Download - DNA Transcription and Translation
![Page 1: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/1.jpg)
DNA Transcription
and TranslationSections 12.3 and 12.4
![Page 2: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/2.jpg)
Do Now 1. What is RNA?
2. What are proteins used for in our bodies?
3. Fill in the chart below:
DNA RNA
Structure
Sugar
Base
Example strand: Complimentary:
TACGA TACGA
![Page 3: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/3.jpg)
Gene
Segment of DNA that codes for a protein
The Central Dogma of Biology: DNA codes for RNA and RNA
makes protein (the synthesis of)
![Page 4: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/4.jpg)
One Gene – One Enzyme
The Beadle and Tatum experiment showed that one gene codes for one enzyme.
One gene codes for one polypeptide. polypeptide - a chain of covalently
bonded amino acids. (proteins are made of one or more
polypeptide)
![Page 5: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/5.jpg)
![Page 6: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/6.jpg)
Let’s make some observations about RNA’s structure
![Page 7: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/7.jpg)
RNA
RNA stands for:Ribonucleic acid
RNA is found:Nucleus and Cytoplasm
![Page 8: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/8.jpg)
RNA Structure
Like DNA, RNA is made up of subunits called _____________, which are made of three parts: Sugar (ribose) Phosphate Nitrogen Base
![Page 9: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/9.jpg)
RNA’s Nitrogen Bases
Adenine (A) Cytosine (C) Guanine (G) Uracil (U)
![Page 10: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/10.jpg)
There are 3 types of RNA: Messenger RNA (mRNA) – long
strands of RNA nucleotides that are formed complementary to one strand of DNA.
Transfer RNA (tRNA) – smaller segments of RNA nucleotides that transport amino acids to the ribosomes.
Ribosomal RNA (rRNA) – associates with protein to form the ribosome.
![Page 11: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/11.jpg)
All RNA is …
Single stranded Many different shapes “Cheap copy” of DNA
![Page 12: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/12.jpg)
![Page 13: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/13.jpg)
Do Now
1. What is a protein made of?
2. Explain the process between DNA and proteins.
![Page 14: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/14.jpg)
Transcription
First step in making proteins
Process of taking one gene (DNA) and converting into a mRNA strand
DNA -> RNA
Location:
Nucleus of the cell
![Page 15: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/15.jpg)
![Page 16: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/16.jpg)
Steps to Transcription
1. An enzyme attaches to the promoter (start signal region) of a gene and unwinds the DNA
![Page 17: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/17.jpg)
Steps to Transcription (Cont.)
2. One strand acts as a template.
![Page 18: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/18.jpg)
Steps to Transcription (Cont.)
3. A mRNA copy is made from the DNA template strand by RNA polymerase
4. A mRNA copy is made until it reaches the termination (stop signal) sequence
5. The two strands of DNA rejoin.
![Page 19: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/19.jpg)
Template vs. Non Template Strand
![Page 20: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/20.jpg)
![Page 21: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/21.jpg)
![Page 22: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/22.jpg)
Transcription animation
https://www.youtube.com/watch?v=ztPkv7wc3yU
![Page 23: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/23.jpg)
Transcribe this DNA to mRNA
![Page 24: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/24.jpg)
![Page 25: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/25.jpg)
mRNA Processing
Pre-mRNA – the original sequence of RNA created during transcription
mRNA reaches the ribosomes
![Page 26: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/26.jpg)
RNA Processing
![Page 27: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/27.jpg)
What is RNA Processing?
After transcription the pre-mRNA molecule undergoes processing
5’ cap is added
Poly A tail is added to the 3’ end
Introns are removed.
![Page 28: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/28.jpg)
Do Now
Label the Transcription diagram
![Page 29: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/29.jpg)
RNA Processing
In Eukaryotes only
Introns- non-coded sections
Exons- codes for a protein
Before RNA leaves the nucleus, introns are removed and exons are spliced together
A cap and poly A tail are added to ends of the sequence
mRNA leaves the nucleus through the nuclear pores
![Page 30: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/30.jpg)
Why is it necessary to add the poly A tail and 5’ cap?
![Page 31: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/31.jpg)
Let’s try an activity (11.5)
http://www2.pearsonsuccessnet.com/snpapp/iText/products/0-13-115075-8/index.html
![Page 32: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/32.jpg)
![Page 33: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/33.jpg)
Pg. 339
Pg. 339
![Page 34: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/34.jpg)
Let’s an example…
Original DNA Sequence (DNA):
5’ GTACTACATGCTATGCAT 3’
Translate it (RNA):
3’ CAUGAUGUACGAUACGUA 5’
Add the 5’ cap:
3’ CAUGAUGUACGAUACGUA 5’ cap
![Page 35: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/35.jpg)
Finish the job!
Remove the introns “UGUA” and “AUAC”:
3’ CAUGAUGUACGAUACGUA 5’ cap
3’ CAUGACGGUA 5’ cap
Add a poly A tail onto the 3’ end
3’ CAUGACGGUA 5’ capPoly A tail
![Page 36: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/36.jpg)
Get a new partner!
