BRIEF REPORT

Detection and characterization of porcine bocavirusin the United States

Jinhai Huang • Sunil K. Mor • Jonathan Erber •

Elyce Voss • Sagar M. Goyal

Received: 17 September 2013 / Accepted: 29 December 2013

� Springer-Verlag Wien 2014

Abstract We screened pigs (n = 203) presenting with

respiratory illness or diarrhea for porcine bocavirus (PBoV);

88 (43.30 %) were positive by PCR. More positives were

seen in diarrhea cases (48.7 %) than in respiratory cases

(29.1 %). Based on phylogenetic analysis of 540 nucleotides

of the NS1 gene, the viruses could be divided into four

possible groups. Group IV sequences did not match any

GenBank sequences, while groups I, II and III gave matches

with PBoV3, PBoV4 and PBoV5, respectively. The wide

range (70 % to 100 %) of nucleotide (nt) sequence identity

among strains in this study indicates high genetic diversity

among porcine bocaviruses.

Keywords Porcine bocavirus � Diarrhea � Phylogenetic

analysis

The genus Bocavirus, family Parvoviridae, subfamily

Parvovirinae, includes five members: bovine parvovirus

(BPV), canine minute virus (CnMV), human bocavirus

(HBoV), gorilla bocavirus (GBoV), and California sea lion

virus (CslBoV) [4, 7]. These non-enveloped viruses have a

diameter of 26 nm and contain a linear, single-stranded

DNA genome of 5-6 kb of either plus or minus polarity.

There are three open reading frames (ORFs) encoding two

nonstructural proteins (NS1 and NP1) and two structural

proteins (viral capsid proteins VP1 and VP2) [4].

Using random amplification and large-scale sequencing

technology, porcine bocaviruses (PBoV) were discovered

in Swedish pigs with post-weaning multisystemic wasting

syndrome (PMWS) [1]. Since then, a number of different

PBoVs have been discovered and characterized in Asia,

Europe and the U.S.A. The virus was detected in China in

2010 [12], and its complete genome was sequenced [12,

14]. In the following years, highly divergent PBoVs were

discovered. Cheng et al. [2] described the presence of

PoBoV1 and PBoV2 in China. Two other bocaviruses,

PoBoV3 and PoBoV4, were described in Hong Kong [5].

Recently, PBoV5 from pigs in China was described [6].

Using high-throughput sequencing, Shan et al. [11] iden-

tified bocaviruses in healthy (19-30 days) and diarrheic

piglets (24-30 days) on a high-density farm (1000 sows) in

North Carolina, USA. The present study was undertaken to

determine the presence of bocaviruses samples from pigs

submitted to the Minnesota Veterinary Diagnostic Labo-

ratory (MVDL) for detecting the cause of diarrhea and

respiratory problems.

The samples were submitted to MVDL between

October 2010 and February 2011. A total of 203 samples

were examined: 55 were lung samples of pigs from

seven different states, and 148 were fecal samples from

18 states and Mexico and Canada (Table 1). At the

MVDL, these samples were examined for the presence of

rotavirus, transmissible gastroenteritis virus (TGEV),

porcine circovirus type-2b (PCV2b), porcine respiratory

and reproductive syndrome virus (PRRSV), and hemag-

glutinating encephalomyelitis virus (HEV) [9, 10]. In

addition, we tested 10 fecal samples each from healthy

piglets and healthy gilts from two different Minnesota

farms.

J. Huang � S. K. Mor � J. Erber � E. Voss � S. M. Goyal (&)

Department of Veterinary Population Medicine and Minnesota

Veterinary Diagnostic Laboratory, University of Minnesota,

1333 Gortner Ave, St. Paul, MN 55108, USA

e-mail: goyal001@umn.edu

J. Huang

Tianjin University, No. 92 Weijin road, Nankai District,

Tianjin 300072, China

123

Arch Virol

DOI 10.1007/s00705-013-1972-4

DNA was extracted from all samples using a DNeasy

Blood and Tissue Kit (QIAGEN, Valencia, CA). Extracted

DNA was subjected to PCR using self-designed specific

primers for partial amplification of the NS gene: BoV-

NS1F (50 ACAGGCAGCCGATCACTCACTAT 30) and

BoV-NS1R (50 CTCGTTCCTCCCATCAGACACTT-30).A HotStar Taq Master Mix Kit (QIAGEN, Valencia, CA)

was used for PCR, and the reaction mixture consisted of

12.5 ll of master mix, 0.6 lM primer, 100 ng of template,

and nuclease-free water to make a total volume of 25 ll.

