BRIEF REPORT
Detection and characterization of porcine bocavirusin the United States
Jinhai Huang • Sunil K. Mor • Jonathan Erber •
Elyce Voss • Sagar M. Goyal
Received: 17 September 2013 / Accepted: 29 December 2013
� Springer-Verlag Wien 2014
Abstract We screened pigs (n = 203) presenting with
respiratory illness or diarrhea for porcine bocavirus (PBoV);
88 (43.30 %) were positive by PCR. More positives were
seen in diarrhea cases (48.7 %) than in respiratory cases
(29.1 %). Based on phylogenetic analysis of 540 nucleotides
of the NS1 gene, the viruses could be divided into four
possible groups. Group IV sequences did not match any
GenBank sequences, while groups I, II and III gave matches
with PBoV3, PBoV4 and PBoV5, respectively. The wide
range (70 % to 100 %) of nucleotide (nt) sequence identity
among strains in this study indicates high genetic diversity
among porcine bocaviruses.
Keywords Porcine bocavirus � Diarrhea � Phylogenetic
analysis
The genus Bocavirus, family Parvoviridae, subfamily
Parvovirinae, includes five members: bovine parvovirus
(BPV), canine minute virus (CnMV), human bocavirus
(HBoV), gorilla bocavirus (GBoV), and California sea lion
virus (CslBoV) [4, 7]. These non-enveloped viruses have a
diameter of 26 nm and contain a linear, single-stranded
DNA genome of 5-6 kb of either plus or minus polarity.
There are three open reading frames (ORFs) encoding two
nonstructural proteins (NS1 and NP1) and two structural
proteins (viral capsid proteins VP1 and VP2) [4].
Using random amplification and large-scale sequencing
technology, porcine bocaviruses (PBoV) were discovered
in Swedish pigs with post-weaning multisystemic wasting
syndrome (PMWS) [1]. Since then, a number of different
PBoVs have been discovered and characterized in Asia,
Europe and the U.S.A. The virus was detected in China in
2010 [12], and its complete genome was sequenced [12,
14]. In the following years, highly divergent PBoVs were
discovered. Cheng et al. [2] described the presence of
PoBoV1 and PBoV2 in China. Two other bocaviruses,
PoBoV3 and PoBoV4, were described in Hong Kong [5].
Recently, PBoV5 from pigs in China was described [6].
Using high-throughput sequencing, Shan et al. [11] iden-
tified bocaviruses in healthy (19-30 days) and diarrheic
piglets (24-30 days) on a high-density farm (1000 sows) in
North Carolina, USA. The present study was undertaken to
determine the presence of bocaviruses samples from pigs
submitted to the Minnesota Veterinary Diagnostic Labo-
ratory (MVDL) for detecting the cause of diarrhea and
respiratory problems.
The samples were submitted to MVDL between
October 2010 and February 2011. A total of 203 samples
were examined: 55 were lung samples of pigs from
seven different states, and 148 were fecal samples from
18 states and Mexico and Canada (Table 1). At the
MVDL, these samples were examined for the presence of
rotavirus, transmissible gastroenteritis virus (TGEV),
porcine circovirus type-2b (PCV2b), porcine respiratory
and reproductive syndrome virus (PRRSV), and hemag-
glutinating encephalomyelitis virus (HEV) [9, 10]. In
addition, we tested 10 fecal samples each from healthy
piglets and healthy gilts from two different Minnesota
farms.
J. Huang � S. K. Mor � J. Erber � E. Voss � S. M. Goyal (&)
Department of Veterinary Population Medicine and Minnesota
Veterinary Diagnostic Laboratory, University of Minnesota,
1333 Gortner Ave, St. Paul, MN 55108, USA
e-mail: [email protected]
J. Huang
Tianjin University, No. 92 Weijin road, Nankai District,
Tianjin 300072, China
123
Arch Virol
DOI 10.1007/s00705-013-1972-4
DNA was extracted from all samples using a DNeasy
Blood and Tissue Kit (QIAGEN, Valencia, CA). Extracted
DNA was subjected to PCR using self-designed specific
primers for partial amplification of the NS gene: BoV-
NS1F (50 ACAGGCAGCCGATCACTCACTAT 30) and
BoV-NS1R (50 CTCGTTCCTCCCATCAGACACTT-30).A HotStar Taq Master Mix Kit (QIAGEN, Valencia, CA)
was used for PCR, and the reaction mixture consisted of
12.5 ll of master mix, 0.6 lM primer, 100 ng of template,
and nuclease-free water to make a total volume of 25 ll.