DNA Strand of non-template strand:
5’ ATCGGTAGAGTATTTACAGATA 3’
Remove introns:
CGGUA UUACAG
![Page 37: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/37.jpg)
Think, Pair, Share
Take a minute think on your own, then pair with your partner, and share your ideas!
Evolutionary, why do you think there are introns?
Where did they come from?
Why do we have them?
Remember there is NO wrong answer!
![Page 38: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/38.jpg)
PROTEINS!
![Page 39: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/39.jpg)
Proteins are made up of amino acids!!!
Proteins are polymers of amino acids
Only 20 different amino acids
BUT there are hundreds of thousands of different proteins
How can this be?
![Page 40: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/40.jpg)
Let’s compare to it to the English language
How many letters are in the alphabet?
A,b,c,d,…26 How many words are there?Miss, Ings, is, smart, .. Almost infinite! Each word has a unique structure of
letters.
Similar to proteins and amino acids
![Page 41: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/41.jpg)
Proteins- (PCFNa)
-made of 20 different Amino Acids
- Amino Acids bond to form polypeptide chains
![Page 42: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/42.jpg)
How do amino acids form these peptide chains?
Peptide Bonds – Link each amino acids together to form proteins
![Page 43: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/43.jpg)
How many amino acids are in a dipeptide chain?
How about a tripeptide chain?
How many water molecules are formed from 2 amino acids?
How many water molecules are formed from 100 amino acids?
![Page 44: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/44.jpg)
Do Now
Perform transcription on this DNA segment: GCTTCATACGA
Do RNA processing and remove the introns: GAA and UGC
How does this mRNA sequence leave the nucleus?
Where does it go?
![Page 45: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/45.jpg)
Protein
Structure
http://www3.interscience.wiley.com:8100/legacy/college/boyer/0471661791/structure/HbMb/hbmb.htm
![Page 46: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/46.jpg)
![Page 47: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/47.jpg)
Translation
Production of proteins from mRNA
mRNA goes to the ribosomes in the cytoplasm or the RER and produces proteins
![Page 48: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/48.jpg)
![Page 49: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/49.jpg)
Steps to Translation
1. mRNA leaves the nucleus and binds to a ribosome
2. the 5’ end of mRNA binds to ribosome
![Page 50: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/50.jpg)
Ribosome
Two subunits to the ribosome
3 grooves on the ribosome (A, P, E)
A: tRNA binding site
P: polypeptite bonding site
E: exit site
![Page 51: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/51.jpg)
Steps to Translation (Cont.)
3. Ribosome looks for the start Codon (AUG)
Codon: group of 3 nucleotides on the messenger RNA that specifies one amino acid (64 different codons)
![Page 52: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/52.jpg)
![Page 53: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/53.jpg)
Steps to Translation (Cont.) 4. Amino acids attached to a tRNA molecule and are brought
over to the mRNA.
5. This tRNA has an anticodon that matches the codon on the mRNA strand
Anticodon:
Group of 3 unpaired nucleotides on a tRNA strand. (binds to mRNA codon)
![Page 54: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/54.jpg)
tRNA
![Page 55: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/55.jpg)
Think-Pair-Share
The mRNA sequence reads the following codons: What amino acids do they stand for?
AUG
GGA
GAG
CAA
** What amino acid does the anticodon CGU stand for?***
![Page 56: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/56.jpg)
Steps to Translation (Cont.)
6. tRNA binds to the mRNA sequence and adds an amino acid
7. Each amino acid matches up with 1-6 tRNA molecules
8. tRNA leaves and amino acids bond together through a polypeptide bond
![Page 57: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/57.jpg)
Think – Pair - Share
Find the amino acid sequence for the following mRNA sequence (translation)
AUGCGACGAAUUUAA
![Page 58: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/58.jpg)
![Page 59: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/59.jpg)
Translation Animations
http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a3.html
http://www.stolaf.edu/people/giannini/flashanimat/molgenetics/translation.swf
![Page 60: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/60.jpg)
Steps to Translation (Cont.)
9. The mRNA sequence continues until a stop codon is reached.
10. The amino acids disconnect from the mRNA sequence and a protein is formed.
![Page 61: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/61.jpg)
![Page 62: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/62.jpg)
Think-Pair-Share
Get with a partner, one partner transcribes and the other translates.
![Page 63: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/63.jpg)
Do Now
Do transcription on this DNA sequence:
CGTACGCTCCCTAGACTA
Do Translation- Remember to start the right place!
![Page 64: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/64.jpg)
Do Now
Do transcription on this DNA sequence:
TTTTATACTGAGGGTTAACTCGT
Do Translation- Remember to start the right place!
![Page 65: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/65.jpg)
![Page 66: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/66.jpg)
![Page 67: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/67.jpg)
1. 2. 3.
![Page 68: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/68.jpg)
4. 5. 6.
![Page 69: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/69.jpg)
1. Initiation
The two ribosomal subunits come together with the mRNA and the first tRNA molecule which attaches to the start codon (AUG).
This is the only tRNA that will attach to the P site. The first amino acid is always methionine.
![Page 70: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/70.jpg)
2. Codon Recognition
The tRNA anticodon will hydrogen bind to the mRNA codon in the A site.