The amplification reaction consisted of initial denaturation

at 94 �C for 15 min, 35 cycles of denaturation at 94 �C for

30 s, annealing at 52 �C for 30 s, and extension at 72 �C

for 45 s, and final extension at 72 �C for 10 min. PCR

products were separated by electrophoresis on a 1.2 %

agarose gel, and the presence of a band at the position

corresponding to 780 bp confirmed the presence of PBoV.

PCR products from a representative set of samples

(n = 38) were purified by treating the amplified PCR

products with ExoSAP-IT (USB). PCR product (5 ll) was

mixed with 2 ll of ExoSAP-IT, incubated at 37 �C for

30 min, followed by inactivation of ExoSAP-IT at 80 �C

for 10 min. Purified products were submitted for

sequencing to the University of Minnesota Genomics

Center (UMGC). Forward and reverse sequences were

aligned together using Sequencher 5.1 software (www.

genecodes.com) followed by BLAST analysis (www.ncbi.

nlm.nih.gov). The nucleotide sequences thus obtained were

then aligned by the Clustal W method using MEGA 5.0

software. A phylogenetic tree of aligned sequences was

constructed by the neighbor-joining and maximum-likeli-

hood methods with the Kimura 2-parameter model using

1000 bootstrap replicate values.

Of the 203 samples tested, 88 (43.3%) were positive for

PBoV by PCR (Table 1). The virus was detected at a

higher rate from feces (48.6 %) than from lungs (29.1 %).

In respiratory cases, bocavirus was always present as a

mixed infection with other viruses, e.g., rotavirus (18.7 %),

HEV (12.5 %), and PRRSV (12.5 %). In 56.3 % of posi-

tive lungs, bocavirus was present as a mixed infection with

more than two viruses (Table 2). In cases of diarrhea, 57 %

of bocavirus-positive samples had mixed infections with

PCV, porcine astrovirus, or porcine rotavirus. Seven of ten

and six of ten samples were positive from healthy piglets

and gilts, respectively.

A representative number of samples (n = 38) were

purified for sequencing; two were lung samples and 31 were

intestinal contents from cases of illness. The remaining five

samples were from healthy pigs. BLAST analysis of

sequences confirmed them to be PBoV. All sequences have

been submitted to GenBank under accession numbers

KC514531-KC514561. The GenBank accession numbers

for sequences from lung as well as sequences from healthy

piglets and gilts are KF278661-KF278667.

We compared bocavirus sequences of this study with

published sequences of other bocaviruses. Phylogenetic

Table 1 Source of samples tested for porcine bocavirus

Sample

no.

State or

country

No. positive/no. tested from

the indicated samples

Total

positive/

total testedLung Feces

1 Arizona 0/1 0/1 0/2

2 Arkansas 2/4 3/8 5/13

3 Colorado 0/0 3/10 3/10

4 Illinois 2/4 7/8 9/12

5 Iowa 1/2 5/6 6/8

6 Kansas 0/0 0/1 0/1

7 Minnesota 9/41 21/42 30/83

8 Missouri 0/0 3/7 3/7

9 Michigan 0/0 0/1 0/1

10 Nebraska 0/0 4/5 4/5

11 North

Carolina

0/0 3/5 3/5

12 Ohio 0/0 0/1 0/1

13 Oklahoma 1/2 3/20 4/22

14 Pennsylvania 0/0 1/1 1/1

15 South

Dakota

0/0 2/2 2/2

16 Tennessee 1/1 5/6 6/7

17 Virginia 0/0 0/1 0/1

18 Wisconsin 0/0 0/1 0/1

19 Canada 0/0 4/9 4/9

20 Mexico 0/0 8/13 8/13

Total 16/55

(29.1 %)

72/148

(48.6 %)

88/203

Table 2 Occurrence of porcine bocavirus with other viruses

Virus No. (%)

positive in

lungs

No. (%)

positive in

feces

Porcine bocavirus alone 0 4 (5.5)

Porcine bocavirus ? porcine astrovirus 0 7 (9.7)

Porcine bocavirus ? porcine circovirus 0 5 (7.0)

Porcine bocavirus ? enteric viruses* 0 41 (57.0)

Porcine bocavirus ? rotavirus 3 (18.8) 15 (20.8)

