downloaded from //aem.asm.org/content/aem/early/2017/03/14/aem.03249-16.fu… · óð 5xe$ dqg...
TRANSCRIPT
![Page 1: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/1.jpg)
1
Transcriptomic Analyses Elucidate Adaptive Differences of Closely-Related 1
Strains of P. aeruginosa in Fuel 2
Thusitha S. Gunasekera1, Loryn L. Bowen1, Carol E. Zhou2, Susan C. Howard-Byerly1, William 3
S. Foley3, Richard C. Striebich1, Larry C. Dugan2 , Oscar N. Ruiz3# 4
5
1. Environmental Microbiology Group, University of Dayton Research Institute, University 6
of Dayton, Dayton OH 45469, USA 7
2. Lawrence Livermore National Laboratory, Livermore, CA, USA 8
3. Fuels and Energy Branch, Aerospace Systems Directorate, Air Force Research 9
Laboratory, Wright-Patterson AFB, OH 45433, USA 10
11
# Corresponding author: Oscar N. Ruiz, [email protected] 12
13
Running Title: Adaptive differences of P. aeruginosa strains to fuel 14
15
16
17
18
19
AEM Accepted Manuscript Posted Online 17 March 2017Appl. Environ. Microbiol. doi:10.1128/AEM.03249-16Copyright © 2017 American Society for Microbiology. All Rights Reserved.
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 2: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/2.jpg)
2
ABSTRACT 20
Pseudomonas aeruginosa can utilize hydrocarbons, but different strains have varying degrees of 21
adaptation despite their highly conserved genome. P. aeruginosa ATCC 33988 is highly adapted 22
to hydrocarbons while strain PAO1, a human pathogen, is less-adapted and degrades jet fuel at a 23
slower rate than does ATCC 33988. We investigated fuel specific transcriptomic differences 24
between these strains in order to ascertain the underling mechanisms utilized by the adapted 25
strain to proliferate in fuel. During growth in fuel, the genes related to alkane degradation, heat-26
shock response, membrane proteins, efflux pumps and several novel genes were upregulated in 27
ATCC 33988. Overexpression of alk genes in PAO1 provided some improvement in growth, but 28
not as robust as that of ATCC 33988, suggesting the role of other genes in adaptation. 29
Expression of the function unknown gene PA5359 from ATCC 33988 in PAO1 increased the 30
growth in fuel. Bioinformatic analysis revealed that PA5359 is a predicted lipoprotein with a 31
conserved ‘Yx(FWY)xxD’ motif, which is shared among bacterial adhesins. Overexpression of 32
the putative RND-efflux pump PA3521-PA3523 increased the growth of ATCC 33988 strain 33
suggesting a possible role in fuel tolerance. Interestingly the PAO1 strain cannot utilize nC8 34
and nC10. Expression of GFP under the control of alkB promoters confirmed that alk gene 35
promoter polymorphism affects the expression of alk genes. Promoter fusion assays further 36
confirmed that regulation of alk genes was different in the two strains. Protein sequence analysis 37
showed low amino acid differences for many of the upregulated genes, further supporting 38
transcriptional control as the main mechanism for enhanced adaptation. 39
40
41
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 3: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/3.jpg)
3
IMPORTANCE 42
These results support that specific signal transduction, gene regulation and coordination of 43
multiple biological responses are required to improve survival, growth and metabolism of fuel in 44
adapted strains. This study provides new insight into the mechanistic differences between strains 45
and helpful information that may be applied in the improvement of bacterial strains for resistance 46
to biotic and abiotic factors encountered during bioremediation and industrial biotechnological 47
processes. 48
INTRODUCTION 49
Pseudomonas aeruginosa has the unique ability to colonize a wide range of ecological niches, 50
including animal tissues, soil, and hydrocarbon-contaminated habitats (1). The ubiquity of P. 51
aeruginosa is primarily due to its metabolic versatility, which is linked to plastic but precisely 52
controlled genetic systems. The genomes of environmental and pathogenic strains of P. 53
aeruginosa are highly conserved (2). Thus, the phenotypic variability of strains cannot be solely 54
attributed to significant protein coding sequence variability (3). The highly conserved core 55
genome represents 88% of the average P. aeruginosa genome (4). Genes involved in aerobic and 56
anaerobic respiration, transcription and translation regulation, DNA and protein repair, 57
hydrocarbon degradation, and multi-drug efflux systems are all represented in the core-genome. 58
These genetic systems enable strains to adapt to different conditions rapidly. 59
P. aeruginosa ATCC 33988, isolated from a fuel tank in Oklahoma, is highly adapted to 60
hydrocarbon-containing environments and is considered to be an efficient alkane degrader (5, 6). 61
The 6.4 Mb genome of strain ATCC 33988 has 5,975 predicted coding sequences (7). In 62
contrast, the genome of P. aeruginosa PAO1, an important opportunistic human pathogen, is 63
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 4: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/4.jpg)
4
6.26 Mb in size (8) with 5,696 genes (http://www.pseudomonas.com). Although there is a high 64
degree of genome similarity between these two strains, including the presence of the long-chain 65
alkane monooxygenase genes alkB1 and alkB2 (5, 7, 9), the growth of the PAO1 strain in jet fuel 66
is markedly slower compared to that of ATCC 33988. In particular, we noticed the PAO1 strain 67
exhibits a reduced growth rate and a longer lag phase than ATCC 33988 when hydrocarbons are 68
its sole carbon source. The alkB1 and alkB2 gene coding regions of ATCC 33988 and PAO1 are 69
highly conserved, presenting only two synonymous single-nucleotide polymorphisms (SNPs) 70
between them (7). Other genes important for growth and survival in hydrocarbon-containing 71
environments were found to be at least 99% conserved between PAO1 and ATCC 33988. These 72
genes included those encoding the essential electron transfer proteins, the rubredoxins (RubA1, 73
RubA2), and FAD-dependent NAD(P)H2 rubredoxin reductases, the pel and alg genes for 74
biofilm formation, fur, pvc, pch and pfe for iron acquisition, and Mex efflux pumps and porins 75
(7). The high degree of similarity in the coding regions of these essential genes in PAO1 and 76
ATCC 33988 suggests that transcriptional regulation may play an essential role in the adaption 77
of these strains to fuel. 78
The mechanism that regulates the alk genes in P. aeruginosa is not well understood. 79
However, in P. putida GpO1, the alk genes are regulated by AlkS in the presence of alkanes (10, 80
11). In addition, the AlkS regulator is controlled by other global regulators (10, 11). For 81
instance, the expression of genes encoding components of the alkane degradation pathway is 82
negatively regulated by the catabolic repression control complex formed by the Crc and Hfq 83
protein, depending on the availability of other carbon sources. Recent research by Moreno et al 84
(12) shows it is the Hfq protein that binds to the catabolite activity (CA) motif- AAnAAnAA of 85
alkS (12). The binding of Hfq to the CA motifs of the alkS is stabilized by co-complexing with 86
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 5: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/5.jpg)
5
Crc. Therefore, the Crc/Hfq complex regulates AlkS at the translational level by binding to the 5’ 87
end of the alkS mRNA adjacent to the alkS start codon, repressing genes involved in 88
hydrocarbon assimilation when other preferred carbon compounds are present (11, 12). The 89
regulatory effect of Crc/Hfq complex is antagonized by the CrcZ, a non-coding RNA (13). 90
Although, AlkS or AlkS homologs have not been identified in P. aeruginosa ATCC 33988 and 91
PAO1, a CRC-dependent regulatory network exists in P. aeruginosa (13). Cell signaling and 92
protective mechanisms are vital for bacteria survival in hostile environments. The adaptation of 93
the ATCC 33988 strain to hydrocarbon-rich environments may be due to the presence of 94
multiple single nucleotide polymorphisms (SNPs) in the cis-acting regulatory region of 95
promoters in homologous genes. This type of genetic variation often explains organism evolution 96
and adaptation to a particular environment (14). These SNPs may affect the binding of regulatory 97
protein factors to the promoter influencing gene transcription and expression (15). 98
When the fuel adapted strain P. aeruginosa ATCC 33988 was grown in Jet A fuel and its 99
transcriptome compared with cells grown in glycerol, a large number of genes were differentially 100
expressed. (5). Upon exposure to fuel, strain ATCC 33988 transcriptionally regulated several 101
genes that included genes encoding efflux pumps (mexCD-OprJ, mexEF-OprN, mexAB-oprN) 102
and porins (oprF, oprG), extracellular polysaccharides (algD operon, pel operon) and genes 103
associated with biofilm formation, production of siderophores such as pyoverdine (pvc-A-F) and 104
pyocheline (pchC, pchD, pchF) for iron acquisition, and a range of transcriptional regulator 105
proteins (e.g., Fur, Hfq). Likely, these adaptive mechanisms were important in the survival and 106
proliferation of strain ATCC 33988 in fuel (5). 107
In this study, we characterized the genetic regulation, growth and metabolism of 108
Pseudomonas aeruginosa strains with similar genetic backgrounds but with different levels of 109
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 6: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/6.jpg)
6
adaption to hydrocarbon fuels in order to determine which genes, pathways, and regulatory 110
mechanisms contribute to the adaptive difference observed between these closely related strains. 111
P. aeruginosa ATCC 33988 and PAO1 cannot utilize aromatic hydrocarbons. Here, ATCC 112
33988 was shown to degrade n-alkanes ranging from n-C8 to n-C16 and isoparaffinic 113
hydrocarbons while PAO1 lacked the ability to degrade isoparaffins and n-C8 and n-C10 alkanes. 114
Genome-wide microarray analyses of the transcriptome of fuel-adapted (ATCC 33988) 115
and clinical (PAO1) strains in hydrocarbons were combined with reverse-transcriptase 116
quantitative PCR analyses (RT-qPCR) to characterize the regulation of genes and pathways in 117
the presence of fuel. Bioinformatic analyses were used to predict the function of unknown genes 118
that were highly upregulated in the ATCC 33988 strain during hydrocarbon consumption in 119
comparison to PAO1. Recombinant DNA approaches were used to study the regulation and 120
activity of strain-specific promoters in the presence of hydrocarbons. Additionally, genes highly 121
up-regulated in ATCC 33988 were overexpressed in PAO1 to determine whether each gene 122
product promotes fuel growth. The growth and hydrocarbon degradation rates of wild type and 123
genetically modified strains were closely monitored by performing growth assays and gas 124
chromatography-mass spectrometry (GC-MS) analyses. Understanding the contribution of 125
strain-specific transcriptional responses, novel genes, and regulatory sequence polymorphisms in 126
the adaptation of bacteria to adverse conditions and environments is crucial to developing 127
improved bacterial systems for biotechnological and environmental applications including 128
production of biopharmaceuticals, added value products, and bioremediation. 129
130
131
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 7: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/7.jpg)
7
MATERIALS AND METHODS 132
Bacteria strains and growth conditions 133
Pseudomonas aeruginosa ATCC 33988 and Pseudomonas aeruginosa PAO1 were grown in LB 134
(Luria-Bertani) media overnight at 28o C. Cells were washed twice using 1X M9 minimal media 135
or PBS and inoculated at an OD600 of 0.03 into 20 ml of 1X M9 minimal media overlaid with 5 136
ml Jet A fuel in 50 ml polystyrene tubes. Four sample replicates per strain and condition were 137
used. Samples were incubated at 28oC and shaken at 200 rpm. The initial inoculum level was 138
adjusted to an OD600 of 0.03. The Jet A fuel used was comprised of 21.8 wt% aromatics, (16.8 139
wt% alkylbenzenes, 0.5 wt% alkylnaphthalenes, 4.5 wt% indanes and tetralins), 32.8 wt% 140
isoparaffins, 23.9 wt% n-alkanes, and 21.5 wt% cycloparaffins. In tests were normal alkane 141