![Page 71: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/71.jpg)
3. Bond Formation
The amino acid in the P site will form a peptide bond with the amino acid in the A site.
![Page 72: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/72.jpg)
4. Translocation
The tRNA's and the mRNA move down one site. The empty tRNA is released from the exit site.
![Page 73: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/73.jpg)
5. Repeat
This process will repeat hundreds of times.
![Page 74: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/74.jpg)
6. Termination
Translation is terminated with the stop codon is reached. There are three different stop codons UGA, UAA, UAG.
The release factor recognizes the stop codon and releases the polypeptide strand. All the factors break apart and are reused.
![Page 75: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/75.jpg)
![Page 76: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/76.jpg)
Do Now
Take the following amino acid sequence, do reverse transcription and translation (find RNA and DNA).
Methionine, Arginine, Alanine, Serine, Tryptophan, Tyrosine, Leucine, Valine, stop
What do you notice about your DNA sequences?
![Page 77: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/77.jpg)
Do Now
Template strand of DNA:
5’ TTACGGCTAGGAGTAGCCGAATTCTG 3’
Remove the introns: CUCAUC
Determine protein sequence
![Page 78: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/78.jpg)
Do Now
![Page 79: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/79.jpg)
![Page 80: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/80.jpg)
How do cells know what protein to make when?
Gene Regulation: ability of an organism to control which genes are transcribed.
![Page 81: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/81.jpg)
Controlling Transcription
Transcription factors ensure that a gene is used at the right time and that protein are made in the right amounts
The complex structure of eukaryotic DNA also regulate transcription.
![Page 82: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/82.jpg)
HOX Genes
Everyone develops from a zygote
Zygote undergoes mitosis
Cell differentiation: cells become specialized
Certain gene sequences determine cell differentiation
![Page 83: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/83.jpg)
HOX Genes
Homeobox Genes (Hox Genes) are sequences of DNA
Hox genes are responsible for the general body pattern of most animals.
![Page 84: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/84.jpg)
HOX Genes
Are transcribed at specific times, and located in specific places on the genome
Mutations:
![Page 85: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/85.jpg)
Telephone
We are going to play the game telephone.
Every time a DNA makes a copy (spreading of a message), mutations can happen (mistakes in a message)
![Page 86: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/86.jpg)
Mistakes in DNA
Cell make mistakes in replication, and transcription
Most often these mistakes are fixed
EX.
![Page 87: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/87.jpg)
Mutations
A permanent change that occurs in a cell’s DNA is called a mutation.
Three types of mutations:
Point mutation
Insertion
Deletion
![Page 88: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/88.jpg)
Point Mutation
Substitution: A change in just one base pair
Missense Mutation: amino acid is change
Nonsense Mutation: amino acid is changed to a stop codon
![Page 89: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/89.jpg)
Frameshift Mutations
Causes the reading frame to shift to the left or the right
Insertion: Addition of a nucleotide
Deletion: Removal of a nucleotide
![Page 90: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/90.jpg)
![Page 91: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/91.jpg)
ACGAAATACAGACAT
Decide what type of mutation occurred:
ACGAAATAGAGACAT
ACAAATACAGACAT
ACGAAATACAGGACAT
![Page 92: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/92.jpg)
![Page 93: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/93.jpg)
Causes of Mutations
Mutations can happen spontaneously Mutagens: Certain chemicals or radiation that
can cause DNA damage Causes bases to mispair and bond with the wrong
base High-energy forms of radiation, such as X rays
and gamma rays, are highly mutagenic.
![Page 94: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/94.jpg)
Sex Cell vs. Somatic Cell Mutations
Somatic cell mutations are not passed on to the next generation.
Mutations that occur in sex cells are passed on to the organism’s offspring and will be present in every cell of the offspring
![Page 95: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/95.jpg)
![Page 96: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/96.jpg)
![Page 97: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/97.jpg)
Chromosomal Mutations
Piece of chromosome can be broken off, duplicated, or moved to another chromosome
![Page 98: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/98.jpg)
Fragile X Syndrome
Repeat of CGG about 30 times
Causes mental and behavior impairments
![Page 99: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/99.jpg)
![Page 100: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/100.jpg)
Protein Folding and Stability
Substitutions also can lead to genetic disorders.
Ex. Sickle Cell Anemia (caused by a substitution mutation)
Can change both the folding and stability of the protein
![Page 101: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/101.jpg)
Sickle Cell Anemia
![Page 102: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/102.jpg)
Causes of Mutations
Mutations can happen spontaneously Mutagens: Certain chemicals or radiation that
can cause DNA damage Causes bases to mispair and bond with the wrong
base High-energy forms of radiation, such as X rays
and gamma rays, are highly mutagenic.
![Page 103: DNA Transcription and Translation](https://reader036.vdocuments.us/reader036/viewer/2022081421/56815123550346895dbf40d1/html5/thumbnails/103.jpg)
Sex Cell vs. Somatic Cell Mutations
Somatic cell mutations are not passed on to the next generation.
Mutations that occur in sex cells are passed on to the organism’s offspring and will be present in every cell of the offspring