Porcine bocavirus ? hemagglutinating

encephalomyelitis virus

2 (12.5) 0

Porcine bocavirus ? PRRSV 2 (12.5) 0

Porcine bocavirus ? respiratory viruses** 9 (56.3) 0

* Two or more enteric viruses (astro-, rota, HEV, PCV, TGE) were

present in association with porcine bocavirus

** Two or more respiratory viruses (HEV, SIV, PCV, rota-, PRRSV)

were present in association with porcine bocavirus

J. Huang et al.

123

analysis was based on 540 nucleotides (position 753-1257

of the reference sequence JF713715) of the NS1 gene. The

tree topology was the same in both neighbor-joining and

maximum-likelihood analysis. Based on sequence align-

ment and phylogenic tree, all sequences were divided into

four possible groups (groups I, II, III and IV). Group I

included 18 sequences (15 intestinal, 2 lung and 1 healthy

gilt), which had 90 % to 96 % nt sequence identity to

published PBoV3 sequences from China (JX944666,

NC_016031) and the USA (JF713715). Group II included

two sequences (one intestinal and one healthy piglet) that

gave a match with PBoV 4 (JF512473). Group III had four

sequences (three intestinal and one healthy piglet), which

gave match with PBoV5 (JN621325, NC_016647) (Fig. 1).

Group IV had 14 sequences (12 intestinal and one each

from healthy gilt and piglet) that did not match any ref-

erence GenBank sequences.

Group I sequences had 89 % to 100 % nt sequence

identity to each other but only 76.4-80 %, 77 %-79.5 %

and 75-80 % nt sequence identity with groups II, III, and

Fig. 1 Phylogenetic analysis

based on 540 nucleotides (from

nucleotide position 753 to 1257

of reference sequence

JF713715) of the NS1 gene of

bocavirus. The phylogenetic

tree was constructed by the

neighbor-joining method with

the Kimura 2-parameter model

and 1000 bootstrap replicates

Bocavirus in swine

123

IV, respectively. Group II sequences had 91.7 % to 95 %

nt sequence identity within the group and 79 % to 82 % nt

sequence identity with group III sequences. Group III

sequences had 92 % to 96 % nt sequence identity within

the group. Group IV sequences had 87 % to 95.6 % nt

sequence identity within the group while 71 % to 77 % and

72 % to 88 % nt sequence identity with group II and group

III, respectively. Comparison between healthy and affected

cases showed no distinction between the two, indicating

that they are closely related.

Based on the existing criteria for bocavirus classification

by the International Committee on Taxonomy of Viruses

(http://www.ictvdb.org), isolates belong to separate species

if they have\95 % identity in the nonstructural gene DNA

sequence [4]. In this study, all sequences had 90 % to

100 % nt sequence identity within their respective group,

but because only partial sequences were determined, the

existing criteria could not be applied here. The group IV

sequences did not align with existing GenBank sequences

of bocavirus and had limited identity (71 % to 88 %) to

other sequences in this study. Complete genome sequenc-

ing of these strains should yield a clearer picture of these

bocaviruses.

One of the important findings of this study is that all of

the sequences formed separate lineages from PBoV1 and

PBoV2, which are considered to be closely related to

HBoVs [14]. Recombination may play an important role in

the generation of new genotypes, as parvoviruses are

known to undergo genetic rearrangement and recombina-

tion similar to RNA viruses [3, 5, 14]. For example, canine

parvoviruses have a mean substitution rate of *1 9 10-4

substitutions nt-1 year-1, which is similar to that of RNA

viruses [3]. Hence, there is great need for continuous sur-

veillance to rule out any possibility of emergence of novel

bocaviruses of zoonotic importance.

Bocaviruses have gained attention following reports of

the involvement of human bocaviruses (HBoVs) in respi-

ratory illness and diarrhea. Recently discovered bocavi-

ruses from primates and pigs are closely related to HBoVs,

leading to the hypothesis that HBoV could be of zoonotic

origin [8, 13]. Thus, it is important to study emerging and

reemerging pathogens of swine, and this preliminary study

was conducted to determine the prevalence of porcine

bocaviruses in the US swine population. The overall rate of

bocavirus positivity in this study was higher than that

reported by Lau et al. [5]. They reported 16.5 % of samples

from healthy, sick, and deceased pigs to be bocavirus

positive. In our study, 5.5 % of the diarrhea cases that

tested negative for common gastrointestinal viruses were

found to contain bocavirus, indicating that this virus should

be considered a probable cause of diarrhea in pigs.

