derivative strains were routinely cultured on deMan, Rogosa and Sharpe (MRS) medium (10) 115 at 37˚C in the presence of 5% CO2. 116 The human colonic carcinoma cell line Caco-2 (ATCC No. HTB-37) was grown on 117 Dulbecco’s Modified Eagles Medium (35), supplemented with Fetal Bovine Serum (10%) 118 and non-essential amino acids (1%) penicillin 100U/ml and streptomycin 100mg/ml were 119 added for routine cell culture. The cells were grown at 37°C in the presence of 5% CO2 and 120 when the cells became confluent the cultures were passaged by the addition of trypsin EDTA 121 followed by appropriate dilution in fresh DMEM medium. 122 Exposure of Caco-2 cells to Lb. salivarius. For measurement of Caco-2 123 transcriptional changes, the cells were grown for 12 days in 6-well tissue culture plates to 124 allow full differentiation to occur. The cultures were fed by removing the culture medium by 125 aspiration at 72 hour intervals and replacing with fresh DMEM. At 12 hours prior to addition 126 of the bacteria, the medium was aspirated and replaced with antibiotic free DMEM, two 127 hours prior to addition of the bacterial cells the medium was again removed and replaced by 128 fresh antibiotic free DMEM. Overnight cultures of Lb. salivarius UCC118 and its derivatives 129 were washed twice and resuspended in phosphate buffered saline (PBS) and the optical 130 density at 600nm (OD600nm) of the suspension was determined. The viable cell count of the 131 suspension was estimated from a previously prepared standard curve that related optical 132 density to viable cell numbers from which it was determined that a cell suspension with an 133 OD600nm of 1.0 contained 2x108 CFU/ml. Caco-2 cell cultures in 6-well plates were 134 previously determined to contain, on average, 2x106 viable cells per well; the amount of 135


.asm.org/

Dow

nloaded from

http://aem.asm.org/

7

bacterial suspension added was adjusted so that a multiplicity of infection (MOI) of 10:1 was 136 achieved. The plates were incubated at 37°C for 4 hours in the presence of 5% CO2 after 137 which the growth medium was removed by aspiration and the epithelial cells were lysed by 138 the addition of 1 ml of TRIZOL. The TRIZOL lysates were frozen at -70°C until required. 139 For the measurement of bacterial gene transcription, the Caco-2 cells were seeded in 140 T75 tissue culture flasks and grown for 12 days to allow complete differentiation. The 141 medium was changed twice to remove all traces of antibiotics prior to addition of the 142 bacteria. A higher MOI of 100:1 was used to ensure that bacterial cell numbers were high 143 enough to give sufficient yields of RNA and the cultures were harvested following 90 144 minutes of exposure by aspirating the DMEM medium and replacing it with 2ml of 145 RNAprotect reagent (Qiagen). The tissue culture monolayer was scraped into suspension 146 using a cell scraper and placed in a microfuge tube in 1ml aliquots. The tubes were 147 centrifuged, excess RNAprotect was removed and the pellets were frozen at -80°C until 148 required. 149 RNA extraction. RNA was extracted from all samples using TRIZOL reagent. For 150 the Caco-2 cells, RNA was extracted from the TRIZOL lysates by adding 0.5ml of glass 151 beads and 200μl chloroform to the lysate in a screw-topped microfuge tube and 152 homogenizing for 40 seconds in a Bead-Beater (Bio-Spec). The tubes were then centrifuged 153 at maximum speed in a microcentrifuge tube for 10 minutes after which the upper layer was 154 removed, mixed with ethanol to obtain final concentration of 35% v/v ethanol and the tubes 155 were mixed thoroughly. The ethanol/lysate mixture was applied to a purification column 156 from a ‘Totally RNA Isolation Kit’ (Agilent) and centrifuged to bind the RNA to the column. 157 The manufacturer’s protocol was followed for the remainder of the isolation. The eluted RNA 158


.asm.org/

Dow

nloaded from

http://aem.asm.org/

8

was frozen at -80°C until required. cDNA was synthesized from the RNA using MMLV 159 reverse transcriptase (Fermentas). 160 To extract RNA from the pelleted bacterial cells in RNAprotect, the pellets were 161 resuspended in 250μl TE buffer containing 10mg/ml lysozyme and 25 units of mutanolysin 162 and incubated for 45 min at 37°C. Following incubation 750μl of TRIZOL LS was added to 163 the lysis buffer together with 0.5ml of acid washed glass beads. The mixture was subjected to 164 3 x 40sec cycles of mechanical disruption in a beadbeater with incubation on ice between 165 each cycle of homogenization. Following homogenization 200μl of chloroform was added 166 and the mixture was shaken followed by centrifugation at 13,200rpm for 15 minutes in a 167 microcentrifuge. The upper phase was removed and had 100% ethanol added to a final 168 concentration of 35% followed by thorough mixing. The mixture was added to a RNA 169 purification column from an Agilent/Stratagene ‘Totally RNA’ isolation kit and the 170 manufacturer’s instructions followed as described above. cDNA was synthesized using 171 MMLV-reverse transcriptase (Fermentas). 172 Microarray hybridization and analysis. Labelling of cDNA with Cy3 and Cy5 dyes 173 for use in microarray experiments was done using a chemical labelling kit (Kreatech), 174 following the manufacturer’s instructions. The efficiency of labeling was determined using a 175 nanodrop spectrophotometer. Labeled cDNA was either used immediately or stored at -80°C 176 until required. Slides were hybridized for 16h at 55°C and scanned using an Agilent 177 Microarray Scanner System (G2505B) with Agilent scan control software version 7.0 for the 178 44k microarray at a resolution of 5 μm. Agilent feature extraction software version 9.1 was 179 used to process the image file from the scanner and the extracted data was further processed 180 using an in-house microarray transform platform which performed the following 181 manipulations: (a) The replicate values for each gene were combined and the mean was 182


