![Page 1: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/1.jpg)
The Whole Genome Sequencing Revolution
Martin WiedmannGellert Family Professor of Food Safety
Department of Food ScienceCornell University, Ithaca, NYE-mail: [email protected]
Phone: 607-254-2838
![Page 2: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/2.jpg)
Outline• Subtyping for disease surveillance: from PFGE to WGS• WGS challenges: when are two isolates the same or
different? Can we find identical isolates in different locations?
• Looking in the future
![Page 3: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/3.jpg)
PulseNetPulseNet
USAUSA
PulseNet PulseNet EuropeEurope
PulseNet PulseNet Asia Asia PacificPacific
PulseNetPulseNetLatin America Latin America & Caribbean& Caribbean
PulseNetPulseNetMiddle EastMiddle East
PulseNet CanadaPulseNet Canada
PulseNetPulseNet
USAUSA
PulseNet PulseNet EuropeEurope
PulseNet PulseNet Asia Asia PacificPacific
PulseNetPulseNetLatin America Latin America & Caribbean& Caribbean
PulseNetPulseNetMiddle EastMiddle East
PulseNet CanadaPulseNet Canada
PulseNet allows international outbreak
detection and traceback – a hypothetical example
Food isolate, deposited into PulseNet
Human case
Human case
![Page 4: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/4.jpg)
![Page 5: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/5.jpg)
Whole Genome Sequencing• It all started with the human genome project• Sequencing of a bacterial genome is now
feasible at costs of <$100/isolate• Costs will continue to drop
• Commonly used platforms include• Roche 454• Illumina HiSeq/MiSeq• Applied Biosystems SOLiD Systems• Life Technologies/Thermofisher Ion
Torrent; • PacBio RS• Nanopore based systems (e.g., Oxford
Nanopore MinION)
![Page 6: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/6.jpg)
The genome sequence revolution
![Page 7: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/7.jpg)
DNA sequencing-based subtyping
Isolate 1 AACATGCAGACTGACGATTCGACGTAGGCTAGACGTTGACTGIsolate 2 AACATGCAGACTGACGATTCGTCGTAGGCTAGACGTTGACTGIsolate 3 AACATGCAGACTGACGATTCGACGTAGGCTAGACGTTGACTGIsolate 4 AACATGCATACTGACGATTCGTCGAAGGCTAGACGTTGACTG
SNP: single nucleotide polymorphism
1
3
2
4
![Page 8: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/8.jpg)
Challenges with use of PFGE as a subtyping method in outbreak
investigations • Two isolates may show the same PFGE type even
though they are genetically distinct• PFGE only interrogates small part of the genome
• Two isolates may show “slightly” (?? - the “3-band rule”) different PFGE patterns despite sharing a very recent common ancestor• Could be due to lateral genes transfer, loss of
plasmid, rearrangements, point mutations etc.
![Page 9: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/9.jpg)
Xbal SpeI
L
Den Bakker et al. 2011. AEM.
Includes isolates form Salmonella outbreak linked to sausages (Rhode Island) and isolates from pistachios
![Page 10: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/10.jpg)
Tip-dated maximum clade credibility tree based on SNP data for 47 Montevideo isolates
![Page 11: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/11.jpg)
MLVA type frequency BGBQFJWIDAIBNACEAGVABAFBDAD
98 MLVA types
• Salmonella Enteritidis is most common cause of human salmonellosis – poorly resolved by current subtyping technologies.
PFGE type frequency 4342215819692562332788231899879199184
52 PFGE types
MLVA-PFGE type frequencyB4B34G4B21BQ8I5W4J4D4BN692AI19AC2F2V4AG56J21AB2AF4
163 combined MLVA-PFGE types
![Page 12: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/12.jpg)
![Page 13: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/13.jpg)
Full genome sequencing identified the following differences between these isolates:(i) 28 single nucleotide polymorphisms
(SNPs) and (ii) three indels, including a 33 kbp
prophage that accounted for the observed difference in AscI PFGE patterns.
Both isolates were found to harbor a 50 kbp putative mobile genomic island encoding translocation and efflux functions that has not been observed in other Listeria genomes.
Gilmour et al. BMC Genomics 2010, 11:120
![Page 14: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/14.jpg)
![Page 15: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/15.jpg)
In addition, whole genome sequencing showed that 5 Listeria isolates collected in 2010 from the same facility were also closely related genetically to isolates from ill people.