In both respiratory and diarrhea cases, a large number of

samples were positive as mixed infection (56.3 % and

57 %, respectively). This finding is in line with a study by

Zhang et al. [13], who also found a significantly higher rate

of mixed infections in diarrheal pigs than in healthy pigs in

China. Blomstrom et al. [1] reported a high prevalence of

bocavirus in pigs with PMWS when compared to non-

PMWS pigs in Sweden. They detected bocavirus along

with PCV-2 and porcine torque teno virus (PTTV-1,

PTTV-2) and suggested that synergistic effects of these

viruses may be responsible for the clinical manifestation of

PMWS. Zhai et al. [12] studied 191 pigs with respiratory

and reproductive problems on 31 farms in China and

reported a higher prevalence of PCV2, PRRSV, PTTV and

classical swine fever virus (CSFV) in bocavirus-positive

samples than in bocavirus-negative samples. They believed

that bocavirus present in healthy pigs may cause clinical

disease in the presence of bad management and/or infection

with other viruses. These studies indicate the importance of

bocavirus in pig diseases, either alone or with other viruses,

and also emphasize the need to study them further.

Acknowledgments We thank Montserrat Torremorell for providing

samples from healthy farms.

References

1. Blomstrom AL, Belak S, Fossum C, Fuxler L, Wallgren P, Berg

M (2010) Studies of porcine circovirus type 2, porcine boca-like

virus and torque teno virus indicate the presence of multiple viral

infections in postweaning multisystemic wasting syndrome pigs.

Virus Res 152:59–64

2. Cheng WX, Li JS, Huang CP, Yao DP, Liu N, Cui SX, Jin Y,

Duan ZJ (2010) Identification and nearly full-length genome

characterization of novel porcine bocaviruses. PLoS One

5:e13583

3. Hoelzer K, Shackelton LA, Holmes EC, Parrish CR (2008)

Within-host genetic diversity of endemic and emerging parv-

oviruses of dogs and cats. J Virol 82:11096–11105

4. King AMQ, Lefkowiz E, Adams M, Carstens E (2012) Virus

taxonomy: ninth report of the international committee on taxon-

omy of viruses. Parvovirdae. Academic Press, Waltham,

pp 405–425

5. Lau SK, Woo PC, Yip CC, Li KS, Fu CT, Huang Y, Chan KH,

Yuen KY (2011) Co-existence of multiple strains of two novel

porcine bocaviruses in the same pig, a previously undescribed

phenomenon in members of the family Parvoviridae, and evi-

dence for inter- and intra-host genetic diversity and recombina-

tion. J Gen Virol 92:2047–2059

6. Li B, Ma J, Xiao S, Fang L, Zeng S, Wen L, Zhang X, Ni Y, Guo

R, Yu Z, Zhou J, Mao A, Lv L, Wang X, He K (2012) Complete

genome sequence of a novel species of porcine bocavirus,

PBoV5. J Virol 86:1286–1287

7. Li L, Shan T, Wang C, Cote C, Kolman J, Onions D, Gulland

FM, Delwart E (2011) The fecal viral flora of California sea lions.

J Virol 85:9909–9917

8. Malecki M, Schildgen V, Schildgen O (2011) Human bocavirus:

still more questions than answers. Future Virol 6:1107–1114

9. Marthaler D, Rossow K, Gramer M, Collins J, Goyal S, Tsune-

mitsu H, Kuga K, Suzuki T, Ciarlet M, Matthijnssens J (2012)

Detection of substantial porcine group B rotavirus genetic

J. Huang et al.

123

diversity in the United States, resulting in a modified classifica-

tion proposal for G genotypes. Virology 433:85–96

10. Mor SK, Chander Y, Marthaler D, Patnayak DP, Goyal SM

(2012) Detection and molecular characterization of porcine as-

trovirus strains associated with swine diarrhea. J Vet Diagn Invest

24:1064–1067

11. Shan T, Li L, Simmonds P, Wang C, Moeser A, Delwart E (2011)

The fecal virome of pigs on a high-density farm. J Virol

85:11697–11708

12. Zhai S, Yue C, Wei Z, Long J, Ran D, Lin T, Deng Y, Huang L,

Sun L, Zheng H, Gao F, Chen S, Yuan S (2010) High prevalence

of a novel porcine bocavirus in weanling piglets with respiratory

tract symptoms in China. Arch Virol 155:1313–1317

13. Zhang Q, Hu R, Tang X, Wu C, He Q, Zhao Z, Chen H, Wu B

(2013) Occurrence and investigation of enteric viral infections in

pigs with diarrhea in China. Arch Virol 158:1631–1636

14. Zeng S, Wang D, Fang L, Ma J, Song T, Zhang R, Chen H, Xiao

S (2011) Complete coding sequences and phylogenetic analysis

of porcine bocavirus. J Gen Virol 92:784–788

Bocavirus in swine

123