.asm.org/

Dow

nloaded from

http://aem.asm.org/

9

calculated, (b) outliers were identified using the Grubbs test as follows: the Z-value (|mean-183 x|)/sd, (where x is the ratio of a spot and sd is the standard deviation) was calculated, if the Z-184 value was greater than (N-1)/ (N)2, where N is the number of spots analysed, then the spot is 185 an outlier. (c) The p-value for each gene was calculated using a Cyber-T test (2) the 186 parameters for the cyber-t test were as follows, a Bayes t-test was used with a betafit of 1, a 187 winsize of 101 and a confidence level of 10. The log transformed mean from the cyber-t test 188 was then converted to non-exponential numbers to give a value for up- or down-fold 189 regulation. Genes were selected as being significantly changed in expression if their fold 190 change in Cy3/Cy5 ratio was >2 and where the p-value was < 0.0001. 191 The human genome microarrays used for this study were Agilent Whole human 192 genome (4x44k) microarrays (catalog number G4112F). The Lactobacillus salivarius 193 microarrays were Agilent custom microarrays with 3 probes per gene and 7 replicates per 194 probe. All microarray results are the means of a minimum of at least 3 biological replicates. 195 qRT-PCR confirmation of changes in gene expression. Nucleic acid concentration 196 was quantified using NanoDrop ND-1000 spectrophotometer (Thermo Scientific). 197 Complementary DNA (cDNA) was synthetized using 300ng of RNA incubated with 3.2µg of 198 random hexamers, 0.5µl of Transcript Reverse Transcriptase (Roche), 0.5µl of Protector 199 RNAse inhibitor, 1mM dNTPs mix, 4µl of Transcriptor RT Reaction Buffer, in a final 200 volume of 20µl. Template and random primers were incubated at 65°C for 10min, then the 201 other components were added and the mix was incubated at 55°C for 30min. Transcript 202 Reverse Transcriptase was inactivated by heating to 85°C for 5min. 203

PCR primers and probes were designed using the Universal ProbeLibrary Assay 204 Design Centre. Primers, sequence and probe combinations are listed in Table 1. 205


.asm.org/

Dow

nloaded from

http://aem.asm.org/

10

β-actin, GAPDH and TBP were used as housekeeping genes to correct for variability in the 206 starting total RNA. Amplification reactions contained 2.5µl of cDNA, 5ul of 2X SensiMix II 207 Probe Buffer (Bioline), 5pmol/µl (20nM) of each primer and probe mix and were brought up 208 to a total of 10µl by the addition of RNase-free water. 209 All reactions were performed in duplicate in 384-well plates on the LightCycler®480 System 210 (Roche). Positive and negative controls were included in each run. Thermal cycling 211 conditions applied were as recommended by the manufacturer (Roche). The 2-ΔΔCt method 212 (24) was engaged to calculate relative changes in gene expression. 213 Statistical analysis. Statistical analysis was carried out using GraphPad Prism for 214 Windows (version 5.03; GraphPad Software, San Diego, CA). Differences between two 215 groups were calculated using an Unpaired student’s t-test. Differences between three or 216 more groups were analysed by analysis of variance (ANOVA) with Bonferroni’s post-hoc 217 test. Differences were considered significant at p ≤0.05. 218 Accession numbers for microarray data. The data for all microarray experiments 219 has been deposited in the EBI ArrayExpress database. The accession numbers for the array 220 data are as follows; E-MEXP-3607 (Gene expression in UCC118 following exposure to 221 Caco-2 cells), E-MEXP-3616 (Gene expression in the ΔSrtA mutant and UCC118 in response 222 to Caco-2 cells), E-MEXP-3597, (Gene expression in Caco-2 cells following exposure to 223 UCC118) and E-MEXP-3614 (Gene expression in the Caco-2 cells in response to the 224 ΔSrtA negative mutant). 225 226 227


.asm.org/

Dow

nloaded from

http://aem.asm.org/

11

RESULTS AND DISCUSSION. 228 Exposure to L. salivarius UCC118 alters innate immunity gene expression in 229 Caco-2 cells. Human genes whose expression levels changed significantly following 230 exposure to bacterial cells are listed in Table 2. Although relatively few genes were 231 differentially expressed, those that passed statistical cut-offs for significance all have putative 232 roles in the regulation of the innate immune system, particularly in the down-regulation of the 233 NF-κB mediated response, through the enhanced transcription of inhibitors of NF-κB 234 activity. In that regard, the data is resonant with that derived in vivo by other workers (46), 235 whereby there was little induction of specific immune system effector genes, but rather a 236 number of regulatory genes were upregulated. Thus, the effect of Lb. salivarius on the innate 237 immune phenotype of epithelial cells does not appear to involve the direct activation of a 238 typical inflammatory response but rather the selective induction of an immune-regulatory 239 response. 240 The epithelial gene displaying the greatest fold expression change following L. 241 salivarius exposure was CCL20 (also known as Macrophage Inflammatory Protein-3, 242 MIP3A), which was up-regulated 38.2-fold as measured by microarray, and 20-fold by 243 qPCR. The substantial up-regulation of this gene by L. salivarius UCC118 concords with 244 previous studies in which UCC118 failed to suppress baseline CCL20 production, or 245 pathogen-induced induction of CCL20, in HT29 epithelial cells (39). Another study indicated 246 that L. salivarius UCC118 increased the secretion of CCL20 in AGS gastric epithelial cells in 247 response to Helicobacter pylori (37). It is thus consistent to say based on data from the 248 current investigation and the two earlier studies cited that induction of CCL20 is a 249 reproducible response by epithelial cells to stimulation by L. salivarius UCC118. This raises 250 the intriguing possibility that induction of CCL20, which is known to have antimicrobial 251