blend (20% n-C8, 20% n-C10, 20% n-C12, 20% n-C14, 20% n-C16) and pure n-alkane solvents were 142
used, 20 ml of M9 minimal media were amended with 500 µL of alkanes. For RNA extractions, 143
the cells were grown to mid log phase (0.4 -0.6 OD600) and then cooled rapidly on ice. Cells were 144
harvested by centrifugation (4oC) with 10% ethanol/phenol (19:1) solution and the pellet was 145
frozen immediately on dry ice and stored at -80oC. 146
RNA extraction, DNA microarray, and expression analyses. For statistical confidence in 147
differential gene expression, four biological replicates per test condition were employed. All the 148
samples including fuel and alkane amended were RNA extracted for qPCR and microarray using 149
the RNeasy Mini Kit as described by the manufacturer (Qiagen, Valencia, CA). The RNA was 150
treated with DNase to remove any residual DNA (TURBO DNA-free Kit, Ambion). The quality 151
of the RNA and DNA removal was confirmed by electrophoresis through a 1% agarose gel. 152
RNA integrity was analyzed using the BioAnalyzer chip based microcapillary electrophoresis 153
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 8: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/8.jpg)
8
systems (Agilent 2100 BioAnalyzer, Agilent Technology, USA) for RIN value >9 and 23S 154
rRNA to 16S rRNA ratio between 1.5-2.0. RNA concentrations and purity were measured using 155
a NanoDrop 2000c Spectrophotometer (Thermo Fisher Scientific, USA). Only those samples 156
with a 260/280 nm ratio between 1.8-2.1 were used for cDNA synthesis. DNA-free total RNA 157
was used for cDNA synthesis with random primers using SuperScript II, reverse transcriptase. 158
Five µg of cDNA were fragmented and labeled with biotin. The labeled-cDNA was hybridized to 159
Affymetrix® microarray chips. Arrays were then washed and stained as described in the 160
Affymetrix® GeneChip Expression Analysis Technical Manual, using the instructions 161
specifically for P. aeruginosa PAO1. After washing and staining, microarray chips were scanned 162
using the Affymetrix® GeneChip Scanner 3000. The initial data analyses were performed using 163
Affymetrix® Microarray Analysis Suite (MAS), version 5.1. Each array was scaled to a target 164
intensity of 500 for all probe sets. The Cell files (.CEL) were uploaded into the Expression 165
Console (ver 1.2.0.20), and background corrections, and normalizations were performed using 166
MicroArray Suite 5.0 (MAS5.0) algorithms. MAS-5 calculates a robust average of all the 167
contained probes using Tukey’s bi-weight function. The MAS-5 normalized dataset was filtered 168
by excluding probe sets with 100% ‘absent’ calls. The MAS5.0 normalized CHP files were 169
imported into the Affymetrix® Transcriptome Analysis Console (TAC). Comparison analyses 170
were performed using TAC software. TAC uses Tukey’s bi-weight function to determine the 171
averages among the analysis groups. Additionally, TAC employs traditional unpaired One-Way 172
ANOVA to determine variance and significance (p-value). The complete dataset (CEL and CHP 173
files) has been deposited at the NCBI/GEO database (accession number GSE93305). 174
Gene annotation methodology. The P. aeruginosa PAO1 and ATCC 33988 genomes were 175
processed through automated annotation using RAST (16) and the PSAT system (17), which 176
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 9: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/9.jpg)
9
runs EFICAz 2.5 (18), blastp against the KEGG, MetaCyc, BRENDA, STRING databases (19, 177
20, 21, 22), InterProScan (23), and SignalP (24). Differentially regulated unknown hypothetical 178
genes from P. aeruginosa ATCC 33988 were further annotated using TMHMM version 2.0 (25). 179
Each unknown hypothetical gene was considered in the context of other genes in close proximity 180
in the genome (i.e., gene neighborhood, using graphical information provided by the 181
Pseudomonas Database; 26), and the Transport Database (27) was consulted to identify putative 182
membrane proteins among these genes. In the majority of cases, the automated annotations for 183
ATCC 33988 were identical to those of the corresponding genes in PAO1, but when there were 184
differences, the annotations for ATCC 33988 were used. Literature searches were performed for 185
all corresponding PAO1 genes in order to identify empirical functional information and 186
annotations previously assigned in the literature. Priority was given to function calls presented in 187
the literature or made by RAST, but all contributing information was considered in proposing 188
one or more putative functions. When appropriate, a gene assigned to a given protein family or 189
broad function category was aligned using Clustal Omega (28) to verify similarity to related, 190
annotated genes from other organisms. Functional annotations were assigned as “putative” in the 191
absence of experimental evidence of function. Additional sequence-based annotations were 192
performed for the ATCC 33988 homolog of PA5359. The sequence was analyzed using CD-193
search (29), SPRINT-CBH (30), and blastp against the P. aeruginosa PAO1 protein sequences in 194
the CAZy database (31). 195
Reverse transcription quantitative PCR (RT-qPCR) 196
RT-qPCR was used to estimate the expression of alkB1 and alkB2 by quantifying mRNA 197
abundance in the sample. Several differentially expressed genes (e.g., alk genes, outer 198
membrane proteins) were also validated using RT-qPCR. The expressions of oprF and oprG 199
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 10: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/10.jpg)
10
genes in alkanes and Jet A was measured by RT-qPCR and compared to the corresponding 200
expression of these genes in glycerol as a carbon source. Also the expressions of several 201
regulatory small RNA that are not represented in the microarray chips were assessed using RT-202
qPCR. Gene-specific primers were designed using PrimerQuest software 203
(https://www.idtdna.com/Primerquest/Home/Index). Reverse transcription was carried out using 204
1µg of total RNA, random primers and 75 U of iScript MMLV-RT (RNaseH+). The protocol for 205
reverse transcription reaction is as follows: priming for 5 min at 25o C, reverse transcription for 206
30 min at 42o C followed by RT inactivation for 5 min at 85o C. cDNA was diluted five-fold and 207
stored at -80o C. Negative controls lacking reverse transcriptase were performed using the same 208
program to ensure there was no gDNA carryover into RNA samples. Triplicate qPCR reactions 209
were performed with the cDNA for each condition using SYBR Green Master Mix (Bio-Rad). 210
Five µl of the cDNA were amplified using 0.2 µM of each gene-specific primers. After the 211
initial denaturation step at 95o C samples were subjected to 40 cycles of PCR amplification using 212
30s annealing/extension step at 60o C. A melt-curve analysis was performed at the end of the 213
cycle to determine that one specific product was produced. The threshold cycle values (Ct) were 214
obtained from the amplification curves and the gene expression fold changes was calculated 215
using 2-∆ΔCT method. The housekeeping gene proC (32) or 16s rRNA gene was used to normalize 216
the qPCR data to cDNA input levels. 217
218
Overexpression of alkB1 and alkB2 genes with native promoters in P. aeruginosa PAO1 219
The alkB1 and alkB2 genes of ATCC 33988 and PAO1 with their respective proximal promoters 220
were PCR-amplified from PAO1 or ATCC 33988 genomic DNA with the primers Forward 5’- 221
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 11: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/11.jpg)
11
ATC GCC ATG GCG TGA CGT GAG GCT CCT TGT TTG GAA-3’ and Reverse 5’-ATC 222
GTC TAG AGA TTG CCC GAA CGA AGA GCT ATT-3’, and . Forward 5’-ATC GCC ATG 223
GCG TGA GGT GAT CCT TTT ATC CAG GGG-3’ and Reverse 5-ATC GTC TAG ATC AGG 224
AAG CTG CCG GCC GC-3’, respectively. The purified PCR products were cloned into the 225
pHERD20T plasmid using NcoI and XbaI restriction enzymes. All clones were confirmed by 226
PCR , restriction digestion, and DNA sequencing. The plasmid DNA manipulation was initially 227
carried out in JM109 cells (Promega). The pHERD20T plasmid with alk genes and their 228
respective promoters were electro-transformed into PAO1 and ATCC 33988 cells. The empty 229
plasmid pHERD20T (33) was transformed into PAO1 wild-type cells and used as a control for 230
the expression, growth and Jet A degradation studies described below. 231
Construction of alkB1 and alkB2 promoter-GFP constructs 232
In order to compare the strengths and regulation of the native alkB1 and alkB2 promoters from 233
PAO1 and ATCC 33988 strains, individual alkB1 and alkB2 promoters were fused to the green 234
fluorescent protein (GFP) gene. The alkB1 and alkB2 promoters were PCR-amplified from 235
PAO1 or ATCC 33988 genomic DNA with the primers AlkB1pro-FOR (5’-ATC GGG ATC 236
CCG TGA GGC TCC TTG TTT GGA AAT TGG-3’) and AlkB1pro-REV (5’-CAC CGG ATC 237
CGC GGC CGC CGA CAT ATG TGC GCT CCA GTT TTT GTC CGA CA-3’) or AlkB2pro-238
FOR (5’-ATC GGG ATC CGG TGA TCC TTT TAT CCA GGG GCG C-3’) and AlkB2pro-239
REV (5’-CAC CGG ATC CGC GGC CGC CGA CAT ATG AAG TCC TCG TAT TTA TCT 240
TGT TAG ATT GTC TG-3’) . Gel-purified alkB1 and alkB2 promoter PCR products were cut 241
with BamHI and ligated into BamHI-digested pHERD20T+KanR, replacing the plasmid pBAD 242
promoter. The DNA fragment 6His-GFP was cut from pCR2.1-prrn-6His-GFP using NdeI and 243
NotI and ligated into NdeI/NotI-digested pHERD20T-KanR-AlkB1pro and pHERD20T-KanR-244
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 12: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/12.jpg)
12
AlkB2pro plasmids to create alkB1 and alkB2 promoter-driven 6His-GFP constructs for 245
transformation of P. aeruginosa strains. P. aeruginosa PAO1 and ATCC 33988 were electro-246
transformed with the above plasmids. Plasmid presence was confirmed by PCR using genomic 247
DNA prepared from transformation isolates and primers specific for GFP and the KanR gene. 248
Plasmid-containing isolates were cultured in M9 minimal media with alkanes, or glycerol. Cells 249
were analyzed by fluorescence microscopy to test for GFP expression. 250
To compare relative GFP expression levels, cultures were inoculated at 0.03 OD600 in 15 251
ml of M9 with 200 µg/ml carbenicillin and 1 ml n-alkane blend (comprised of 20 wt% of the 252
followings: n-C8, n-C10, n-C12, n-C14, n-C16), or with 0.2% glycerol. Cultures were grown at 28oC 253
with shaking at 220 rpm and growth (OD600) and GFP expression were measured periodically. 254
To estimate GFP expression, cells were excited at 488nm and the GFP emission peak (509 nm) 255
was measured using a fluorometer (Cary Eclipse Fluorescence Spectrophotometer, Agilent 256
Technologies). 257
Fuel degradation profiles by GC-MS. Gas chromatography-mass spectrometry (GC–MS) 258
analyses were conducted to investigate which specific hydrocarbons in Jet A fuel were 259
preferentially degraded by different P. aeruginosa strains, including the strains with alk gene 260
overexpression plasmids. One-ml samples of P. aeruginosa in M9 media were spiked with 10 µL 261
of Jet A fuel in a 10 ml glass vial sealed with a Teflon-lined lid. The sealed samples were 262
incubated at 28o C. Multiple sample replicates were incubated simultaneously and tested in 263
triplicates for each condition and time point. Sample vials were removed from the incubator at 264
the time of testing so that no sample would be disturbed during the exposure. Small sample 265
volumes and a M9-to-fuel ratio of 100:1 were used to allow more of the fuel to interact with P. 266
aeruginosa, making analytical changes more detectable. In this instance, the purpose of the 267
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 13: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/13.jpg)
13
experiment was to observe which of the fuel components were more readily consumed by the 268
bacteria. 269
As each M9-fuel sample with or without bacteria was removed, it was placed in a 270
refrigerator (4o C) until analyses could be performed. In order to extract the hydrocarbons and 271
other non-polar degradation products from the fuel-M9 matrix, sample extractions were prepared 272
as previously described but substituting methylene chloride by hexane as the extraction solvent 273