The amplification reaction consisted of initial denaturation
at 94 �C for 15 min, 35 cycles of denaturation at 94 �C for
30 s, annealing at 52 �C for 30 s, and extension at 72 �C
for 45 s, and final extension at 72 �C for 10 min. PCR
products were separated by electrophoresis on a 1.2 %
agarose gel, and the presence of a band at the position
corresponding to 780 bp confirmed the presence of PBoV.
PCR products from a representative set of samples
(n = 38) were purified by treating the amplified PCR
products with ExoSAP-IT (USB). PCR product (5 ll) was
mixed with 2 ll of ExoSAP-IT, incubated at 37 �C for
30 min, followed by inactivation of ExoSAP-IT at 80 �C
for 10 min. Purified products were submitted for
sequencing to the University of Minnesota Genomics
Center (UMGC). Forward and reverse sequences were
aligned together using Sequencher 5.1 software (www.
genecodes.com) followed by BLAST analysis (www.ncbi.
nlm.nih.gov). The nucleotide sequences thus obtained were
then aligned by the Clustal W method using MEGA 5.0
software. A phylogenetic tree of aligned sequences was
constructed by the neighbor-joining and maximum-likeli-
hood methods with the Kimura 2-parameter model using
1000 bootstrap replicate values.
Of the 203 samples tested, 88 (43.3%) were positive for
PBoV by PCR (Table 1). The virus was detected at a
higher rate from feces (48.6 %) than from lungs (29.1 %).
In respiratory cases, bocavirus was always present as a
mixed infection with other viruses, e.g., rotavirus (18.7 %),
HEV (12.5 %), and PRRSV (12.5 %). In 56.3 % of posi-
tive lungs, bocavirus was present as a mixed infection with
more than two viruses (Table 2). In cases of diarrhea, 57 %
of bocavirus-positive samples had mixed infections with
PCV, porcine astrovirus, or porcine rotavirus. Seven of ten
and six of ten samples were positive from healthy piglets
and gilts, respectively.
A representative number of samples (n = 38) were
purified for sequencing; two were lung samples and 31 were
intestinal contents from cases of illness. The remaining five
samples were from healthy pigs. BLAST analysis of
sequences confirmed them to be PBoV. All sequences have
been submitted to GenBank under accession numbers
KC514531-KC514561. The GenBank accession numbers
for sequences from lung as well as sequences from healthy
piglets and gilts are KF278661-KF278667.
We compared bocavirus sequences of this study with
published sequences of other bocaviruses. Phylogenetic
Table 1 Source of samples tested for porcine bocavirus
Sample
no.
State or
country
No. positive/no. tested from
the indicated samples
Total
positive/
total testedLung Feces
1 Arizona 0/1 0/1 0/2
2 Arkansas 2/4 3/8 5/13
3 Colorado 0/0 3/10 3/10
4 Illinois 2/4 7/8 9/12
5 Iowa 1/2 5/6 6/8
6 Kansas 0/0 0/1 0/1
7 Minnesota 9/41 21/42 30/83
8 Missouri 0/0 3/7 3/7
9 Michigan 0/0 0/1 0/1
10 Nebraska 0/0 4/5 4/5
11 North
Carolina
0/0 3/5 3/5
12 Ohio 0/0 0/1 0/1
13 Oklahoma 1/2 3/20 4/22
14 Pennsylvania 0/0 1/1 1/1
15 South
Dakota
0/0 2/2 2/2
16 Tennessee 1/1 5/6 6/7
17 Virginia 0/0 0/1 0/1
18 Wisconsin 0/0 0/1 0/1
19 Canada 0/0 4/9 4/9
20 Mexico 0/0 8/13 8/13
Total 16/55
(29.1 %)
72/148
(48.6 %)
88/203
Table 2 Occurrence of porcine bocavirus with other viruses
Virus No. (%)
positive in
lungs
No. (%)
positive in
feces
Porcine bocavirus alone 0 4 (5.5)
Porcine bocavirus ? porcine astrovirus 0 7 (9.7)
Porcine bocavirus ? porcine circovirus 0 5 (7.0)
Porcine bocavirus ? enteric viruses* 0 41 (57.0)
Porcine bocavirus ? rotavirus 3 (18.8) 15 (20.8)