.asm.org/

Dow

nloaded from

http://aem.asm.org/

12

properties (43,52) is a probiotic trait of L. salivarius UCC118, in which it triggers a host 252 antimicrobial response. Further supporting this possibility, the array data showed that the 253 gene for the chemokine CXCL1 was also substantially up-regulated (13-fold by microarray 254 and 47-fold by qPCR), as was the gene for another chemokine CXCL2 (6.4- and 4.5-fold in 255 the array and qPCR data, respectively). Both of these chemokines have inherent antimicrobial 256 properties (52) similar to those of CCL20. Furthermore, these chemokines have an important 257 role in neutrophil attraction and have been implicated in the prevention of infection in the 258 lung epithelium (7). Induction of these genes by L. salivarius UCC118 may therefore 259 contribute to a generalized activation of the innate immune response in the epithelium (see 260 also below). 261 The TNFAIP3 gene, which was up-regulated 5.5-fold according to microarray 262 measurements following exposure to UCC118, encodes an important immune-regulator that 263 has functions in the negative regulation of NF-κB and apoptosis. Deletion of TNFAIP3 in 264 mice leads to a plethora of immunological defects including increased susceptibility to 265 intestinal inflammation and rheumatoid arthritis (48). UCC118 has been reported to 266 ameliorate the effects of colitis and collagen induced arthritis in mice (Sheil et al., 2004), so it 267 is noteworthy that TNFAIP3 has a demonstrated role in suppressing rheumatoid arthritis and 268 intestinal inflammation. In addition to TNFAIP3, two other NF-κB regulatory genes were up-269 regulated, NFKBIA (5.4-fold) and BIRC3 (6.1-fold). NFKBIA is one of the most important 270 negative regulators of NF-κB in that it interacts directly with the NF-κB transcription factor 271 subunits, p65/p50 heterodimers, sequestering them in the cytoplasm and preventing their 272 translocation to the nucleus. BIRC3 (cIAP2), in contrast, is an NF-κB target gene that is an 273 inhibitor of apoptosis and whose expression in epithelial cells is likely to protect against 274 cytokine-induced apoptosis (51). It has been demonstrated that mice defective in Birc3 are 275


.asm.org/

Dow

nloaded from

http://aem.asm.org/

13

more susceptible to DSS-induced colitis (3), so the induction of BIRC3 gene expression by L. 276 salivarius UCC118 may be relevant for the previously reported protective effect of this strain 277 against DSS-induced colitis in mice (38). 278 The ZC3H12A gene was up-regulated 5.7 – fold in Caco-2 cells stimulated with 279 UCC118. The ZC3H12A gene product, MCP-1-induced protein 1 (MCPIP), is an important 280 immune regulator essential for the prevention of lethal autoimmune responses in mice (25). It 281 has been clearly demonstrated that in addition to a macrophage-associated anti-inflammatory 282 function, Zc3H12A also has a substantial inhibitory effect on NF-κB (40). Up-regulation of 283 Zc3H12A expression by epithelial cells in response to UCC118 is potentially mechanistically 284 relevant for the signaling involved in the demonstrated anti-inflammatory properties of 285 UCC118 (30, 38 ). 286 The combined induction of the NF-kBIA inhibitor, together with TNFAIP3 and 287 ZC3H12A, suggests that although NF-κaB target genes such as BIRC3 (and the chemokines 288 CCL20, CXCL1 and CXCL2) are up-regulated by UCC118, the net effect is to tilt the NF-κB 289 regulatory system towards attenuating the NF-κB response. In this respect, benefits ascribed 290 to probiotics may function similarly to amelioration of induced colitis, whereby a moderate 291 NF-κB response is beneficial by way of inducing anti-apoptopic genes such as BIRC3, while 292 a more severe response would be harmful. It is becoming apparent that in terms of intestinal 293 protection, NF-κB activity is in effect a double edged sword in that a high level of up-294 regulation will lead to profound inflammation, but a tightly regulated level of activity of NF-295 κB and of its target genes is critical for proper epithelial function in which the epithelial cells 296 can mount a measured and proportionate response to commensal microorganisms (42). 297 L. salivarius surface proteins are involved in modulating epithelial mucin gene 298 expression. We compared the epithelial cell transcriptome elicited by UCC118 with that 299


.asm.org/

Dow

nloaded from

http://aem.asm.org/

14

elicited by an adhesion-impaired mutant (47) in which the sortase A gene which is the only 300 sortase present in UCC118 had been deleted. The only genes differentially transcribed were 301 those encoding three mucin genes (Table 3). Surprisingly there was no difference in the 302 expression levels of the NF-κB regulatory genes following stimulation by UCC118 wild-type 303 or sortase mutant. The mucin genes MUC3A, MUC5AC and MUC12 were transcribed at 304 lower levels following exposure to the bacterial sortase mutant (Table 3). These MUC genes 305 encode cell surface associated mucins (11). This was a surprising result, as up-regulation of 306 these mucin genes had not been observed following exposure to wild-type UCC118 cells. 307 Down-regulation of intestinal mucins has been reported for other gastrointestinal organisms 308 e.g. Helicobacter pylori (5). We can rationalize altered (reduced) mucin gene expression, 309 upon exposure to UCC118 cells lacking sortase dependent proteins, if this probiotic 310 lactobacillus normally has both positive and negative regulatory effects on mucin gene 311 expression. Thus with the wild type strain, the effect of the sortase dependent proteins is to 312 up-regulate intestinal mucins, but this is counter-balanced by opposing effects from other cell 313 components, analogous to how L. plantarum can have both pro-inflammatory and anti-314 inflammatory activities (46). It has been reported that probiotic bacteria increase the 315 synthesis of cell surface mucins (6) and that modulation of mucin gene expression is 316 dependent on the adhesion of the bacterial cells. The VSL#3 preparation used for that study 317 was a complex mixture of four Lactobacillus species, three bifidobacterial species, and 318 Streptococcus thermophilus (6). The data presented here provide a single-strain model to 319 further explore this phenomenon, and to test the effect of lactobacillus adhesion, and mucin 320 gene induction, upon barrier function. 321 Adhesion to epithelial cells induces L. salivarius bacteriocin gene expression. L. 322 salivarius genes that displayed significantly altered expression levels upon exposure to Caco-323