(5, 6). Briefly, 2-ml of HPLC-grade hexanes (Fisher Scientific) was used for extracting the 274
solution of 1 ml media and 10µL of organic materials. The solution was hand-shaken for 275
approximately for 1 minute and 1 ml of the hexane extract was removed for analysis. The 276
recovered extractants were analyzed by GC-MS (Agilent 7890-5973). The analyzed samples 277
were compared to control samples using an extracted ion signal for each compound of interest. 278
Sample responses for each compound were adjusted for the farnesane (2, 6,10-279
trimethyldodecane) in the jet fuel, which is not consumed by the bacteria investigated. 280
281
Efflux pump inhibition assay. The efflux pump inhibition assay was performed accordingly to 282
Gunasekera et al (5). Briefly, P. aeruginosa ATCC 33988 was inoculated at 0.03 OD600 into 5 ml 283
of M9 broth amended with 0, 20, 40, and 80 µg/ml Phe-Arg-naphthylamide dihydrochloride 284
(Sigma-Aldrich P4157-250MG), and overlaid with 2 ml of Jet A fuel n-hexadecane and n-285
dodecane. Hexadecane and dodecane were used because they are the primary normal alkane 286
constituents of Jet A fuel. Cultures were grown at 28 ºC aerobically in a shaker incubator (200 287
rpm) and the growth recorded by measuring OD600 for 11 days. Triplicates were used for each 288
fuel and inhibitor condition tested. 289
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 14: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/14.jpg)
14
RESULTS AND DISCUSSION 290
P. aeruginosa strains have evolved to thrive in different environments and these environment-291
specific strains are more robust and better adapted to their particular niche than other genetically 292
similar strains from a different environment. Understanding what makes these genetically similar 293
strains differ in terms of their resistance to adverse conditions and ability to exploit specific 294
resources is critical to elucidate novel cellular and metabolic mechanisms for biotic and abiotic 295
resistance that can be used in environmental and biotechnological applications. DNA 296
microarrays have been used to compare the global expression profiles of two P. aeruginosa 297
strains growing in hydrocarbon fuel; strain ATCC 33988, which was isolated from a fuel tank 298
and is well-adapted to hydrocarbon-rich environments, and PAO1, which was isolated from 299
human tissue and is therefore not well adapted to a hydrocarbon-containing environment. Both 300
strains have functional alkB1 and alkB2 genes, which are essential for alkane degradation. Poor 301
growth rates and a longer lag phase observed in the PAO1 strain in alkanes maybe due to weak 302
induction of alk genes in combination with less-adapted mechanisms for survival in a harsh fuel 303
environment. We have hypothesized that differential transcriptional regulation between these 304
two strains largely explains, the different fuel-adaptive phenotypes. In addition, this approach 305
could lead to the discovery of novel gene functions that are related to hydrocarbon degradation 306
and adaptation in the fuel resistant strain. We have used DNA microarrays to perform a whole 307
genome transcriptomic analysis of coding sequences shared by PAO1 and ATCC 33988 strains. 308
Although RNA sequencing is a rapidly advancing technology for measuring gene expression 309
levels, microarray remains a useful tool to study the transcriptome of well-defined model 310
organisms such as E. coli and P. aeruginosa. In contrast to RNAseq, microarrays do not require 311
depletion of rRNA and multiple probes per gene are used to capture the expression of even 312
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 15: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/15.jpg)
15
weakly expressed genes. However, it has the drawback of being unable to detect the genes that 313
are not present in the type strain. In contrast, RNAseq can detect other species of transcripts such 314
as non-coding RNAs, SNPs and regulatory sequences but requires intensive bioinformatics and 315
massive computational capabilities. Nevertheless, RNA sequencing and DNA microarray 316
methods have shown very strong correlation in bacterial whole-genome gene expression studies 317
(34). 318
319
Genome-wide expression profiling 320
Whole genome sequencing of Pseudomonas aeruginosa ATCC 33988 revealed that this genome 321
is at least 99% similar to the PAO1 strain for the known genes contained in PAO1 chips (7; 322
Table S1). Several genes of ATCC 33988 were confirmed to have 100% sequence homology to 323
the PAO1 strain (e.g., rubA1, rub, oprF, oprG, mexE, oprN, pvdE, PA3235, PA2779, PA3819, 324
PA3451, PA0038, PA0276, PA3986, PA5424, PA0109, PA2024). DNA sequence analyses of P. 325
aeruginosa ATCC 33988 alkB1 and alkB2 genes revealed two synonymous SNPs. However, the 326
probes to detect alkB1 or alkB2 in the Affymetrix® Microarray chips (Pae_G1A) did not target 327
the two SNP regions. Therefore these mismatches were not present to confound hybridization 328
signal intensity. It was confirmed that many of the genes considered important in fuel adaptation 329
and metabolism that were characterized in this study presented higher than 98% homology 330
between the two strains (Table S1). For microarray data analyses, fold change cut-off of 2.0 and 331
significance p-value of <0.05 were used as filtering criteria to group up-regulated and down-332
regulated genes as described previously (5, 35). Of the 5,570 annotated open reading frames 333
corresponding to P. aeruginosa PAO1, 447 genes were up-regulated and 528 genes were down 334
regulated in P. aeruginosa ATCC 33988 compared to the PAO1 strain in jet fuel (Figure 1). Of 335
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 16: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/16.jpg)
16
the 447 induced genes, the majority of the genes are classified to have unknown functions. 336
Analyses showed that 32% of the induced and 36.5% of the repressed genes were hypothetical 337
genes of unknown functions in P. aeruginosa. Of the induced known genes, 20% were related to 338
translation, post-translational modification and degradation of cellular components (Figure 2). 339
The majority of genes encoding ribosomal proteins were significantly up-regulated in the ATCC 340
33988 strain compared to the PAO1 strain. These differences likely reflected the faster growth 341
rates observed in the ATCC 33988 strain in jet fuel compared to the PAO1 strain. Fast-growing 342
bacteria increase the ribosomal protein fraction in order to meet protein synthesis demand. The 343
relationship between ribosome concentration and growth rate is well-established (36). 344
Of the repressed genes, significant numbers of genes were related to putative enzymes, 345
membrane proteins and transport of small molecules (Figure 2). Of the known down-regulated 346
genes, 32% were related to either membrane proteins or transport of small molecules (Figure 2), 347
indicating that in the presence of jet fuel, membrane transport is down-regulated, possibly to 348
reduced intake of toxic compounds present in jet fuel. The ability to tightly regulate membrane 349
transport is likely a major factor in the ability of P. aeruginosa ATCC 33988 to thrive in toxic 350
environments. The down-regulation of genes encoding membrane proteins may suggest that this 351
strain shifts its transcriptional machinery and changes its outer-membrane composition to endure 352
stress caused by the fuel. In addition significant numbers of putative enzymes (14.5%) and 353
genes related to protein secretion (6.9%) were down regulated in the ATCC 33988 strain 354
compared to the PAO1. 355
As would be expected, genes related to energy and central intermediary metabolisms 356
were induced by 8.4% and 3.7%, respectively in the ATCC 33988 strain compared to the PAO1 357
strain (Figure 2). The genes that encode the NADH-quinone oxidoreductase subunits (NuoA, 358
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 17: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/17.jpg)
17
NuoD, NuoE), essential genes for the electron transport chain, were up-regulated in the ATCC 359
33988 strain. In addition genes encoding cytochrome C oxidase subunits (CoxAB), and the 360
periplasmic nitrate reductase (NapEFDABC) were up-regulated in the ATCC 33988 strain. Of 361
particular note, in P. aeruginosa ATCC 33988, alkB1 and alkB2 genes, encoding alkane 362
hydroxylases were up-regulated, 10.76 and 15.27- fold, respectively. The expression of alk genes 363
is dependent on the bacterial growth phase (37); expression of alkB2 peak during the early 364
exponential phase, while alkB1 was induced at the late exponential phase as described by Marín 365
et al., (37). Our experiments were performed using early to mid-exponentially growing cells in 366
jet fuel or alkanes as carbon sources. In addition to alk genes, several genes involved in fatty 367
acid oxidation have been significantly upregulated. (Table 1 provides a list of selected genes that 368
were up-regulated in ATCC 33988 in fuel environments; see Table S2 for a complete list of 369
genes that were up-regulated in ATCC 33988 related to energy metabolism and cell adaptation). 370
However, the PA2475 and PA3331 genes encoding two Cytochrome P450, involved in 371
degradation of medium chain alkanes (n-C5 to n-C16) were not differentially expressed between 372
these two strains. 373
Of the up-regulated genes 6% were related to adaptation and protection. Among these 374
genes were katA, which encodes catalase, and sodB, which encodes superoxide dismutase. In 375
addition, a gene encoding lon-protease, which is a central player in adaptive response to adverse 376
conditions (38), was induced 3.76-fold in the ATCC 33988 strain. Changes in transcript levels of 377
genes related to heat shock proteins and chaperones were observed (Figure 2). The well-known 378
genes encoding the heat shock proteins, dnaK and groES, were induced in the ATCC 33988 379
strain, 2.83 and 5.15-fold, respectively (Table 1). In addition, transcription of the heat shock 380
sigma factor gene rpoH, was induced in the ATCC 33988 strain 3.9-fold (Table 1). Significant 381
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 18: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/18.jpg)
18
up-regulation of genes encoding heat-shock/chaperone proteins suggests that ATCC 33988 cells 382
have developed efficient adaptive mechanisms to prevent protein mis-folding and to degrade the 383
irreversibly denatured proteins. Studies using cDNA microarrays have shown the induction of a 384
large number of heat shock-related proteins in P. putida KT2440 cells when cells were exposed 385
to different organic solvents such as toluene, o-xylene and 3-methylbenzoate (39). These results 386
indicate that organic solvents can trigger a heat shock response in the fuel-adapted strain P. 387
putida KT2440. In a recent review by Ramos et al.,(40) it was indicated that stress response is 388
one of the major mechanisms involved in solvent tolerance. Our study suggests that the fuel-389
adapted strain ATCC 33988 employs a rapid heat shock response as a mechanism to tolerate 390
stresses produce by the hydrocarbons and other toxic compounds in jet fuel. 391
It has been shown that aromatics such as toluene and naphthalene can be transported into 392
the cell through the porins OprF and OprG, respectively (41, 42). The RT-qPCR data showed 393
both oprF and oprG genes were significantly down regulated in ATCC 33988 and PAO1 strain 394
when grown in fuel as compared to cells grown in 0.2% glycerol (Table 2). However, oprF and 395
oprG were more repressed in the PAO1 strain than in the ATCC 33988 strain (Table 2). For 396
example, RT-qPCR data showed oprF and oprG were repressed -42.46 and -311.44-fold in the 397
PAO1 strain while the corresponding down regulation of oprF and oprG in ATCC 33988 was 398
only -26.27 and -54.60, respectively. This indicates that PAO1 may be more sensitive than 399
ATCC 33988 to the fuel environment, and that reducing the abundance of these porins may 400
control the uptake of toxic organic compounds from jet fuel. It is likely that down-regulation of 401
porins in PAO1 could contribute to the lower growth rate of this strain in fuels by resulting in 402