Porcine bocavirus ? hemagglutinating
encephalomyelitis virus
2 (12.5) 0
Porcine bocavirus ? PRRSV 2 (12.5) 0
Porcine bocavirus ? respiratory viruses** 9 (56.3) 0
* Two or more enteric viruses (astro-, rota, HEV, PCV, TGE) were
present in association with porcine bocavirus
** Two or more respiratory viruses (HEV, SIV, PCV, rota-, PRRSV)
were present in association with porcine bocavirus
J. Huang et al.
123
analysis was based on 540 nucleotides (position 753-1257
of the reference sequence JF713715) of the NS1 gene. The
tree topology was the same in both neighbor-joining and
maximum-likelihood analysis. Based on sequence align-
ment and phylogenic tree, all sequences were divided into
four possible groups (groups I, II, III and IV). Group I
included 18 sequences (15 intestinal, 2 lung and 1 healthy
gilt), which had 90 % to 96 % nt sequence identity to
published PBoV3 sequences from China (JX944666,
NC_016031) and the USA (JF713715). Group II included
two sequences (one intestinal and one healthy piglet) that
gave a match with PBoV 4 (JF512473). Group III had four
sequences (three intestinal and one healthy piglet), which
gave match with PBoV5 (JN621325, NC_016647) (Fig. 1).
Group IV had 14 sequences (12 intestinal and one each
from healthy gilt and piglet) that did not match any ref-
erence GenBank sequences.
Group I sequences had 89 % to 100 % nt sequence
identity to each other but only 76.4-80 %, 77 %-79.5 %
and 75-80 % nt sequence identity with groups II, III, and
Fig. 1 Phylogenetic analysis
based on 540 nucleotides (from
nucleotide position 753 to 1257
of reference sequence
JF713715) of the NS1 gene of
bocavirus. The phylogenetic
tree was constructed by the
neighbor-joining method with
the Kimura 2-parameter model
and 1000 bootstrap replicates
Bocavirus in swine
123
IV, respectively. Group II sequences had 91.7 % to 95 %
nt sequence identity within the group and 79 % to 82 % nt
sequence identity with group III sequences. Group III
sequences had 92 % to 96 % nt sequence identity within
the group. Group IV sequences had 87 % to 95.6 % nt
sequence identity within the group while 71 % to 77 % and
72 % to 88 % nt sequence identity with group II and group
III, respectively. Comparison between healthy and affected
cases showed no distinction between the two, indicating
that they are closely related.
Based on the existing criteria for bocavirus classification
by the International Committee on Taxonomy of Viruses
(http://www.ictvdb.org), isolates belong to separate species
if they have\95 % identity in the nonstructural gene DNA
sequence [4]. In this study, all sequences had 90 % to
100 % nt sequence identity within their respective group,
but because only partial sequences were determined, the
existing criteria could not be applied here. The group IV
sequences did not align with existing GenBank sequences
of bocavirus and had limited identity (71 % to 88 %) to
other sequences in this study. Complete genome sequenc-
ing of these strains should yield a clearer picture of these
bocaviruses.
One of the important findings of this study is that all of
the sequences formed separate lineages from PBoV1 and
PBoV2, which are considered to be closely related to
HBoVs [14]. Recombination may play an important role in
the generation of new genotypes, as parvoviruses are
known to undergo genetic rearrangement and recombina-
tion similar to RNA viruses [3, 5, 14]. For example, canine
parvoviruses have a mean substitution rate of *1 9 10-4
substitutions nt-1 year-1, which is similar to that of RNA
viruses [3]. Hence, there is great need for continuous sur-
veillance to rule out any possibility of emergence of novel
bocaviruses of zoonotic importance.
Bocaviruses have gained attention following reports of
the involvement of human bocaviruses (HBoVs) in respi-
ratory illness and diarrhea. Recently discovered bocavi-
ruses from primates and pigs are closely related to HBoVs,
leading to the hypothesis that HBoV could be of zoonotic
origin [8, 13]. Thus, it is important to study emerging and
reemerging pathogens of swine, and this preliminary study
was conducted to determine the prevalence of porcine
bocaviruses in the US swine population. The overall rate of
bocavirus positivity in this study was higher than that
reported by Lau et al. [5]. They reported 16.5 % of samples
from healthy, sick, and deceased pigs to be bocavirus
positive. In our study, 5.5 % of the diarrhea cases that
tested negative for common gastrointestinal viruses were
found to contain bocavirus, indicating that this virus should
be considered a probable cause of diarrhea in pigs.