.asm.org/

Dow

nloaded from

http://aem.asm.org/

15

2 cells are listed in Table 4. These genes fall into two main categories, these involved in 324 purine metabolism, or in the production of the bacteriocin Abp118. The expression level of 325 purine metabolism genes is known to be affected by numerous environmental factors and 326 these genes are often differentially expressed in microarray experiments of lactobacilli (27) . 327 All genes within the Abp-118 bacteriocin operon were up-regulated, ranging between 3.7 and 328 13.9 fold. Comparison of the gene expression profiles of the UCC118 wild type and srtA 329 mutant upon exposure of both strains to Caco-2 cells (Table 5) revealed that the bacteriocin 330 operon was differentially expressed in the wild-type only. The fold difference in Abp118 331 gene transcription between the wild-type UCC118 and the sortase mutant (Table 5) is in the 332 same range as the fold expression difference between UCC118 cells exposed to Caco-2 cells 333 and non-exposed UCC118 control cells. This suggests that the sortase-mediated adhesion to 334 Caco-2 cells is the primary trigger for increased bacteriocin gene transcription. We have not 335 observed any significant differences between bacteriocin gene expression in the wild-type 336 and ΔsrtA mutant when grown in MRS broth and tested by qPCR (data not shown), 337 supporting the theory that the bacterial-epithelial cell interaction mediated by the sortase-338 anchored proteins is key for the induction of bacteriocin production. Mechanistically, this 339 could be explained by adhesion causing a sufficiently high local concentration of induction 340 peptide to trigger Abp118 production, since this quorum-sensing mechanism is encoded by 341 the Abp118 operon (14). 342 Localized induction of bacteriocin production by adhesion to mucosal surfaces could 343 be relevant for probiotic effects (reviewed in ref. (33)), including playing a role in the anti-344 infective activity shown by UCC118 in models for enteric pathogenesis (9). There is also 345 evidence that L. salivarius strains isolated from different intestinal sources produce different 346 variants of the bacteriocin salivaricin from the same genetic locus, suggesting that bacteriocin 347


.asm.org/

Dow

nloaded from

http://aem.asm.org/

16

production in L. salivarius has evolved in a host-specific manner (31). In addition to the 348 anti-infective effect, it is possible that enhanced bacteriocin production may aid colonization 349 of the bacteriocin producer. This has been demonstrated for a number of bacteria including 350 Escherichia coli where colicin producers were more persistent than non-producers (16) and 351 Streptococcus mutans where a mutant with enhanced mutacin production was more 352 successful at colonizing the oral tract than the wild type strain (18). UCC118 is strongly 353 adherent to epithelial cells (47) and is known to be able to persist in the gut for a substantial 354 length of time after ingestion (8). The induction of bacteriocin gene expression reported here 355 is likely to enhance the colonization potential of Lb. salivarius through inhibition of 356 competing organisms and may well be a factor in the persistence of UCC118 in the GIT. 357 Bacteriocins may also function as signalling molecules that could directly influence the host 358 immune system; for example, bacteriocin genes have been identified in Lb. plantarum among 359 a group of genes that are implicated in influencing epithelial gene transcription (27) 360 Conclusions. The data accrued in this study are integrated into a model (Fig. 1) 361 showing the relevant proposed mechanisms. It could be argued that Lb. salivarius cells in the 362 intestine might be restricted from contacting the epithelium, such that the transcriptional 363 response observed in cell culture systems would be limited. However any disruption to the 364 epithelium, including sloughing off of mucus by digesta, would allow intestinal bacteria 365 including lactobacilli to contact epithelial cells in greater numbers, which would allow 366 induction of the responses detailed herein. Enhanced mucus production would be 367 accompanied by sortase-mediated lactobacillus adhesion, through the action of the mucus 368 binding proteins LspA and LspC, bacteriocin production, and localized competitive exclusion 369 of bacteriocin-sensitive pathogens (Fig. 1). It is conceivable that commensal bacteria such as 370 UCC118, with proven colonization and persistence, effectively act as ‘sentinels’ conditioning 371


.asm.org/

Dow

nloaded from

http://aem.asm.org/

17

the epithelium for possible exposure to pathogens or other inflammatory stimuli. Through 372 their presence in substantial numbers in the mucus layer they are able to trigger protective 373 immune responses in epithelia following disruption of this layer or the underlying epithelium. 374

375 376 377

ACKNOWLEDGEMENTS 378 This research was supported by Science Foundation Ireland through a Centre for Science, 379 Engineering and Technology award to the Alimentary Pharmabiotic Centre, UCC (SFI CSET 380 grant 07/CE/B1368). We are grateful to Alimentary Health Ltd., Ireland for providing L. 381 salivarius UCC118. We thank Heleen de Weerd for assistance with the microarray data 382 analysis platform, and Aldert Zomer and Ian Jeffery for guidance in microarray analysis. 383 384