lesser ability to transport cell nutrients through these down-regulated outer membrane proteins. 403
Interestingly, the oprF and oprG genes were also highly down regulated in the presence of pure 404
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 19: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/19.jpg)
19
n-alkanes (Table 2). This finding is novel in being the first time it has been shown that the 405
expression of oprF and oprG are regulated by n-alkanes. These results suggest OprF and OprG 406
may be involved in the uptake of n-alkanes. The RT-qPCR analyses revealed that OprF and 407
OprG were controlled differentially by n-alkanes and aromatic compounds in fuel. The RT-408
qPCR showed that oprF expression in PAO1 was reduced 4.6-fold in comparison to ATCC 409
33988 when grown in pure n-alkanes (Table 2). However, the repression of oprF in PAO1 410
compared to ATCC 33988 was only 1.6-fold in jet fuel. On the contrary, oprG was 5.7-fold more 411
repressed in PAO1 than in ATCC 33988 grown in Jet A, which contains aromatics, but only 1.2-412
fold repressed in n-alkanes (Table 2). Based on these results, it appears that OprF may have a 413
more central role in alkane uptake than OprG. Both OprF and OprG have been shown to play an 414
important role in resistance to aromatic hydrocarbons in P. aeruginosa (41, 42). 415
In addition to being able to prevent the internalization of toxic hydrocarbons, cells have 416
also developed adaptive mechanisms to extrude these toxic compounds. The efflux-mediated 417
extrusion of toxic compounds has been shown to be a major determinant in bacterial resistance to 418
exogenous toxic compounds, including aromatics (43, 44). The two P. aeruginosa strains 419
compared in this study cannot degrade aromatic hydrocarbons; therefore accumulation of any 420
toxic compounds could lead to cell death. The efflux mediated extrusion of toxic compounds is 421
one of the major adaptive mechanisms in P. aeruginosa. P. aeruginosa has at least 20 different 422
efflux pumps and some of them are uncharacterized. The tripartite resistance-nodulation-cell 423
division (RND) efflux pumps are one of the most effective ways of detoxifying and removing 424
aromatic solvents (44). The genetic overexpression of RND efflux systems from P. putida in E. 425
coli conferred biofuel tolerance (45). Recent results have demonstrated that multiple RND efflux 426
pumps were upregulated in P. aeruginosa ATCC 33988 when grown in fuel (5). Furthermore, 427
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 20: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/20.jpg)
20
blocking the efflux pumps with an efflux blocker molecule during fuel growth led to growth 428
reduction in P. aeruginosa (5). These results indicated that the outer membrane porins and the 429
tripartite RND efflux systems in Gram negative bacteria could be working in tandem to provide 430
fuel tolerance. Elevated adaptation to fuel toxicity can be achieved via activating efflux pumps 431
or by reducing the uptake of toxic materials into the cell (46). In this study, microarray data 432
showed the mexG and mexH efflux pump genes of ATCC 33988 were highly induced, 7.58-and 433
4.07-fold, respectively, in jet fuel compared to PAO1 (Table 1). However, differential expression 434
of other efflux pumps such as MexCD, and MexEF in jet fuel was not observed. These results 435
suggested that while the MexGHI-OpmD efflux pump could be conferring additional resistance 436
to jet fuel in ATCC 33988, most Mex efflux pumps could be acting as a general mechanism of 437
resistance in P. aeruginosa by the extrusion of toxic hydrocarbons that enter the cell. 438
It has been shown that efflux pumps have an important role in resistance to aromatic 439
solvents such as toluene, benzene and ethylbenzene but their role in extrusion and resistance to 440
n-alkanes have not been characterized. To determine if efflux pumps also have a role in the 441
resistance of P. aeruginosa to alkanes, the known efflux pump inhibitor compound, Phe-Arg-442
naphthylamide (PAβN), a c-capped dipeptide, was utilized to block the RND efflux pumps and 443
determine the effects this blockage may have on cell viability in different fuels. The compound 444
PAβN, also known as MC-207 is a generalized RND efflux pump inhibitor acting directly on the 445
RND efflux pumps without affecting the proton gradient and the electrical potential across the 446
inner cell membrane (47, 48) 447
448
In this assay, PAβN was applied at concentrations of 0, 20, 60, and 80µg/ml to M9 449
minimal media containing the different fuels. As previously reported by Gunasekera et al., (5), 450
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 21: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/21.jpg)
21
our results showed that treating P. aeruginosa cells with PAβN while growing in the presence of 451
Jet A fuel led to growth inhibition for several days (Figure 3a). Furthermore, the efflux pump 452
inhibitor is effective against P. aeruginosa in n-dodecane and n-hexadecane solvents (Figure 3 b, 453
c). These results indicated that blocking efflux pumps in the presence of alkanes can also lead to 454
cell toxicity as was previously reported for aromatic hydrocarbons (5). As previously 455
demonstrated (5), the efflux pump inhibitor PAβN is non-toxic and does not inhibit the growth of 456
P. aeruginosa in the absence of hydrocarbons. Furthermore, the results indicated that P. 457
aeruginosa efflux pumps are involved in alkane extrusion and resistance to fuel of diverse 458
hydrocarbon compositions. Thus, efflux pump inhibitors may be used to prevent bio-459
contamination in multiple fuels independently of their hydrocarbon composition. 460
461
Regulation of gene expression in alkanes. alkB1 and alkB2 genes encoding alkane 462
monooxygenases were up regulated in the ATCC 33988 strain compared to the PAO1 strain 463
(Figure 4). By microarray alkB1 and alkB2 were up-regulated 10.26-and 15.27- fold 464
respectively. Microarray expression results were validated by RT-qPCR, which showed the 465
expression alkB1 and alkB2 genes were 2.93 and 3.63-fold higher in ATCC 33988 than in PAO1 466
(Figure 4). Both microarray and RT-qPCR showed alkB1 and alkB2 were highly induced in P. 467
aeruginosa ATCC 33988 compared to the PAO1 strain. The expression of alk genes was highly 468
induced in fuel compared to glycerol, suggesting that both strains have active alkane 469
monooxygenases. To address whether the weaker expression of alk genes in PAO1 was the 470
primary reason for the slower growth in jet fuel; we overexpressed the alkB1 and alkB2 genes in 471
the PAO1 strain. 472
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 22: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/22.jpg)
22
Furthermore, to explore the possibility that strain-specific polymorphisms in the promoter 473
region of alk genes (presented later) were affecting the transcriptional regulation of these genes, 474
we tested whether the ATCC 33988 alkB1 and alkB2 promoters would stimulate higher 475
expression of the alk genes in PAO1. To this end, we cloned the alk genes with their strain-476
specific promoters into the pHERD20T plasmid and overexpressed these genes in the wild type 477
PAO1 strain. When alkB1 was overexpressed with PAO1 and ATCC 33988 native promoters in 478
the PAO1 strain, the alkB1 mRNA level increased 17- and 15.9-fold, respectively. Similarly, 479
when alkB2 was overexpressed with PAO1 and ATCC 33988 native promoters in the PAO1 480
strain, the alkB2 mRNA level increased 9.87- and 4.37-fold, respectively (Figure 5b). 481
Overexpression of alk genes using native promoters stimulated the growth of PAO1 in fuel 482
(Figure 5). Significant growth induction and faster growth rate was noticed with the 483
overexpression of the alkB2 gene. These results support the transcriptomic data that indicated 484
alkB2 is poorly expressed in the PAO1 strain. Overall, the over-expression of either alk gene in 485
PAO1 did not shorten the lag phase or increase the growth rates to the levels of the ATCC 33988 486
strain, indicating that other cellular factors and adaptive mechanisms may have contributed to the 487
ability of P. aeruginosa ATCC 33988 to be an aggressive hydrocarbon degrader. 488
The rate of hydrocarbon degradation by P. aeruginosa strains and recombinant cell lines 489
carrying additional copies of the alkane monooxygenease genes was measured by GC-MS 490
(Figure 6). P. aeruginosa ATCC 33988 was shown to degrade n-C12, n-C14, n-C16, and 491
isoparaffins significantly (p<0.01) faster than the PAO1 strain (Figure 6). The genetically 492
modified PAO1 strain carrying additional alkane monooxygenease genes degraded n-C12, n-C14, 493
and n-C16 faster than did the wild type PAO1 strain and PAO1 cell line with the empty plasmid. 494
The alkane degradation rate of strains carrying additional alkB genes was consistent with the 495
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 23: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/23.jpg)
23
growth and mRNA expression results. However, overexpression of alkB1 or alkB2 in PAO1 did 496
not increase the degradation of isoparaffins suggesting that P. aeruginosa ATCC 33988 utilizes a 497
different mechanism to degrade isoparaffinic hydrocarbons. 498
The substrate specificity of the two P. aeruginosa strains was further characterized using 499
pure normal alkanes n-C8, n-C10, n-C12, n-C14, n-C16 as a sole carbon source. Both strain utilized 500
n-C12, n-C14, and n-C16 (Figure 7). However, due to the limited O2 availability in the culture 501
tubes, the observed growth rates and total biomass were somewhat lower than those presented by 502
Marín et al., (37) when P. aeruginosa RR1 was grown in well aerated flasks. Interestingly, the P. 503
aeruginosa PAO1 strain could not utilize n-C8 or n-C10 as a carbon source, indicating that these 504
two strains have different alkane specificities (Figure 7). 505
To determine if the lack of growth by PAO1 in n-C8 was due to an inability to metabolize 506
n-C8 or toxicity, both PAO1 and ATCC 33988 were grown in n-C8 and n-C10 in the presence of 507
0.2% glycerol as a source of simple carbon, and the growth compared against cells in 0.2% 508
glycerol. It was expected that if n-C8 was toxic to the cells, a growth reduction would be 509
observed in samples containing alkanes with glycerol. The results indicated that n-C8 was 510
somewhat toxic to both strains but it showed a higher toxic towards the PAO1 strain (Figure 8). 511
This indicates ATCC 33988 was better adapted to overcome n-C8 toxicity and utilize n-C8 as a 512
sole carbon source. The n-C10 did not pose toxicity to any of the two strains (Figure 8). 513
Since alkB1 and alkB2 are structurally the same at the amino acid level in both strains, it 514
is assumed either alk genes are not induced by n-C8 and n-C10 in PAO1 or that an additional 515
functional alkane monooxygenase may be present in P. aeruginosa ATCC 33988 strain. 516
517
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 24: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/24.jpg)
24
Promoter polymorphism and alk genes regulation in Pseudomonas aeruginosa strains 518
Transcriptomic data revealed that the expression of alkB1 and alkB2 genes was weaker in the 519
PAO1 strain than in the ATCC 33988 strain when fuel was used as a carbon source (Figure 4). In 520
comparison to the ATCC 33988 strain, alkB1 and alkB2 coding regions in the PAO1 strain have 521
two synonymous SNPs; therefore, the nucleotide differences do not translate into amino acid 522
differences (Table S1). Further analysis of coding sequences showed that most SNPs in genes 523
involved in hydrocarbon adaptation (5) were silent (Table S1). Thus, these results supported the 524
notion that differences in the hydrocarbon adaptation between strains was due to changes in 525
transcriptional response rather than changes in the amino acids sequences of the corresponding 526
proteins. 527
However, SNPs were also found in the promoter regions of genes alkB1 and alkB2 528
(Figure S1 & S2). Transcription start sites of the alkB1 and alkB2 promoters have been 529
discussed previously (30). Two nucleotide polymorphic sites were identified in the alkB1 530
promoter (Figure S1). One SNP was found at position -60 with the base guanine in PAO1 being 531