In both respiratory and diarrhea cases, a large number of
samples were positive as mixed infection (56.3 % and
57 %, respectively). This finding is in line with a study by
Zhang et al. [13], who also found a significantly higher rate
of mixed infections in diarrheal pigs than in healthy pigs in
China. Blomstrom et al. [1] reported a high prevalence of
bocavirus in pigs with PMWS when compared to non-
PMWS pigs in Sweden. They detected bocavirus along
with PCV-2 and porcine torque teno virus (PTTV-1,
PTTV-2) and suggested that synergistic effects of these
viruses may be responsible for the clinical manifestation of
PMWS. Zhai et al. [12] studied 191 pigs with respiratory
and reproductive problems on 31 farms in China and
reported a higher prevalence of PCV2, PRRSV, PTTV and
classical swine fever virus (CSFV) in bocavirus-positive
samples than in bocavirus-negative samples. They believed
that bocavirus present in healthy pigs may cause clinical
disease in the presence of bad management and/or infection
with other viruses. These studies indicate the importance of
bocavirus in pig diseases, either alone or with other viruses,
and also emphasize the need to study them further.
Acknowledgments We thank Montserrat Torremorell for providing
samples from healthy farms.
References
1. Blomstrom AL, Belak S, Fossum C, Fuxler L, Wallgren P, Berg
M (2010) Studies of porcine circovirus type 2, porcine boca-like
virus and torque teno virus indicate the presence of multiple viral
infections in postweaning multisystemic wasting syndrome pigs.
Virus Res 152:59–64
2. Cheng WX, Li JS, Huang CP, Yao DP, Liu N, Cui SX, Jin Y,
Duan ZJ (2010) Identification and nearly full-length genome
characterization of novel porcine bocaviruses. PLoS One
5:e13583
3. Hoelzer K, Shackelton LA, Holmes EC, Parrish CR (2008)
Within-host genetic diversity of endemic and emerging parv-
oviruses of dogs and cats. J Virol 82:11096–11105
4. King AMQ, Lefkowiz E, Adams M, Carstens E (2012) Virus
taxonomy: ninth report of the international committee on taxon-
omy of viruses. Parvovirdae. Academic Press, Waltham,
pp 405–425
5. Lau SK, Woo PC, Yip CC, Li KS, Fu CT, Huang Y, Chan KH,
Yuen KY (2011) Co-existence of multiple strains of two novel
porcine bocaviruses in the same pig, a previously undescribed
phenomenon in members of the family Parvoviridae, and evi-
dence for inter- and intra-host genetic diversity and recombina-
tion. J Gen Virol 92:2047–2059
6. Li B, Ma J, Xiao S, Fang L, Zeng S, Wen L, Zhang X, Ni Y, Guo
R, Yu Z, Zhou J, Mao A, Lv L, Wang X, He K (2012) Complete
genome sequence of a novel species of porcine bocavirus,
PBoV5. J Virol 86:1286–1287
7. Li L, Shan T, Wang C, Cote C, Kolman J, Onions D, Gulland
FM, Delwart E (2011) The fecal viral flora of California sea lions.
J Virol 85:9909–9917
8. Malecki M, Schildgen V, Schildgen O (2011) Human bocavirus:
still more questions than answers. Future Virol 6:1107–1114
9. Marthaler D, Rossow K, Gramer M, Collins J, Goyal S, Tsune-
mitsu H, Kuga K, Suzuki T, Ciarlet M, Matthijnssens J (2012)
Detection of substantial porcine group B rotavirus genetic
J. Huang et al.
123
diversity in the United States, resulting in a modified classifica-
tion proposal for G genotypes. Virology 433:85–96
10. Mor SK, Chander Y, Marthaler D, Patnayak DP, Goyal SM
(2012) Detection and molecular characterization of porcine as-
trovirus strains associated with swine diarrhea. J Vet Diagn Invest
24:1064–1067
11. Shan T, Li L, Simmonds P, Wang C, Moeser A, Delwart E (2011)
The fecal virome of pigs on a high-density farm. J Virol
85:11697–11708
12. Zhai S, Yue C, Wei Z, Long J, Ran D, Lin T, Deng Y, Huang L,
Sun L, Zheng H, Gao F, Chen S, Yuan S (2010) High prevalence
of a novel porcine bocavirus in weanling piglets with respiratory
tract symptoms in China. Arch Virol 155:1313–1317
13. Zhang Q, Hu R, Tang X, Wu C, He Q, Zhao Z, Chen H, Wu B
(2013) Occurrence and investigation of enteric viral infections in
pigs with diarrhea in China. Arch Virol 158:1631–1636
14. Zeng S, Wang D, Fang L, Ma J, Song T, Zhang R, Chen H, Xiao
S (2011) Complete coding sequences and phylogenetic analysis
of porcine bocavirus. J Gen Virol 92:784–788
Bocavirus in swine
123