.asm.org/

Dow

nloaded from

http://aem.asm.org/

18

REFERENCES 385 1. Bai, A.-P., Q. Ouyang, W. Zhang, C.-H. Wang, and S.-F. Li. 2004. Probiotics inhibit 386 TNF-alpha-induced interleukin-8 secretion of HT29 cells. World J. Gastroenterol. 387 10:455–457. 388 2. Baldi, P., and A. D. Long. 2001. A Bayesian Framework for the Analysis of 389 Microarray Expression Data: Regularized T -Test and Statistical Inferences of Gene 390 Changes. Bioinformatics 17:509–519. 391 3. Bertrand, M. J. M., K. Doiron, K. Labbé, R. G. Korneluk, P. A. Barker, and M. 392 Saleh. 2009. Cellular Inhibitors of Apoptosis cIAP1 and cIAP2 Are Required for 393 Innate Immunity Signaling by the Pattern Recognition Receptors NOD1 and NOD2. 394 Immunity 30:789–801. 395 4. Buck, B. L., E. Altermann, T. Svingerud, and T. R. Klaenhammer. 2005. 396 Functional Analysis of Putative Adhesion Factors in Lactobacillus acidophilus 397 NCFM. Appl. and Environ. Microbiology 71:8344–8351. 398 5. Byrd, J. C., C. K. Yunker, Q. S. Xu, L. R. Sternberg, and R. S. Bresalier. 2000. 399 Inhibition of gastric mucin synthesis by Helicobacter pylori. Gastroenterology 400 118:1072–1079. 401 6. Caballero-Franco, C., K. Keller, C. De Simone, and K. Chadee. 2007. The VSL#3 402 probiotic formula induces mucin gene expression and secretion in colonic 403 epithelial cells. Am. J. Physiol. Gastrointest. Liver Physiol. 292:G315 –G322. 404 7. Cai, S., S. Batra, S. A. Lira, J. K. Kolls, and S. Jeyaseelan. 2010. CXCL1 Regulates 405 Pulmonary Host Defense to Klebsiella Infection via CXCL2, CXCL5, NF-κB, and 406 MAPKs. J. Immunol. 185:6214 –6225. 407 8. Collins, J. K., C. Dunne, L. Murphy, D. Morrissey, L. O’Mahony, E. O’Sullivan, G. 408 Fitzgerald, B. Kiely, G. C. O’Sullivan, C. Daly, P. Marteau, and F. Shanahan. 2002. 409 A Randomised Controlled Trial of a Probiotic Lactobacillus Strain in Healthy Adults: 410 Assessment of its Delivery, Transit and Influence on Microbial Flora and Enteric 411 Immunity. Microbial Ecology in Health and Disease 14:81–89. 412 9. Corr, S. C., Y. Li, C. U. Riedel, P. W. O’Toole, C. Hill, and C. G. M. Gahan. 2007. 413 Bacteriocin production as a mechanism for the antiinfective activity of 414 Lactobacillus salivarius UCC118. Proc. Natl. Acad. Sci. USA 104:7617 –7621. 415 10. De Man, J. C., M. Rogosa, and M. E. Sharpe. 1960. A Medium for the Cultivation of 416 Lactobacilli. J. Appl. Microbiol. 23:130–135. 417 11. Dharmani, P., V. Srivastava, V. Kissoon-Singh, and K. Chadee. 2009. Role of 418 Intestinal Mucins in Innate Host Defense Mechanisms against Pathogens. J. Innate 419 Immun. 1:123–135. 420 12. Didierlaurent, A., J. Sirard, J. Kraehenbuhl, and M. R. Neutra. 2002. How the gut 421 senses its content. Cell. Microbiol. 4:61–72. 422 13. Ewaschuk, J. B., H. Diaz, L. Meddings, B. Diederichs, A. Dmytrash, J. Backer, M. 423 Looijer-van Langen, and K. L. Madsen. 2008. Secreted bioactive factors from 424 Bifidobacterium infantis enhance epithelial cell barrier function. Am J Physiol 425 Gastrointest. Liver Physiol. 295:G1025–G1034. 426 14. Flynn, S., D. van Sinderen, G. M. Thornton, H. Holo, I. F. Nes, and J. K. Collins. 427 2002. Characterization of the genetic locus responsible for the production of ABP-428 118, a novel bacteriocin produced by the probiotic bacterium Lactobacillus 429 salivarius subsp. salivarius UCC118. Microbiology 148:973–984. 430


.asm.org/

Dow

nloaded from

http://aem.asm.org/

19

15. Frank, D. N., A. L. St. Amand, R. A. Feldman, E. C. Boedeker, N. Harpaz, and N. R. 431 Pace. 2007. Molecular-phylogenetic characterization of microbial community 432 imbalances in human inflammatory bowel diseases. Proc. Natl. Acad. Sci, USA 433 104:13780 –13785. 434 16. Gillor, O., I. Giladi, and M. A. Riley. 2009. Persistence of colicinogenic Escherichia 435 coli in the mouse gastrointestinal tract. BMC Microbiol. 9:165. 436 17. Hansson, Gunnar, C, H. 2012. Role of mucus layers in gut infection and 437 inflammation. Current Opinion in Microbiology 15:57–62. 438 18. Hillman, J. D., A. L. Dzuback, and S. W. Andrews. 1987. Colonization of the 439 human oral cavity by a Streptococcus mutans mutant producing increased 440 bacteriocin. J. Dent. Res. 66:1092–1094. 441 19. Jeffery, I. B., P. W. O’Toole, L. Ohman, M. J. Claesson, J. Deane, E. M. M. Quigley, 442 and M. Simrén. 2011. An irritable bowel syndrome subtype defined by species-443 specific alterations in faecal microbiota. Gut. doi:10.1136/gutjnl-2011-301501 444 20. Kiesslich, R., C. A. Duckworth, D. Moussata, A. Gloeckner, L. G. Lim, M. Goetz, D. 445 M. Pritchard, P. R. Galle, M. F. Neurath, and A. J. M. Watson. 2011. Local barrier 446 dysfunction identified by confocal laser endomicroscopy predicts relapse in 447 inflammatory bowel disease. Gut. doi:10.1136/gutjnl-2011-300695 448 21. Kim, Y. S., and S. B. Ho. 2010. Intestinal goblet cells and mucins in health and 449 disease: recent insights and progress. Curr Gastroenterol Rep 12:319–330. 450 22. Kumar, A., H. Wu, L. S. Collier-Hyams, J. M. Hansen, T. Li, K. Yamoah, Z.-Q. Pan, 451 D. P. Jones, and A. S. Neish. 2007. Commensal bacteria modulate cullin-dependent 452 signaling via generation of reactive oxygen species. EMBO J 26:4457–4466. 453 23. Ley, R. E., P. J. Turnbaugh, S. Klein, and J. I. Gordon. 2006. Microbial ecology: 454 Human gut microbes associated with obesity. Nature 444:1022–1023. 455 24. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of Relative Gene Expression Data 456 Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 25:402–408. 457 25. Matsushita, K., O. Takeuchi, D. M. Standley, Y. Kumagai, T. Kawagoe, T. 458 Miyake, T. Satoh, H. Kato, T. Tsujimura, H. Nakamura, and S. Akira. 2009. 459 Zc3h12a is an RNase essential for controlling immune responses by regulating 460 mRNA decay. Nature 458:1185–1190. 461 26. McGuckin, M. A., S. K. Lindén, P. Sutton, and T. H. Florin. 2011. Mucin dynamics 462 and enteric pathogens. Nat. Rev. Microbiol. 9:265–278. 463 27. Meijerink, M., S. van Hemert, N. Taverne, M. Wels, P. de Vos, P. A. Bron, H. F. 464 Savelkoul, J. van Bilsen, M. Kleerebezem, and J. M. Wells. 2010. Identification of 465 Genetic Loci in Lactobacillus plantarum that modulate the immune response of 466 Dendritic Cells Using Comparative Genome Hybridization. PLoS ONE 5:e10632. 467 28. Moussavi, M., and M. C. Adams. 2009. An In Vitro Study on Bacterial Growth 468 Interactions and Intestinal Epithelial Cell Adhesion Characteristics of Probiotic 469 Combinations. Current Microbiology 60:327–335. 470 29. Neville, B., and P. O’Toole. 2010. Probiotic properties of Lactobacillus salivarius 471 and closely related Lactobacillus species. Future Microbiology 5:759–774. 472 30. O’Mahony, L., M. Feeney, S. O’Halloran, L. Murphy, B. Kiely, J. Fitzgibbon, G. 473 Lee, G. O’Sullivan, F. Shanahan, and J. K. Collins. 2001. Probiotic impact on 474 microbial flora, inflammation and tumour development in IL-10 knockout mice. 475 Aliment. Pharmacol. Thera. 15:1219–1225. 476