replaced by the base cytosine in the ATCC 33988 strain. At position -55 an additional guanine 532
was found in the promoter of PAO1 strain. In the alkB2 promoter, a single polymorphic site at 533
position -22 were cytosine in PAO1 was changed to thiamine in ATCC 33988 (Figure S2). 534
These observations raised the possibility that nucleotide differences in the promoters of each 535
strain could be responsible for the differential expression of the alk genes. 536
To address this possibility, alkB1 and alkB2 gene promoters from PAO1 and ATCC 537
33988 were individually fused to the green fluorescence protein (gfp) reporter gene, cloned into 538
the pHERD20T vector and transformed into PAO1 and ATCC 33988 genetic backgrounds. 539
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 25: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/25.jpg)
25
Transformed cells were grown in M9 minimal media with alkanes, and the promoter induction 540
determined by measuring the levels of GFP fluorescence using a fluorometer. In the transformed 541
P. aeruginosa ATCC 33988 strain, expression from the PAO1 alkB1 and alkB2 promoters was 542
weaker than expression from the ATCC 33988 alkB1 and alkB2 promoters (Figure 9). The 543
alkB1 promoters were less active than the alkB2 promoters in the PAO1 strain; where reliably 544
measurable levels of induction were present only after 17 days (Figure 9). However, both 545
versions of the alkB1 promoters were measurably active in ATCC 33988 as early as day nine in 546
fuel. These results suggested that regulatory genes that induced the expression of alkB1 in 547
ATCC 33988 may be missing or defective in the PAO1 strain. 548
In contrast to the results obtained with the alkB1 promoters, the alkB2 promoter from 549
ATCC 33988 was highly induced in both ATCC 33988 and PAO1 genetic backgrounds 550
producing high level of GFP expression. However, induction levels were significantly higher in 551
the ATCC 33988 strain than in PAO1 (Figure 9). The result indicated the alkB2 promoter of 552
PAO1 was not as active as the alkB2 promoter from ATCC 33988. These functional results 553
confirmed the transcriptomic results obtained from P. aeruginosa cDNA arrays in which alkB1 554
and alkB2 genes were significantly induced in the ATCC 33988 strains compared to the PAO1 555
strain. The poor induction of the PAO1 alkB2 promoter in the ATCC 33988 strain compared to 556
its own alkB2 promoter indicated the PAO1 alkB2 promoter may bind relatively weakly to RNA 557
polymerase or associated transcription factors. The SNPs in the ATCC 33988 alkB2 promoter 558
may have contributed to this difference. A single nucleotide polymorphism in the promoter 559
region of the orf2-folC-operon of Streptococcus suis was shown to influence the bacterial 560
pathogenicity dramatically (15). This study demonstrated polymorphism of a single nucleotide in 561
the promoter region is sufficient to significantly change the gene expression. A single-nucleotide 562
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 26: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/26.jpg)
26
mutation in the -10 promoter region was shown to inactivate the narK2X promoter in 563
Mycobacterium bovis and Mycobacterium bovis BCG (49). Similarly, here we have 564
demonstrated using GFP as a reporter gene, that alk gene promoter polymorphisms greatly affect 565
the expression of alk genes. 566
The regulation of the alk genes in P. aeruginosa has not been well-characterized. An 567
alkS holmolog has not been found in the P. aeruginosa genome. However, the crc and hfq genes 568
whose products repress AlkS expression were down-regulated 1.95 and 4.52–fold, respectively, 569
in P. aeruginosa ATCC 33988 grown in Jet A as compared to cells grown in 0.2% glycerol. RT-570
qPCR results further confirmed that crc and hfq genes were significantly down-regulated in both 571
strains when grown in Jet A as compared to glycerol. This indicates the Crc/Hfq translational 572
repressors may play a role in controlling expression of alk genes in P. aeruginosa strains. In P. 573
putida, CrcZ, a non-coding RNA which contains six CA motifs binds to Hfq and negatively 574
regulates Hfq levels in the cell (12). Both P.aeruginosa strains encode the 407 nucleotide non-575
coding RNA, CrcZ. The RT-qPCR results indicated that CrcZ was upregulated 1.52-fold in 576
ATCC 33988 strain. The protein GntR was proposed to play a role in alk gene expression in P. 577
aeruginosa, (50) and our transcriptional study showed marginal induction (1.85-fold) of gntR in 578
the ATCC 33988 strain grown in Jet A as compared to glycerol. However, differential 579
expression of gntR between ATCC 33988 and PAO1 when grown in Jet A was not observed. 580
Moreover, none of the alk promoters were induced in the presence of 0.2% glycerol, 581
suggesting alk genes are inducible and not constitutively expressed in P. aeruginosa. Therefore, 582
it is possible that an alk gene-specific transcriptional regulator present in P. aeruginosa but the 583
identity of such factor is currently unknown. 584
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 27: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/27.jpg)
27
Predicted functions of hydrocarbon induced novel genes. To gain a deeper understanding of 585
the genes induced by hydrocarbons, the microarray data from this work was compared to a 586
previous microarray study (5), which was conducted to find the differentially expressed genes of 587
the ATCC 33988 strain in jet-fuel compared to glycerol. The analyses revealed that 105 genes 588
were uniquely up-regulated in the ATCC 33988 strain in comparison to the PAO1 strain when 589
grown in jet fuel. Furthermore, these 105 genes were also induced when ATCC 33988 cells were 590
grown in Jet A fuel compared to ATCC 33988 cells grown in 0.2% glycerol. The up-regulation 591
of some of these genes including, PA2779 (11.90-fold increase), PA0588 (17.86-fold increase), 592
PA0830 (2.10-fold increase), PA0365 (2.66-fold increase), and PA5359 (3.97-fold increase) was 593
further confirmed by RT-qPCR. Of these 105 genes, those with unknown function and those 594
differentially expressed were the most likely candidates conferring enhanced adaptation to the 595
ATCC 33988 over PAO1 in fuel. Since induction of these highly up-regulated unknown genes is 596
unique to the fuel adapted ATCC 33988 strain, we have used bioinformatic tools to predict the 597
putative functions of the most up-regulated genes (Table 3 & Table S3). 598
One example of a uniquely induced gene in ATCC 33988 was PA5359, a homolog of 599
PAO1 PA5359. This gene presented a more than 5-fold increase in expression (Table 3) by 600
microarray and 3.97-fold increase in expression by RT-qPCR. Alignment of the RAST-annotated 601
gene sequence from ATCC 33988 with PA5359 taken from the Pseudomonas Genome Database 602
(PGDB) suggested a difference in the predicted open reading frames, whereby the predicted 603
ATCC 33988 gene began at a start codon 72 nucleotides downstream from that of PA5359 604
(Figure 10). To further explore this difference, we re-annotated the ATCC 33988 and PAO1 605
genomes using several gene callers (Prodigal, Glimmer 3, and GeneMarkS) (51, 52, 53), and 606
found that all 3 gene finding methods predicted the shorter gene call for the corresponding gene 607
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 28: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/28.jpg)
28
in both genomes. Whereas the PGDB predicts the length of PA5359 to be 456 base pairs, our 608
analyses predicted the PA5359 gene to be 384 base pairs in length. 609
Promoter prediction analyses using BPROM confirmed the presence of a strong 610
ribosomal binding site (RBS) of consensus sequence AGGAG upstream of the second ATG start 611
codon further supporting the notion that this gene may be mis-annotated in PGDB; a consensus 612
RBS sequence could not be found in the proximal region upstream to the start codon predicted 613
by PGDB (Figure 10). Furthermore, the ATG start codon predicted by PGDB was shown to 614
reside within the -10 box and this is a characteristic feature of the six base pair -10 consensus 615
sequence of Pseudomonas promoters (54). The promoter analyses identified the substitution of 616
adenine for a guanine at the -10 box in ATCC 33988 strain. 617
To characterize if the single nucleotide polymorphism at the -10 promoter region may 618
play a role in the increased expression of ATCC 33988 PA5359 in the presence of hydrocarbons, 619
the PA5359 gene from ATCC 33988 and PAO1 with their native promoters were cloned into the 620
pHERD20T expression vector and expressed individually in the PAO1 strain in the presence of 621
hydrocarbon. Overexpression of the PA5359 gene from ATCC 33988 in PAO1 improved the 622
growth of the PAO1 strain significantly but not so the expression of PA5359 gene from PAO1 in 623
the PAO1 (Figure 11a). These results suggested a possible role of the PA5359 protein in 624
hydrocarbon tolerance (Figure 11a), and the SNP in the promoter apparently is playing a role in 625
the expression and regulation of this gene. Interestingly, a published study using a pathogenic 626
strain of P. aeruginosa, showed PA5359 was up-regulated in the presence of proanthocyanidins, 627
and was implicated in biofilm formation (55). Bioinformatic analysis revealed that PA5359 is a 628
predicted lipoprotein with a conserved ‘Yx(FWY)xxD’ motif of unknown function (COG4315), 629
shared with the bacterial adhesins. Furthermore, by means of blastp it was found that PA5359 630
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 29: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/29.jpg)
29
aligned over a length of 49 residues, including the ‘Yx(FWY)xxD’ motif, with PA1784, a gene 631
of unknown function that is found in the CAZy database (31), a database of genes believed to be 632
involved in carbohydrate metabolism. Analysis of PA5359 using SPRINT-CBH (30) predicted 633
the initial ‘Y’ of this motif to be a carbohydrate-binding residue. Taken together, these results, 634
suggests a possible role for PA5359 in cellular adhesion related to biofilm formation. Therefore, 635
it stands to reason that PA5359 may be involved in cell surface chemistry, binding, or biofilm 636
formation, all of which are requisite mechanisms for survival under adverse conditions, such as 637
hydrocarbon-rich environments. 638
Also in ATCC 33988, the operon PA3521-PA3523, which is a probable Resistance-639
Nodulation-Cell Division (RND) efflux pump, was highly up-regulated in Jet A compared to 640
cells grown in glycerol (5). The genes PA3521, PA3522 and PA3523 were upregulated 10.80, 641
5.97 and 15.4 -fold respectively. To understand its potential physiological role, the entire operon 642
(6.2 kb) with its native promoter was cloned into pHERD20T and transformed into ATCC 33988 643
and PAO1 cell lines. Our experimental data showed (Figure 11b) that the ATCC 33988 cell line 644
expressing the PA3521-PA3523 operon grew better, particularly during the exponential phase, 645
than cell lines carrying the empty plasmid vector (Figure 11b). However, overexpression of 646
PA3521-PA3523 in the PAO1 strain did not produce a similar growth increase. No nucleotide 647
differences were found in the promoter region of the PA3521-PA3523 operon between ATCC 648
33933 and PAO1, but the coding region of PA3521 and PA3522 had three and two amino acid 649
polymorphisms, respectively. So far an efflux substrate has not been identify for PA3521-650
PA3523 but this operon was shown to be induced by the presence of heavy metals in the 651
environment (56). 652
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 30: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/30.jpg)
30
Here we have demonstrated that PA5359, the putative efflux pump PA3521-PA3523, and 653
likely other highly up-regulated known and unknown genes may have important roles in the 654
adaptation of P. aeruginosa ATCC 33988 to fuel, and that a transcriptomics approach together 655
with functional assays can be used to discover novel adaptive genes and mechanisms. 656
Competition between closely related hydrocarbon degraders is an important factor affecting the 657
bioremediation process (57). This study provides new insight into the mechanistic differences 658