![Page 16: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/16.jpg)
Listeria Outbreaks and Incidence, 1983-2014
1983
1984
1985
1986
1987
1988
1989
1990
1991
1992
1993
1994
1995
1996
1997
1998
1999
2000
2001
2002
2003
2004
2005
2006
2007
2008
2009
2010
2011
2012
2013
2014
0
1
2
3
4
5
6
7
8
0
1
2
3
4
5
6
7
8
9Total Out-breaksIncidence
Pre-PulseNet
0.369
Early PulseNet
2.311
Listeria Initiative
2.95.5
No. outbreaksIncidence (per million pop)
EraOutbreaks per
yearMedian cases per
outbreak
WGS8
4.5
Data are preliminary and subject to change
![Page 17: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/17.jpg)
March 2015: Listeriosis cases linked to Blue Bell ice cream
![Page 18: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/18.jpg)
Outline• Subtyping for disease surveillance: from PFGE to WGS• WGS challenges: when are two isolates the same or
different? Can we find identical isolates in different locations?
• Looking in the future
![Page 19: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/19.jpg)
The challenge
• Identical bacteria (100% match over the whole genome) can be found in different places that can be potential sources of foodborne disease outbreaks
![Page 20: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/20.jpg)
The theoretical background• Bacteria divide asexually: Bacterial populations can be seen as large
populations of “identical twins”• Mutation rate during replication is low: extremes of the suggested
mutation rates range from 2.25 × 10-11 to 4.50 × 10-10 per bp per generation– With a genome size of around 5 Million bp per bacterial genome (5 × 106) between
approx. 450 and 9,000 generations are needed for a single SNP difference– Eyre et al. estimated evolutionary rate of 0.74 SNVs per successfully sequenced
genome per year for C. difficile (N. Engl. J. Med. 2013)• “Whole-genome sequencing … identified 13% of cases that were genetically
related (≤2 SNVs) but without any evidence of plausible previous contact through a hospital, residential area, or family doctor.”
– Unknown bacterial generation time in different environments complicates interpretation
![Page 21: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/21.jpg)
2000 US outbreak - Environmental persistence of L. monocytogenes
• 1988: one human listeriosis case linked to hot dogs produced by plant X• 2000: 29 human listeriosis cases linked to sliced turkey meats from plant X
![Page 22: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/22.jpg)
Real world observations
![Page 23: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/23.jpg)
![Page 24: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/24.jpg)
Real world observations
In one case, isolates with < 3 SNP differences were found in retail delis in there different states
![Page 25: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/25.jpg)
Conclusions• Even with WGS, epidemiological data are still essential• Number of SNP differences/allele differences that is meaningful
differs by organism, strain, outbreak/cluster, and growth environment– Number of bacterial generations per calendar year can differ
hugely (think dry environment versus active infection in an animal population)
• Best way to determine “meaningful” SNP differences is through combination of phylogenetic and epidemiological data
![Page 26: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/26.jpg)
Looking in the future• WGS will get cheaper and will be used more
– STEC next, probably Salmonella Enteritidis after that– Detection of more clusters and outbreaks
• WGS database will grow rapidly with inclusion of environmental isolates– More outbreak will be linked to source by using WGS matches
between food or environmental isolates and human isolates as stating point
• More broad application of WGS by private labs, maybe customers and consumers?
![Page 27: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/27.jpg)
![Page 28: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/28.jpg)
Conclusions• WGS is a game changer and will significantly improve
detection of outbreaks, adulteration, etc.– False alarms will occur though
• Pathogen detection in environments, by regulatory agencies, will lead to inclusion of WGS data in CDC/FDA/USDA databases (GenomeTrakr)– Environmental pathogen monitoring by industry will
become even more important
![Page 29: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/29.jpg)
![Page 30: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/30.jpg)
30
![Page 31: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/31.jpg)
Analysis of genome wide SNPs (wgSNPs)• Identifies all high confidence SNPs over whole
genome (approx. 3 to 5 million nucleotides)
![Page 32: The Whole Genome Sequencing Revolution Martin Wiedmann Gellert Family Professor of Food Safety Department of Food Science Cornell University, Ithaca, NY](https://reader036.vdocuments.us/reader036/viewer/2022062322/5697bfa71a28abf838c98c54/html5/thumbnails/32.jpg)
Whole genome multilocus sequence typing (MLST)
• Allows for simpler analysis and clear naming of subtypes
• Performs comparison on a gene by gene levelIsolate A Isolate B Isolate C
Gene 1 1 1 1
Gene 2 8 8 12
Gene 3 5 5 2
Etc.
Gene 1,005 4 4 4
wgMLST type A A B