.asm.org/

Dow

nloaded from

http://aem.asm.org/

20

31. O’Shea, E. F., P. M. O’Connor, E. J. Raftis, P. W. O’Toole, C. Stanton, P. D. Cotter, 477 R. P. Ross, and C. Hill. 2011. Production of multiple bacteriocins from a single 478 locus by gastrointestinal strains of Lactobacillus salivarius. J. Bacteriol. 193:6973-479 6982. 480 32. O’Toole, P. W., and M. J. Claesson. 2010. Gut microbiota: Changes throughout the 481 lifespan from infancy to elderly. Int. Dairy J. 20:281–291. 482 33. O’Toole, P. W., and J. C. Cooney. 2008. Probiotic Bacteria Influence the 483 Composition and Function of the Intestinal Microbiota. Interdisciplinary 484 Perspectives on Infectious Diseases 2008:1–9. 485 34. Oozeer, R., M. Rescigno, R. P. Ross, J. Knol, M. Blaut, A. Khlebnikov, and J. Doré. 486 2010. Gut health: predictive biomarkers for preventive medicine and development 487 of functional foods. Br. J. Nutr. 103:1539–1544. 488 35. Pinto, M., S. Robine-Leon, M. d. Appay, M. Kedinger, N. Triadou, E. Dussaulx, B. 489 Lacroix, P. Simon-Assman, J. Haffen, J. Fogh, and A. Zweibaum. 1983. 490 Enterocyte-like differentiation and polarization of the human colon carcinoma cell 491 line Caco-2 in culture. Biol. Cell 47:323–330. 492 36. Ryan, K. A., P. Daly, Y. Li, C. Hooton, and P. W. O’Toole. 2008. Strain-specific 493 inhibition of Helicobacter pylori by Lactobacillus salivarius and other lactobacilli. J. 494 Antimicrob. Chemother. 61:831 –834. 495 37. Ryan, K. A., A. M. O’Hara, J.-P. van Pijkeren, F. P. Douillard, and P. W. O’Toole. 496 2009. Lactobacillus salivarius modulates cytokine induction and virulence factor 497 gene expression in Helicobacter pylori. J. Med. Microbiol. 58:996 –1005. 498 38. Sheil, B., J. McCarthy, L. O’Mahony, M. W. Bennett, P. Ryan, J. J. Fitzgibbon, B. 499 Kiely, J. K. Collins, and F. Shanahan. 2004. Is the mucosal route of administration 500 essential for probiotic function? Subcutaneous administration is associated with 501 attenuation of murine colitis and arthritis. Gut 53:694 –700. 502 39. Sibartie, S., A. O’Hara, J. Ryan, A. Fanning, J. O’Mahony, S. O’Neill, B. Sheil, L. 503 O’Mahony, and F. Shanahan. 2009. Modulation of pathogen-induced CCL20 504 secretion from HT-29 human intestinal epithelial cells by commensal bacteria. BMC 505 Immunology 10:54. 506 40. Skalniak, L., D. Mizgalska, A. Zarebski, P. Wyrzykowska, A. Koj, and J. Jura. 507 2009. Regulatory feedback loop between NF-kappaB and MCP-1-induced protein 1 508 RNase. FEBS J. 276:5892–5905. 509 41. Sokol, H., B. Pigneur, L. Watterlot, O. Lakhdari, L. G. Bermúdez-Humarán, J.-J. 510 Gratadoux, S. Blugeon, C. Bridonneau, J.-P. Furet, G. Corthier, C. Grangette, N. 511 Vasquez, P. Pochart, G. Trugnan, G. Thomas, H. M. Blottière, J. Doré, P. 512 Marteau, P. Seksik, and P. Langella. 2008. Faecalibacterium prausnitzii is an anti-513 inflammatory commensal bacterium identified by gut microbiota analysis of Crohn 514 disease patients. Proc. Natl. Acad. Sci. USA 105:16731 –16736. 515 42. Spehlmann, M. E., and L. Eckmann. 2009. Nuclear factor-kappa B in intestinal 516 protection and destruction. Curr. Opin. Gastroenterol. 25:92–99. 517 43. Starner, T. D., C. K. Barker, H. P. Jia, Y. Kang, and P. B. McCray Jr. 2003. CCL20 is 518 an inducible product of human airway epithelia with innate immune properties. 519 Am. J. Respir. Cell Mol. Biol. 29:627–633. 520 44. Swidsinski, A., A. Ladhoff, A. Pernthaler, S. Swidsinski, V. Loening-Baucke, M. 521 Ortner, J. Weber, U. Hoffmann, S. Schreiber, M. Dietel, and H. Lochs. 2002. 522 Mucosal flora in inflammatory bowel disease. Gastroenterology 122:44–54. 523