between closely related strains in relation to adaptation and survival in hydrocarbon rich 659
environment. 660
ACKNOWLEDGMENT 661
This material is based on research sponsored by Air Force Research Laboratory under agreement number 662
FA8650-10-2-2934. The views and conclusions contained herein are those of the authors and should not 663
be interpreted as necessarily representing the official policies or endorsements, either expressed or 664
implied, of Air Force Research Laboratory or the U.S. Government. 665
666
FUNDING INFORMATION 667
Research reported in this article was supported by funds from the United States Air Force Research 668
Laboratory, Fuels and Energy Branch (FA8650-10-2-2934), and the U.S. Department of Energy in 669
collaboration with Lawrence Livermore National Laboratory (IAA DE-NA0002320/0002) to O.N.R. This 670
work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore 671
National Laboratory under Contract DE-AC52-07NA27344. 672
673
674
675
676
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 31: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/31.jpg)
31
References 677
1. Kung VL, Ozer EA, Hauser AR. 2010. The accessory genome of Pseudomonas 678
aeruginosa. Microbiol Mol Biol Rev 74 (Suppl 4):621-641. 679
2. Alonso A, Rojo F, Martínez JL. 1999. Environmental and clinical isolates of 680
Pseudomonas aeruginosa show pathogenic and biodegradative properties irrespective of 681
their origin. Environ Microbiol 1:421-430. 682
3. Grosso-Becerra MV, Santos-Medellín C, González-Valdez A, Méndez JL, Delgado G, 683
Morales-Espinosa R, Servín-González L, Alcaraz LD, Soberón-Chávez G. 2014. 684
Pseudomonas aeruginosa clinical and environmental isolates constitute a single 685
population with high phenotypic diversity. BMC Genomics 15:318. 686
4. Valot B, Guyeux C, Rolland JY, Mazouzi K, Bertrand X, Hocquet D. 2015 May 11. 687
What It Takes to Be a Pseudomonas aeruginosa? The Core Genome of the Opportunistic 688
Pathogen Updated. PLoS One 10(5):e0126468. doi: 10.1371/journal.pone.0126468. 689
eCollection 2015. 690
5. Gunasekera TS, Striebich RC, Strobel EM, Mueller SS, Ruiz ON. 2013. Transcriptional 691
profiling suggests that multiple metabolic adaptations are required for effective 692
proliferation of Pseudomonas aeruginosa in jet fuel. Env Sci Technol 47:13449-13458. 693
6. Striebich RC, Smart CE, GunasekeraTS, Mueller SS, Strobel EM, McNichols, B, Ruiz, 694
ON. 2014. Characterization of the F-76 Diesel and Jet A Aviation Fuel Hydrocarbon 695
Degradation Profiles of Pseudomonas aeruginosa and Marinobacter 696
hydrocarbonoclasticus. Int Biodet Biodegr 93:33-43. 697
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 32: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/32.jpg)
32
7. Brown LM, Gunasekera TS, Ruiz ON. 2014. Draft genome sequence of Pseudomonas 698
aeruginosa ATCC 33988, a bacterium highly adapted to fuel-polluted environments. 699
Genome Announcements 2:13-14. 700
8. Stover CK, Pham XQ, Erwin AL, Mizoguchi SD, Warrener P, Hickey MJ, Brinkman FS, 701
Hufnagle WO, Kowalik DJ, Lagrou M, Garber RL, Goltry L, Tolentino E, Westbrock-702
Wadman S, Yuan Y, Brody LL, Coulter SN, Folger KR, Kas A, Larbig K, Lim R, Smith 703
K, Spencer D, Wong GK, Wu Z, Paulsen IT, Reizer J, Saier MH, Hancock RE, Lory S, 704
Olson MV. 2000. Complete genome sequence of Pseudomonas aeruginosa PAO1, an 705
opportunistic pathogen. Nature 406:959-964. 706
9. Smits TH, Witholt B, van Beilen JB. 2003. Functional characterization of genes involved 707
in alkane oxidation by Pseudomonas aeruginosa. Antonie Van Leeuwenhoek 84:193-708
200. 709
10. Dinamarca MA, Aranda-Olmedo I, Puyet A, Rojo, F. 2003. Expression of the 710
Pseudomonas putida OCT plasmid alkane degradation pathway is modulated by two 711
different global control signals: evidence from continuous cultures. J Bacteriol 185:4772-712
4778. 713
11. Moreno R, Ruiz-Manzano A, Yuste L, Rojo F. 2007. The Pseudomonas putida Crc 714
global regulator is an RNA binding protein that inhibits translation of the AlkS 715
transcriptional regulator. Mol Microbiol 64:665-675. 716
12. Moreno R, Hernández-Arranz S, La Rosa R, Yuste L, Madhushani A, Shingler V, Rojo 717
F. 2015. The Crc and Hfq proteins of Pseudomonas putida cooperate in catabolite 718
repression and formation of ribonucleic acid complexes with specific target motifs. 719
Environ Microbiol. 17:105-18. doi: 10.1111/1462-2920.12499. Epub 2014 Jun 2. 720
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 33: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/33.jpg)
33
13. Sonnleitner E, Bläsi U. 2014. Regulation of Hfq by the RNA CrcZ in Pseudomonas 721
aeruginosa carbon catabolite repression. PLoS Genet10(6):e1004440. doi: 722
10.1371/journal.pgen.1004440. 723
14. Osborne SE, Walthers D, Tomljenovic AM, Mulder DT, Silphaduang U, Duong N, 724
Lowden MJ, Wickham ME, Waller RF, Kenney LJ, Coombes BK. 2009. Pathogenic 725
adaptation of intracellular bacteria by rewiring a cis-regulatory input function. Proc Natl 726
Acad Sci U S A 106:3982-4007. doi:10.1073/pnas.0811669106. Epub 2009 Feb 20. 727
15. De Greeff A, Buys H, Wells JM, Smith HE. 2014. A naturally occurring nucleotide 728
polymorphism in the orf2/folc promoter is associated with Streptococcus suis virulence. 729
BMC Microbiol 14:264. 730
16. Aziz RK, Bartels D, Best AA, DeJongh M, Disz T, Edwards RA, Forsma K, Gerdes S, 731
Glass EM, Kubal M, Meyer F, Olsen GJ, Olson R, Osterman AL, Overbeek RA, McNeil 732
LK, Paarmann D, Paczian T, Parrello B, Pusch GD, Reigh C, Stevens 733
Vassieva O, Vonstein V, Wilke A, Zagnitko O. 2008. BMC Genomics 9:75, doi: 734
10.2286/1471-2164-9-75. 735
17. Leung E, Huang A, Cadag E, Montana A, Lorenz Soliman J, Ecale Zhou CL. 2016. 736
Protein sequence annotation tool (PSAT): A centralized web-based meta-server for high-737
throughput sequence annotations. BMC Bioinformatics 17:43. 738
18. Kumar N, Skolnick J. 2012. EFICAz2.5: application of a high-precision enzyme function 739
predictor to 396 proteomes. Bioinformatics 28:2687-2688, 740
doi:10.1093/bioinformatics/bts510. 741
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 34: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/34.jpg)
34
19. Kanehisa M, Sato Y, Kawashima M, Furumichi M, Tanabe M. 2016. KEGG as a 742
reference resource for gene and protein annotations. Nucleic Acids Research 44:D457-743
D462. 744
20. Caspi R, Altman T, Billington R, Dreher K, Foerster H, Fulcher CA, Holland TA, 745
Keseler IM, Kothari A, Kubo A, Drummenacker M, Latendresse M, Mueller LA, Ong Q, 746
Paley S, Subhraveti P, Weaver DS, Weerasinghe D, Zhang P, Karp PD. 2014. The 747
MetaCyc database of metabolic pathways and enzymes and the BioCyc collection of 748
pathway/genome databases. Nucleic Acids Research 42:D473-479, 749
doi:10.1093/nar/gkp875. 750
21. Chang A, Schomburg I, Placzek S, Jeske L, Ulbrich M, Xiao M, Sensen CW, Schomburg 751
D. 2015. BRENDA in 2015: exciting developments in its 25th year of existence. Nucleic 752
Acids Research 43:D439-446. 753
22. Szklarczyk D, Frandeschine A, Wyder S, Forslund K, Heller D, Huerta-Cepas J, 754
Simonovic M, Roth A, Santos A, Tsafou KP, Kuhn M, bork P, Jensen LJ, von Mering C. 755
2015. STRING v10: protein-protein interaction networks, integrated over the tree of life. 756
Nucleic Acids Research 43:D447-452, doi:10.1093/nar/gku1003.\ 757
23. Jones P, Binns D, Chang H-Y, Fraser M, Li W, McAnulla C, McWilliam H, Maslen J, 758
Mitchell A, nuka G, Pesseat S, Quinn AF, Sangrador-Vegas A, Scheremetjew M, Yong 759
S-Y, Lopez R, Hunter S. 2014. Bioinformatics 30:1236-1240, 760
doi:10.1093/bioinformatics/btu031. 761
24. Petersen TN, Brunak S, von Heijne G, Nielsen H. 2011. SignalP 4.0: discriminating 762
signal peptides from transmembrane regions. Nature Methods 8:785-786. 763
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 35: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/35.jpg)
35
25. Krogh A, Larsson B, von heijne G, Sonnhammer ELL. 2001. Predicting transmembrane 764
protein topology with a Hidden markov Model: application to complete genomes. J. Mol. 765
Biol. 305:567-580. 766
26. Winsor GL, Lam DKW, Fleming L, Lo R, Whiteside MD, Yu NY, Hancock RE, 767
Brinkman FS. 2011. Pseudomonas Genome Database: improved comparative analysis 768
and population genomics capability for Pseudomonas genomes. Nucleic Acids Research 769
39:D596-600, doi:10.1093/nar/gkq869. 770
27. Ren Q, Chen K, Paulsen IT. 2007. TransportDB: a comprehensive database resource for 771
cytoplasmic membrane transport systems and outer membrane channels. Nucleic Acids 772
Research 35:D274-279. 773
28. Sievers F, Wilm A, Dineen DG, Gibson TJ, Karplus K, Li W, Lopez R, McWilliam H, 774
Remmert M, Soding J, Thompson JD, Higgins DG. 2011. Fast, scalable generation of 775
high-quality protein multiple sequence alignments using Clustal Omega. Mol. Syst. Biol 776
77:539, doi:10.1038/msb.2011.75. 777
29. Marchler-Bauer A, Derbyshire MK, Gonzales NR, Lu S, Chitsaz F, Geer LY, Geer RC, 778
He J, Gwadz M, Hurwitz DI, Lanczycki CJ, Lu F, Marcheer GH, Song JS, Thanki N, 779
Wang Z, Yamashita RA, Zhang D, Zheng C, Bryant SH. 2015. CDD: NCBI’s conserved 780
domain database. Nucleic Acids Research 43:D222-6. doi: 10.1093/nar/gku1221. 781
30. Taherzadeh G, Zhou Y, Lieu AW-C, Yang Y. 2016. Sequence-based prediction of 782
protein-carbohydrate binding sites using support vector machines. Journal of Chemical 783
Information and Modeling 56:2115-2122. 784
31. Lombard V, Ramulu HG, Drula E, Coutinho PM, Henrissat B. 2014. The carbohydrate-785
active enzymes database (CAZy) in 2013. Nucleic Acids Research 42; (Database 786
issue):D490-5. doi: 10.1093/nar/gkt1178. 787
32. Savli H, Karadenizli A, Kolayli F, Gundes S, Ozbek U, Vahaboglu H. 2003. Expression 788
stability of six housekeeping genes: A proposal for resistance gene quantification studies 789
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 36: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/36.jpg)
36
of Pseudomonas aeruginosa by real-time quantitative RT-PCR. J Med Microbiol 52:403-790
408. 791
33. Damron FH, McKenney ES, Barbier M, Liechti GW, Schweizer HP, Goldberg JB. 2013. 792
Construction of mobilizable mini-Tn7 vectors for bioluminescent detection of gram-793
negative bacteria and single-copy promoter lux reporter analysis. Appl Environ Microbiol 794
79:4149-4153. 795
34. Peng J, Hao B, Liu L, Wang S, Ma B, Yang Y, Xie F, Li Y. 2014. RNA-Seq and 796
microarrays analyses reveal global differential transcriptomes of Mesorhizobium huakuii 797
7653R between bacteroids and free-living cells. PLoS One; 9(4):e93626. doi: 798
10.1371/journal.pone.0093626. 799
35. Gunasekera TS, Csonka LN, Paliy O. 2008. Genome-wide transcriptional responses of 800
Escherichia coli K-12 to continuous osmotic and heat stresses. J. Bacteriol. 190 (10), 801
3712-3720. 802
36. Bosdriesz E, Molenaar D, Teusink B, Bruggeman FJ. 2015. How fast-growing bacteria 803
robustly tune their ribosome concentration to approximate growth-rate maximization. 804
FEBS J : 282(10):2029-44. 805
806
37. Marín MM, Yuste L, Rojo F. 2003. Differential expression of the components of the two 807
alkane hydroxylases from Pseudomonas aeruginosa. J Bacteriol 185:3232-3237. 808
38. Xie F, Li G, Zhang Y, Zhou L, Liu S, Liu S, Wang C. 2016.The Lon protease homologue 809
LonA, not LonC, contributes to the stress tolerance and biofilm formation of 810
Actinobacillus pleuropneumoniae. Microb Pathog. 93:38-43. 811
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 37: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/37.jpg)
37
39. Domínguez-Cuevas P, González-Pastor JE, Marqués S, Ramos JL, de Lorenzo V. 2006. 812
Transcriptional tradeoff between metabolic and stress-response programs in 813
Pseudomonas putida KT2440 cells exposed to toluene. J Biol Chem 281:11981-11991. 814
40. Ramos JL, Sol Cuenca M, Molina-Santiago C, Segura A, Duque E, Gómez-García MR, 815
Udaondo Z, Roca A. 2015 Mechanisms of solvent resistance mediated by interplay of 816
cellular factors in Pseudomonas putida. FEMS Microbiol Rev. 39:555-66. 817
41. Li L, Komatsu T, Inoue A, Horikoshi K. 1995. A toluene-tolerant mutant of 818
Pseudomonas aeruginosa lacking the outer membrane protein F. Biosci Biotechnol 819
Biochem 59:2358-2359 820
42. Touw DS, Patel DR, van den Berg, B. 2010. The crystal structure of OprG from 821
Pseudomonas aeruginosa, a potential channel for transport of hydrophobic molecules 822
across the outer membrane. PLoS One 5:e15016. 823
43. Fillet S, Daniels C, Pini C, Krell T, Duque E, Bernal P, Segura A, Lu D, Zhang X, Ramos 824
JL. 2012. Transcriptional control of the main aromatic hydrocarbon efflux pump in 825
Pseudomonas. Environ Microbiol Rep 4:158-167. doi:10.1111/j.1758-826
2229.2011.00255.x. Epub 2011 Apr 20. 827
44. Ramos JL, Duque E, Gallegos MT, Godoy P, Ramos-Gonzalez MI, Rojas A, Teran W, 828
Segura A. 2002. Mechanisms of solvent tolerance in gram-negative bacteria. Annu Rev 829
Microbiol 56:743-768. 830
45. Dunlop MJ, Dossani ZY, Szmidt HL, Chu HC, Lee TS, Keasling JD, Hadi MZ, 831
Mukhopadhyay A. 2011. Engineering microbial biofuel tolerance and export using efflux 832
pumps. Mol Syst Biol 7:487. 833
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 38: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/38.jpg)
38
46. Jones CM, Hernández Lozada NJ, Pfleger BF. 2015. Efflux systems in bacteria and their 834
metabolic engineering applications. Appl Microbiol Biotechnol 99:9381-9393. 835
doi:10.1007/s00253-015-6963-9. Epub 2015 Sep 12. 836
47. Lomovskaya O, Warren MS, Lee A, Galazzo J, Fronko R, Lee M, Blais J, Cho D, 837
Chamberland S, Renau T, Leger R, Hecker S, Watkins W, Hoshino K, Ishida H, Lee VJ. 838
2001. Identification and characterization of inhibitors of multidrug resistance efflux 839
pumps in Pseudomonas aeruginosa: novel agents for combination therapy. Antimicrob 840
Agents Chemother. 45:105-16. 841
48. Zechini B, Versace I. 2009. Inhibitors of Multidrug Resistant Efflux Systems in Bacteria. 842
Recent Patents on Anti-Infective Drug Discovery 4: 37-50 37 843
49. Chauhan S, Singh A, Tyagi JS. 2010. A single-nucleotide mutation in the -10 promoter 844
region inactivates the narK2X promoter in Mycobacterium bovis and Mycobacterium 845
bovis BCG and has an application in diagnosis. FEMS Microbiol Lett 303:190-196. 846
50. Rojo F. 2009. Degradation of alkanes by bacteria. Environ Microbiol 11:2477-2490. 847
51. Hyatt D, Chen G-L, LoCascio PF, Land ML, Larimer FW, Hauser LJ. 2010. Prodigal: 848
prokaryotic gene recognition and translation initiation site identification. BMC 849
Bioinformatics 11:119. doi:10.1186/1471-2105-11-119. 850
52. Belcher AL, Brake KA, Powers EC, Salzburg SL. 2007. Identifying bacterial genes and 851
endosymbiont DNA with Glimmer. Bioinformatics 23:673-679. 852
doi:10.1093/bioinformatics/btm009. 853
53. Bessemer J, Lomsadze A, Borodovsky M. 2001. GeneMarkS: a self-training method for 854
prediction of gene starts in microbial genomes. Implications for finding sequence motifs 855
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 39: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/39.jpg)
39
in regulatory regions. Nucleic Acids Research 29:2607-2018. 856
doi:10.1093/nar/29.12.2607. 857
54. Ramirez-Santos, J, Collado-Vides, J, Garcia-Varela, M, Gomez-Eichelmann, MC. 2001. 858
Conserved regulatory elements of the promoter sequence of the gene rpoH of enteric 859
bacteria. Nucleic Acids Res 29:380-386. 860
55. Ulrey RK, Barksdale SM, Zhou W, van Hoek ML. 2014. Cranberry proanthocyanidins 861
have anti-biofilm properties against Pseudomonas aeruginosa. BMC Complementary and 862
Alternative Medicine 14:499. 863
56. Teitzel GM, Geddie A, De Long SK, Kirisits MJ, Whiteley M, Parsek MR. 2006. 864
Survival and growth in the presence of elevated copper: transcriptional profiling of 865
copper-stressed Pseudomonas aeruginosa. J Bacteriol. 188:7242-56. 866
57. Ruiz ON, Brown LM, Striebich RC, Smart CE, Bowen LL, Lee JS, Little BJ, Mueller, 867
SS, Gunasekera TS. 2016. Effect of Conventional and Alternative Fuels on a Marine 868
Bacterial Community and the Significance to Bioremediation. Energy & Fuels 30: 434–869
444. 870
58. Jones CJ, Newsom D, Kelly B, Irie Y, Jennings LK, Xu B, Limoli DH, Harrison JJ, 871
Parsek MR, White P, Wozniak DJ. 2014. ChIP-Seq and RNA-Seq reveal an AmrZ-872
mediated mechanism for cyclic di-GMP synthesis and biofilm development by 873
Pseudomonas aeruginosa. PLOS Pathogens March 6, 2014 874
http://dx.doi.org/10.1371/journal.ppat.1003984. 875
876
59. Palma M, DeLuca D, Worgall S, Quadri LEN. 2004. Transcriptome analysis of the 877
response of Pseudomonas aeruginosa to hydrogen peroxide. J Bacteriol 186: 248-252. 878
879 60. Gaillard M, Pernet N, Vogne C, Hagenbuchle O, van der Meer JR. 2008. Host and 880
invader impact of transfer of the clc genomic island into Pseudomonas aeruginosa 881
PAO1. PNAS 105 (19) 7058-63. 882
883
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 40: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/40.jpg)
40
61. Folsom JP, Richards L, Pitts B, Roe F, Ehrlich GD, Parker A, Mazurie A, Stewart PS. 884
2010. Physiology of Pseudomonas aeruginosa in biofilms as revealed by transcriptome 885
analysis. BMC Microbiology 10:294 doi:10.1186/1471-2180-10-294. 886
887 62. Huse HK, Kwon T, Zlosnik JEA, Speert DP, marcotte EM, Whiteley M. 2010. Parallel 888
evolution in Pseudomonas aeruginosa over 39,000 generations in vivo. mBio 889
doi:10.1128/mBio.00199-10. 890
891 63. Perez-Martinez I, Haas D. 2011. Azithromycin inhibits expression of the GacA-892
dependent small RNAs RsmY and RsmZ in Pseudomonas aeruginosa. Antimicrobial 893
Agents and Chemotherapy 55:3399-3405. 894
895 64. Ravichandran A, Sugiyama N, Tomita M, Swarup S, Ishihama Y. 2009. Ser/Thr/Tyr 896
phosphoproteome analysis of pathogenic and non-pathogenic Pseudomonas spp. 897
Proteomics 9:2764-2775 898
899 65. Tan SY1, Chua SL, Chen Y, Rice SA, Kjelleberg S, Nielsen TE, Yang L, Givskov M. 900
2013. Identification of five structurally unrelated quorum-sensing inhibitors of 901
Pseudomonas aeruginosa from a natural-derivative database. Antimicrobial Agents and 902
Chemotherapy 57: 5629-5641. 903
904 66. Alvarez-Ortega C, Harwood CS. 2007. Responses of Pseudomonas aeruginosa to low Ox 905
indicate that growth in the cystic fibrosis lung is by aerobic respiration" Mol Microbiol 906
65:153-165. 907
908 67. Wood L, Ohman DE. 2009. Use of cell wall stress to characterize sigma22 (AlgT/U) 909
activation by regulated proteolysis and its regulon in Pseudomonas aeruginosa. Mol 910
Microbiol 72:183-201. 911
912 68. Gooderham WJ, Gellantly SL, Sanschagrin F, McPhee JB, Bains M, Cosseau C, 913
Levesque RC, Hancock RE. 2009. The sensor kinase PhoQ mediates virulence in 914
Pseudomonas aeruginosa. Microbiology 155:699-711. 915
916
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 41: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/41.jpg)
41
69. Grininger M, Zeth K, Oesterhelt D. 2006. Dodecins: a family of lumichrome binding 917
proteins. Journal of Molecular Biology 357:842-857. 918
919 70. Marti-Arbona R, Raushel FM. 2006. Mechanistic characterization of N-formimino-L-920
glutamate iminohydrolase from Pseudomonas aeruginosa. Biochemistry 45:14256-921
14262. 922
923 71. Skindersoe ME, Alhede M, Phipps R, Yang L, Jensen PO, Rasmussen TB, Bjarnsholt T, 924
Tolker-Nielsen T, Hoiby N, Givskov M. 2008. Effects of antibiotics on quorum sensing 925
in Pseudomonas aeruginosa. Antimicrobial Agents and Chemotherapy 52:3648-3663. 926
927 72. Snyde LA, Loman NH, Faraj LA, Levi K, Weinstock G, Boswell TC, Pallen MJ, 928
Ala'Aldeen DA. 2013. Epidemiological investigation of Pseudomonas aeruginosa 929
isolates from a six-year-long hospital outbreak using high-throughput whole genome 930
sequencing. Euro Surveill. 18: 42 931
932 73. Klockgether J, Miethke N, Kubesch P, Bohn Y, Brockhausen I, Cramer N, Eberl L, 933
Greipel J, Herrmann C, Herrmann S, Horatzek S, Lingner M, Luciano L, Salunkhe P, 934
Schombur D, Wehsling M, Wiehlmann L, Davenport CF, Tummler B. 2012. Intraclonal 935
diversity of the Pseudomonas aeruginosa cystic fibrosis airway isolates TBCF10839 and 936
TBCF121838: distinct signatures of transcriptome, proteome, metabolome, adherence 937
and pathogenicity despite an almost identical genome sequence. Environ Microbiol 938
15:191-210. 939
940 74. Park AJ, Murphy K, Krieger JR, Brewer D, Taylor P, Habash M, Khursigara CM. 2014. 941
A temporal examination of the planktonic and biofilm proteome of whole cell 942
Pseudomonas aeruginosa PAO1 using quantiatvie mass spectrometry. Molecular & 943
Cellular Proteomics 13:1095-1105. 944
945 75. Patell S, Gu M, Davenport P, Givskov M, Waite RD, Welch M. 2010. Comparative 946
microarray analysis reveals that the core biofilm-associated transcriptome of 947
Pseudomonas aeruginosa comprises relatively few genes. Environmental Microbiology 948
Reports 2:440-448. 949
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 42: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/42.jpg)
42
Figure 1 950
951
952
953
447 genes up-regulated 528 genes down-regulated
Fold change
Sign
ifica
nce
(-10L
og10
P-v
alue
)
alkB2
alkB1
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 43: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/43.jpg)
43
954
955
956 957
958
Figure 2
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 44: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/44.jpg)
44
959
Figure 3
a
b
c
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 45: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/45.jpg)
45
960
961
962
963
cDNA
Cop
ies/
g of
RNA
ATCC3398
8 Gly
ATCC3398
8 Jet
A
PAO1 Gly
PAO1 Jet
A
964
965
966
Gene/condition
Microarray Fold change qRT-PCR Fold Change
alkB1 – Jet A (ATCC 33988/PAO1)
+10.26 +2.93
alkB2 –Jet A (ATCC 33988/PAO1)
+15.27 +3.68
967
968
Figure 4
b
c
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 46: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/46.jpg)
46
Figure 5a 969
970
Strain alkB1 induction Fold change pHERD20T in PAO1 cells 1 pHERD20T-alkB1 PAO1 in PAO1 cells 17.0 pHERD20T-alkB1 Ps ATCC 33988 in PAO1 cells 15.9
Figure 5b 971
OD
(600
nm
)
972
Strain alkB2 induction Fold change pHERD20T in PAO1 cells 1 pHERD20T-alkB2 PAO1 in PAO1 cells 9.87 pHERD20T-alkB2 Ps ATCC 33988 in PAO1 cells 4.32
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 47: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/47.jpg)
47
973
974
% R
emai
ning
4 7 114 7 11
% R
emai
ning
4 7 11
% R
emai
ning
4 7 11
975
976
977
978
979
980
981
Figure 6
* * *
** *
* * *
** *
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 48: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/48.jpg)
48
982
983
984
985
986
987
988
Figure 7
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 49: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/49.jpg)
49
C 8 + 0 .2 % g ly c e ro l
T im e (h rs )
OD
(60
0 n
m)
0 6 2 1 2 5 2 9 4 6 5 1 5 4 7 20 .0
0 .5
1 .0
1 .5
2 .0
2 .5
n C8 a n d 0 .2 % g ly c e ro l - P . a e ru g in o s a P A O 1
n C 8 a n d 0 .2 % g ly c e ro l - P . a e ru g in o s a A T C C 3 3 9 8 8
0 .2 % g ly c e ro l- P . a e ru g in o s a P A O 1
0 .2 % g ly c e ro l- P . a e ru g in o s a A T C C 3 3 9 8 8
C 1 0 + 0 .2 % g ly c e ro l
T im e (h rs )
OD
(60
0 n
m)
0 6 2 1 2 5 2 9 4 6 5 1 5 4 7 20 .0
0 .5
1 .0
1 .5
2 .0
2 .5
n C 1 0 a n d 0 .2 % g ly c e ro l - P . a e ru g in o s a P A O 1n C 1 0 a n d 0 .2 % g ly c e ro l - P . a e ru g in o s a A T C C 3 3 9 8 8
0 .2 % g ly c e ro l- P . a e ru g in o s a A T C C 3 3 9 8 8
0 .2 % g ly c e ro l- P . a e ru g in o s a A T C C 3 3 9 8 8
989
Figure 8
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 50: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/50.jpg)
50
990
991
992
993
994
Figure 9
d
e
a b c
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 51: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/51.jpg)
51
995
Figure 10 996
997
ATCC33988_PA5359 GGTCTTGCCTCGGGTCGATCTGTCTTGCGCCGCATTAGATAACGAAATTGTGTCAGGTATG 998
PAO1_PA5359 GGTCTTGCCTCGGGTCGATCTGTCTTGCGCCGCATTAGATAACGAAATTGTGTCAGGTATG 999
1000
TGACACAACGGCGTAGTTTCCGCCGACTGCCCGCGGCGGGGCTATGCTCAACAGGTTCCGGTGCCGTCCCTGCGG 1001
TGACACAACGGCGTAGTTTCCGCCGACTGCCCGCGGCGGAGCTATGCTCAACAGGTTCCGGTGCCGTCCCTGCGG 1002
1003
GCGGCGAACGCTCCACCTGAAGACACAGGAGAGAGACGCGATG 1004
GCGGCGAACGCTCCACCTGAAGACACAGGAGAGAGACGCGATG 1005
1006
1007
-10 Box -35 Box
RBS
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 52: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/52.jpg)
52
Figure 11 1008
(a) 1009
1010
(b) 1011
1012
Days after inoculation0 5 10 15 20 25 30
0.0
0.5
1.0
1.5
2.0
2.5
3.0
P. aeruginosa ATCC 33988 pHERD20T::PA3521-PA3523P. aeruginosa ATCC 33988 pHERD20TP. aeruginosa PAO1 pHERD20T::PA3521-PA3523P. aeruginosa PAO1 pHERD20T