.asm.org/

Dow

nloaded from

http://aem.asm.org/

21

45. van Baarlen, P., F. Troost, C. van der Meer, G. Hooiveld, M. Boekschoten, R. J. 524 M. Brummer, and M. Kleerebezem. 2010. Colloquium Paper: Human mucosal in 525 vivo transcriptome responses to three lactobacilli indicate how probiotics may 526 modulate human cellular pathways. Proc. Natl. Acad.Sci. USA 108:4562–4569. 527 46. van Baarlen, P., F. J. Troost, S. van Hemert, C. van der Meer, W. M. de Vos, P. J. 528 de Groot, G. J. E. J. Hooiveld, R.-J. M. Brummer, and M. Kleerebezem. 2009. 529 Differential NF-κB pathways induction by Lactobacillus plantarum in the 530 duodenum of healthy humans correlating with immune tolerance. Proc. Natl. 531 Acad.Sci. USA 106:2371 –2376. 532 47. van Pijkeren, J.-P., C. Canchaya, K. A. Ryan, Y. Li, M. J. Claesson, B. Sheil, L. 533 Steidler, L. O’Mahony, G. F. Fitzgerald, D. van Sinderen, and P. W. O’Toole. 534 2006. Comparative and Functional Analysis of Sortase-Dependent Proteins in the 535 Predicted Secretome of Lactobacillus salivarius UCC118. Appl. Environ. Microbiol. 536 72:4143–4153. 537 48. Vereecke, L., R. Beyaert, and G. van Loo. 2009. The ubiquitin-editing enzyme A20 538 (TNFAIP3) is a central regulator of immunopathology. Trends Immunol. 30:383–539 391. 540 49. Vizoso Pinto, M. G., M. Rodriguez GÃ3mez, S. Seifert, B. Watzl, W. H. Holzapfel, 541 and C. M. A. P. Franz. 2009. Lactobacilli stimulate the innate immune response and 542 modulate the TLR expression of HT29 intestinal epithelial cells in vitro. 543 International Journal of Food Microbiology 133:86–93. 544 50. Wells, J. M., O. Rossi, M. Meijerink, and P. van Baarlen. 2010. Colloquium Paper: 545 Epithelial crosstalk at the microbiota-mucosal interface. Proc. Natl. Acad. Sci. USA 546 108:4607–4614. 547 51. Yan, F., H. Cao, T. L. Cover, M. K. Washington, Y. Shi, L. Liu, R. Chaturvedi, R. M. 548 Peek, K. T. Wilson, and D. B. Polk. 2011. Colon-specific delivery of a probiotic-549 derived soluble protein ameliorates intestinal inflammation in mice through an 550 EGFR-dependent mechanism. J. Clin. Invest. 121:2242–2253. 551 52. Yang, D., Q. Chen, D. M. Hoover, P. Staley, K. D. Tucker, J. Lubkowski, and J. J. 552 Oppenheim. 2003. Many chemokines including CCL20/MIP-3α display 553 antimicrobial activity. J. Leukocyte Biol. 74:448 –455. 554 53. Zhang, L., N. Li, R. Caicedo, and J. Neu. 2005. Alive and Dead Lactobacillus 555 rhamnosus GG Decrease Tumor Necrosis Factor-alpha�Induced Interleukin-8 556 Production in Caco-2 Cells. J. Nutrition 135:1752 –1756. 557 54. Zoumpopoulou, G., E. Tsakalidou, J. Dewulf, B. Pot, and C. Grangette. 2009. 558 Differential crosstalk between epithelial cells, dendritic cells and bacteria in a co-559 culture model. Int. J. Food Microbiol. 131:40–51. 560 561 562

563 564


.asm.org/

Dow

nloaded from

http://aem.asm.org/

22

565 566

TABLES 567 568 Table 1: Primers used in this study 569

Gene Name Forward Primer 5’-3’ Reverse Primer 5’-3’ Probe No.*

BIRC3 gatgaaaatgcagagtcatcaatta catgattgcatcttctgaatgg 80

TNFAIP3 tgcacactgtgtttcatcgag acgctgtgggactgactttc 74

CCL20 gctgctttgatgtcagtgct gaagaatacggtctgtgtatccaa 39

MUC3A cagtcccccagccctaaa tataccttgctagggaccagga 55

MUC12 cctggaaaccttagcaccag gacagacgcattgttttccat 72

MUC5AC agcaccagtgcccaagtct actcctggcagtccatgc 43

NFKBIA gctgatgtcaatgctcagga acaccaggtcaggattttgc 86

CXCL1 catcgaaaagatgctgaacagt cttcaggaacagccaccagt 52

CXCL-2 cccatggttaagaaaatcatcg cttcaggaacagccaccaat 69

ACTB attggcaatgagcggttc tgaaggtagtttcgtggatgc 11

*Probe no. refers to the hydrolysis probe from the Roche ‘Universal ProbeLibrary’ system 570 used with each primer pair. 571 572 573 574 575 576 577 578 579 580


.asm.org/

Dow

nloaded from

http://aem.asm.org/

23

581 Table 2: Genes up-regulated in Caco-2 cells in response to UCC118 582 Gene Name

Biological Function

Fold Change p-Value qPCR FC

CCL20

Chemokine (C-C motif) ligand 20 38.2 2.82E-08 20

CXCL1

Chemokine (C-X-C motif) ligand 1 13.6 9.64E-07 47.22

CXCL2

Chemokine (C-X-C motif) ligand 2 6.4 4.29E-06 4.5

BIRC3 cIAP2 – anti apoptosis 6.1 2.27E-05 6.9

ZC3H12A

RNase – Immune regulation 5.7 6.60E-05 nd

TNFAIP3

Negative regulator of NF-kappa-B 5.5 4.89E-07 2.5

NFKBIA

Negative regulator of NF-kappa-B 5.4 1.94E-05 3

583 Fold Change: Expression ratio between cells exposed to UCC118 and control cells 584 Pval: p-value 585 qPCR FC: Fold change in qPCR experiment. 586 The cut-off for inclusion was a fold change > 2.0 and a p-value < 9.0E-05 587 588 589 on July 24, 2020 by guest

http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

24

590 Table 3: Genes differentially regulated in Caco-2 cells exposed to UCC118 compared to 591 UCC118 srtA. Ratios are expression in UCC118 stimulated cells over expression in sortase 592 mutant stimulated cells. 593 Gene Name

Fold Change pval qPCR FC

Muc3 15.2 0 5.82

Muc5AC 3.4 0 -1.31

Muc12 16 0 1.95 594 Fold Change: Expression ratio between UCC118 and srtA mutant 595 Pval: p-value 596 qPCR FC: Fold change in qPCR experiment. 597 The cut-off for inclusion was a fold change > 2.0 and a p-value < 9.0E-05. 598 599 600 601 602 603 604 605 on July 24, 2020 by guest

http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

25

Table 4: Genes differentially regulated in UCC118 during co-culture with Caco-2 cells 606 LocusTag Gene Name

Biological Function Fold Change

p-Value

LSL_0515 purE

Phosphoribosylaminoimidazole carboxylase carboxyltransferase subunit 6.8 0

LSL_0516 purK

6.9 0

LSL_0517 purB Adenylosuccinate lyase

2.3 2.23E-08

LSL_0663 purC SAICAR synthetase

6.5 6.11E-15

LSL_0664 purS Phosphoribosylformylglycinamidine synthase 7.1 2.22E-16

LSL_0665 purQ Phosphoribosylformylglycinamidine synthase 5.3 1.47E-12

LSL_0666 purL Phosphoribosylformylglycinamidine synthase II 5.5 0

LSL_0667 purF Amidophosphoribosyltransferase

5.6 0

LSL_0668 purM Phosphoribosylformylglycinamidine cyclo-ligase 6.7 0

LSL_0669 purN Phosphoribosylglycinamide formyltransferase 6.6 0

LSL_0670 purH Bifunctional purine biosynthesis protein purH 7.2 0

LSL_0671 NA Hypothetical membrane spanning protein 6.6 0

LSL_1908 NA Hypothetical protein

2.0 0.007

LSL_1909 abpD Abp118 bacteriocin export accessory protein 2.4 0.011

LSL_1910 abpT Abp118 Bacteriocin export accessory protein 3.1 0.002

LSL_1911 NA Hypothetical membrane

spanning protein 3.7 6.08E-06

LSL_1912 abpR AbpR response regulator

3.7 2.44E-07

LSL_1913 abpK Sensory transduction histidine

kinase 2.2 0.003

LSL_1914 abpIP Abp118 Bacteriocin induction

peptide 4.4 1.33E-06

LSL_1915 abpIM Abp118 Bacteriocin immunity

protein 3.7 5.16E-08

LSL_1916 abp118b Abp118 Bacteriocin beta


LSL_1917 Abp118a Abp118 Bacteriocin alpha

peptide 11.4 4.60E-10

LSL_1918 NA Bacteriocin-like prepeptide

12.9 1.27E-08


associated protein. 1.6 1.03E-08


13.9 4.10E-08

LSL_1921 NA Non-functional salivaricin

precursor 11.1 8.53E-08


spanning protein 3.2 0.009

Locus tag: UCC118 genome annotation locus tag 607 Fold Change: Expression ratio between UCC118 cells exposed to Caco-2 cells and Unexposed UCC118 608 Pval: p-value qPCR FC: Fold change in qPCR experiment 609 The cut-off for inclusion was a fold change > 2.0 and a p-value < 0.01 610


.asm.org/

Dow

nloaded from

http://aem.asm.org/

26

Table 5: Genes differentially expressed in UCC118 cells exposed to Caco-2 cells relative to 611 ΔsrtA mutant cells exposed to Caco-2 cells. 612 613 LocusTag Gene Name

Biological Function Fold Change

p-value

LSL_1908 NA Hypothetical protein

1.9 0.002

LSL_1909 abpD Abp118 bacteriocin export accessory protein 6.1 1.85E-10

LSL_1910 abpT Abp118 Bacteriocin export accessory protein 7.4 9.39E-12



LSL_1912 abpR AbpR response regulator

4.8 1.05E-09

LSL_1913 abpK Sensory transduction histidine

kinase 3.7 2.33E-09

LSL_1914 abpIP Abp118 Bacteriocin induction


LSL_1915 abpIM Abp118 Bacteriocin immunity

protein 4.8 8.8E-14

LSL_1916 abp118b Abp118 Bacteriocin beta

peptide 10.8 6.11E-15

LSL_1917 Abp118a Abp118 Bacteriocin alpha

peptide 11.7 2.18E-09


13.3 4.35E-10


associated protein. 2.0 4.9E-11


17.1 1.1E-10

LSL_1921 NA Non-functional salivaricin

precursor 13.6 4.09E-10



Locus tag: UCC118 genome annotation locus tag 614 Fold Change: Expression ratio (linear) between UCC118 cells exposed to Caco-2 cells and ΔsrtA mutants 615 exposed to Caco-2. 616 Pval: p-value 617 qPCR FC: Fold change in qPCR experiment 618 The cut-off for inclusion was a fold change > 2.0 and a p-value < 0.01 619 620 621 622 623 624 625 626 627 628 629 630 631 632


.asm.org/

Dow

nloaded from

http://aem.asm.org/

27

Figure Legends. 633 634 Figure 1. Schematic summary of the proposed protective mechanism of L. salivarius 635 UCC118 upon the intestinal epithelium. In the normal (undamaged) epithelium, the 636 commensal bacteria are prevented from reaching the epithelial cells by the mucus bilayer. In 637 the case of a damaged epithelium, the integrity of the mucus layer is lost and UCC118 can 638 interact directly with the epithelial cells, with resulting induction of genes for chemokines 639 and anti-inflammatory regulators in the epithelial cells, and the induction of the genes for 640 Abp-118 bacteriocin in the L. salivarius UCC118 cells. 641


.asm.org/

Dow

nloaded from

http://aem.asm.org/


.asm.org/

Dow

nloaded from

http://aem.asm.org/

downloaded from on april 2, 2020 by guest › content › aem › early › 2012 › 05 › 13 ›...

Documents