1013
1014
1015
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 53: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/53.jpg)
53
Table 1 Differentially expressed genes that are possibly related to energy metabolism and adaptation. 1016 Compete gene list are shown in Table S2 1017
1018
1019 Gene ID Gene
Name Fold
Change Gene function/description COG
Genes related to energy metabolism
PA2574 alkB1 10.76 alkane-1-monooxygenase Carbon compound catabolism
PA1525 alkB2 15.27 alkane-1-monooxygenase 2 Carbon compound catabolism
PA5427 adhA 3.55 alcohol dehydrogenases Carbon compound catabolism
Genes related to Membrane Protein/Transport of Small Molecules/Efflux Pumps
PA1777 oprF 21.38 Major porin and structural outer membrane porin OprF precursor
Membrane proteins; Transport of small molecules
PA2853 oprI 19.3 Outer membrane lipoprotein OprI precursor
Membrane proteins
PA4067 oprG 4.12 Outer membrane protein OprG precursor
Membrane proteins
PA4205 mexG 7.58 probable RND efflux membrane fusion protein precursor
Membrane proteins
PA4206 mexH 4.07 probable RND efflux membrane fusion protein precursor
Membrane proteins
PA0958 oprD 7.89 Basic amino acid, basic peptide and imipenem outer membrane porin OprD precursor
Transport of small molecules
PA1178 oprH 4.48 PhoP/Q and low Mg2+ inducible outer membrane protein H1 precursor
Membrane proteins; Adaptation, Protection; Transport of small molecules
PA1777 oprF 21.38 Major porin and structural outer membrane porin OprF precursor
Membrane proteins; Transport of small molecules
PA2853 oprI 19.3 Outer membrane lipoprotein OprI precursor
Membrane proteins
Heat Shock Proteins/Adaptation & Protection/Oxidative Stress/Stress Regulation
PA0376 rpoH 3.9 sigma factor RpoH Transcriptional regulator
PA4761 dnaK 2.83 DnaK protein Chaperones & heat shock proteins
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 54: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/54.jpg)
54
PA3622 rpoS 4.92 sigma factor RpoS Transcriptional regulator
PA1803 lon 3.76 Lon protease Adaptation, Protection
PA4386 groES 5.15 GroES protein Chaperones & heat shock proteins
PA4366 sodB 6.08 superoxide dismutase Adaptation, Protection
PA4236 katA 4.16 catalase Adaptation, Protection
PA1801 clpP 3.82 ATP-dependent Clp protease proteolytic subunit
Chaperones & heat shock proteins
PA1802 clpX 4.17 ClpX Chaperones & heat shock proteins; Cell wall / LPS / capsule
PA3227 ppiA 2.5 peptidyl-prolyl cis-trans isomerase A Chaperones & heat shock proteins
PA1444 fliN 2.29 flagellar motor switch protein FliN Chemotaxis; Adaptation, Protection; Motility & Attachment
Transcriptional Regulators
PA3622 rpoS 4.92 sigma factor RpoS Transcriptional regulators PA0376 rpoH 3.9 sigma factor RpoH Transcriptional regulators PA0762 algU 3.84 sigma factor AlgU Transcriptional regulators PA3351 flgM 10.09 FlgM Transcriptional regulators PA5253 algP 9.01 alginate regulatory protein AlgP Transcriptional regulators PA0763 mucA 8.67 anti-sigma factor MucA Transcriptional regulators;
Cell wall / LPS / capsule PA5499 zur 5.98 transcriptional regulator np20 Transcriptional regulators
1020
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 55: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/55.jpg)
55
1021 1022 Table 2. Down-regulation of genes encoding OprF and OprG outer membrane porins 1023
Gene/condition qRT-PCR fold change
oprF ATCC 33988 jetA/glycerol -26.27 oprF ATCC 33988 Alkanes /glycerol -23.83 oprF PAO1 jetA/glycerol -42.46 oprF PAO1 Alkanes /glycerol -110.07 oprG ATCC 33988 jetA/glycerol -54.60 oprG ATCC 33988 Alkanes /glycerol -228.47 oprG PAO1 jetA/glycerol -311.44 oprG PAO1 Alkanes /glycerol -265.02
1024
1025
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 56: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/56.jpg)
56
Table 3. Functional annotation of up-regulated unknown hypothetical genes from P. aeruginosa 1026 ATCC33988 1027 1028 PAO1 Corresponding Gene ID
Fold Change
Putative Function Category
Gene Function / Description Literature Citation
PA3235 37.04 Membrane-associated protein; putative membrane protein 2C, clustering with ActP (cation/acetate symporter)
58, 59, 60,61
PA2779 16.14 Secreted or membrane-anchored protein of unknown function 62
PA0588 14.03 Phosphorylation Putative serine/threonine protein kinase, PrkA; P-loop motif 63, 64, 65, 66
PA0830 12.84 Hydrolysis Putative metal-dependent hydrolase
PA0365 11.22 Protein translocation Putative membrane-anchored or secreted protein involved in protein translocation
PA3819 8.8 Membrane integrity Putative exported protein (YPO1624); SlyB-like outer membrane lipoprotein, aka peptidoglycan-associated lipoprotein cross-reactive protein (PALs)
67,68
PA0586 8.18 Sporulation or Biofilm Putative member of sporulation stage V protein family 66
PA5212 7.21 Membrane-associated protein of unknown function or ribonucelotide reductase 2C alpha subunit-containing protein
PA3451 6.6 Uncharacterized protein
PA1542 6.04 Hydrolysis Putative metal-dependent hydrolase
PA0038 5.85 Metabolism Putative dodecin-like protein 69
PA1728 5.78 Gene regulation Putative regulator of ribonuclease activity; DNA/RNA helicase 2C SNF2 family protein
PA3284 5.33 Secreted protein of unknown function
PA5359 5.32 Biofilm Putative membrane-associated lipoprotein of unknown function; possibly related to biofilm formation
55
PA4575 5.21 Protein of unknown function
PA5106 4.92 Metabolism hutF; Deaminase (EC 3.5.4.-) or deiminase, possibly metal dependent; N-formimino-L-glutamate deaminase (EC 3.5.3.13); lysine carboxylase (EC 4.1.1.18)
70
PA2562 4.75 Secreted or membrane-associated protein of unknown function (DUF3315)
PA0276 4.69 Membrane-anchored protein of unknown function
PA4290 4.43 Chemotaxis / sensory transduction
Putative secreted methyl-accepting chemotaxis protein 71
PA3568 4.42 Carbon fixation Putative acetyl-CoA synthetase, propionyl-CoA synthetase/ligase (EC 6.2.1.17)
72,73,74,75
PA1333 4.06 Lipoprotein Secreted lipoprotein of unknown function
1029
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 57: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/57.jpg)
57
Figure Legends 1030
Figure 1. Visualization of microarray expression data as volcano plot. Up and down-regulated 1031
genes in Pseudomonas aeruginosa ATCC 33988 compared to the PAO1 strain. X axis is the 1032
Log2 of fold change and the experiment used 2-fold cut off criterion for the consideration of 1033
whether the individual gene was differentially expressed or not; Y axis is -10log10 p-value of the 1034
ANOVA p-values. The significant genes are identified by the ANOVA test (p value <0.05) and 1035
by the fold change cut-off (< -2 or > 2). These genes are located in the upper-left (down-1036
regulated genes) and upper-right (up-regulated genes) parts of the plot. 1037
Figure 2. Regulation of P. aeruginosa functional genetic classes in the ATCC 33988 strain 1038
compared to the PAO1. Functional classifications are according to the P. aeruginosa genome 1039
project (www.pseudomonas.com). Black and gray bars represent induced and repressed genes, 1040
respectively. Of 447 upregulated genes, 145 are function unknown hypothetical genes, which 1041
were not considered for the analyses. Similarly, 193 function unknown hypothetical genes from a 1042
total 528 down regulated genes were not considered for the analyses. 1043
Figure 3. Effect of efflux pump inhibitor (c-capped dipeptide) on P. aeruginosa ATCC 33988 1044
growth in fuels of different hydrocarbon composition. Bacteria were grown in M9 minimal 1045
media containing Jet A fuel (a), n-hexadecane (b) and n-dodecane (c) as sole carbon sources for 1046
growth in the presence of 0, 20, 40, and 80 µg/ml of Phe-Arg-naphthylamide (PAβN). 1047
Figure 4. RT-qPCR expression comparison of alkB1 and alkB2 genes in PAO1 and ATCC 33988 1048
cell lines when grown in Jet A fuel compared to glycerol as a carbon source. The table compares 1049
microarray and RT-qPCR expression results. 1050
Figure 5. Overexpression of alkB1 and alkB2 genes in P. aeruginosa PAO1. The alkB1 (a) and 1051
alkB2 (b) genes from ATCC 33988 and PAO1 strains with their respective native promoters 1052
were cloned and expressed in the PAO1 strain. The pHERD20T empty plasmid was 1053
transformed into wild-type PAO1 cells and used as the control strain. Ps: P. aeruginosa; Bacteria 1054
were grown in M9 minimal media containing Jet A fuel. 1055
Figure 6. Degradation of Jet A fuel hydrocarbons by P. aeruginosa cell lines overexpressing 1056
alkB1 and alkB2. Comparison of the degradation of 4 different jet fuel hydrocarbons: n-C12, n-1057
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 58: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/58.jpg)
58
C14, n-C16, and total isoparaffins. The samples were analyzed by GC-MS with dual flame 1058
ionization detection (FID) and mass spectrometry detection. 1059
Figure 7. Substrate specificity of P. aeruginosa ATCC 33988 and PAO1 strains for individual 1060
normal alkanes as sole carbon source. M9 minimal media was supplemented with n-C8, n-C10, n-1061
C12, n-C14, and n-C16 as carbon source and the growth measured using an spectrophotometer. 1062
Figure 8. Evaluating toxicity of n-C8 and n-C10 against P. aeruginosa strains. P. aeruginosa 1063
PAO1 and ATCC 33988 were grown in n-C8 and n-C10 in the presence of 0.2% glycerol as a 1064
source of simple carbon, and the growth compared against cells in 0.2% glycerol. 1065
Figure 9 Characterization of alkB1 and alkB2 promoter strength in different Pseudomonas 1066
aeruginosa strains. The alkB2 promoter from ATCC 33988 was fused to green fluorescent 1067
protein (gfp) gene and transformed into ATCC 33988 and PAO1 strains. (a) Fluorescence image 1068
of GFP expression from the alkB2 promoter after 9 days growing in the presence of alkanes (b) 1069
Bright-field image and (c) Fluorescence image of GFP expression from alkB2 promoter after 9 1070
days in 0.2% glycerol. No fluorescence was observed in 0.2% glycerol. (d) Green fluorescent 1071
protein (GFP) expression in the ATCC 33988 strain driven by the alkB1 and alkB2 promoters 1072
from ATCC 33988 and PAO1. (e) GFP expression in the PAO1 strain driven by the alkB1 and 1073
alkB2 promoters from ATCC 33988 and PAO1. To estimate GFP expression, cells were excited 1074
at 488nm and the GFP emission peak (509 nm) was measured using a fluorometer. The GFP 1075
expression of the cells was normalized to the cells density (OD600). Background expression of 1076
the empty vector (control) was subtracted from Relative Fluorescence Units (RFUs). Cells were 1077
observed using a 100X oil immersion objective under the bright-field and green fluorescence 1078
emission at 505-530 nm. 1079
Figure 10. Promoter analyses of PA5359 genes from the PAO1 and ATCC 33988 strain. Note 1080
the substitution of a Guanine for an Alanine at -10 box. The promoter analyses were performed 1081
using bacterial sigma 70 promoter prediction program (BPROM: 1082
http://linux1.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb). The 1083
analyses revealed that the ATG site 72 bases downstream of the -10 sequence is the likely gene 1084
start codon not the ATG within the -10 box predicted by the Pseudomonas Genome Database 1085
http://www.pseudomonas.com. 1086
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
![Page 59: Downloaded from //aem.asm.org/content/aem/early/2017/03/14/AEM.03249-16.fu… · óð 5xe$ dqg )$' ghshqghqw 1$' 3 + uxeuhgr[lq uhgxfwdvhv wkh pel dqg alg jhqhv iru óñ ELRILOPIRUPDWLRQ](https://reader033.vdocuments.us/reader033/viewer/2022042313/5edd5291ad6a402d66685f2f/html5/thumbnails/59.jpg)
59
Figure 11 (a). Effect of overexpression of unknown genes on growth and adaptation. 1087
Overexpression of PA5359 in PAO1 cells. ● Wild-type P. aeruginosa PAO1; ▼Wild-type P. 1088
aeruginosa ATCC 33988; ▲ P. aeruginosa PAO1 with pDERD20T+PA5359 from ATCC 1089
33988; ▄ P. aeruginosa PAO1 with pDERD20T+PA5359 from PAO1. 1090
(b) Overexpression of PA3521-3523 in P. aeruginosa ATCC 33988 and PAO1 cells. ▼ Wild-1091
type P. aeruginosa PAO1; ▄ Wild-type P. aeruginosa ATCC 33988; ▲ P. aeruginosa PAO1+ 1092
pDERD20T with PA3521-3523 from ATCC 33988; ● P. aeruginosa ATCC 33988 + 1093
pDERD20T::PA3521-3523 from ATCC 33988. 1094
on June 7, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from