Transcript

Biotechnology MethodsBiotechnology Methods

•Producing Recombinant DNAProducing Recombinant DNA

•Locating Specific GenesLocating Specific Genes

•Studying DNA SequencesStudying DNA Sequences

Recombinant DNARecombinant DNA

• DNA Produced by Joining DNA Produced by Joining Segments of DNA From Different Segments of DNA From Different SourcesSources

• eg. Bacterial plasmid DNA + eg. Bacterial plasmid DNA + Human DNA to Produce Human Human DNA to Produce Human InsulinInsulin

Tools for Producing Tools for Producing Recombinant DNARecombinant DNA

Restriction enzymes: enzymes that Restriction enzymes: enzymes that cleave the DNA double helix at cleave the DNA double helix at specific nucleotide sequencesspecific nucleotide sequences

Use of the Restriction Enzyme Bam H1Use of the Restriction Enzyme Bam H1

5’— G G A T C C — 3’5’— G G A T C C — 3’ 3’— C C T A G G — 5’3’— C C T A G G — 5’

5’— G G A T C C — 3’5’— G G A T C C — 3’ 3’— C C T A G G — 5’3’— C C T A G G — 5’

sticky endsticky end

sticky endsticky end

Results inResults in

DNA fragments from different sources can be joined DNA fragments from different sources can be joined together if they have complementary sticky ends.together if they have complementary sticky ends.

Producing Recombinant DNAProducing Recombinant DNA

Tools for Producing Recombinant DNATools for Producing Recombinant DNA

Plasmid: extrachromosomal, Plasmid: extrachromosomal, independently replicating, small circular independently replicating, small circular DNA molecule; a type of vector used to DNA molecule; a type of vector used to carry DNA into bacterial cellscarry DNA into bacterial cells

DNA Inserted in a Plasmid Can be Detected DNA Inserted in a Plasmid Can be Detected by Disruption of a Selectable Markerby Disruption of a Selectable Marker

ampR

tetR

Bam H1Bam H1

If additional DNA is inserted at the Bam H1 site, the tetR gene is disrupted and is no longer functional

ampR

Producing Recombinant DNA Producing Recombinant DNA

restriction enzyme

Treat source Treat source DNA with DNA with restrictionrestrictionenzymeenzyme

Treat plasmid Treat plasmid DNA with DNA with same enzymesame enzyme

restriction enzyme

Mix togetherMix togetherAdd DNA LigaseAdd DNA Ligase

Many recombinant DNAMany recombinant DNAmolecules are produced,molecules are produced,each with a different each with a different piece of source DNA piece of source DNA

TransformTransform bacterial cells bacterial cells

Each bacterial cellEach bacterial cellcarries a different carries a different recombinant plasmidrecombinant plasmid

Tools for Producing Tools for Producing Recombinant DNARecombinant DNA

Probe: sequence of DNA that is Probe: sequence of DNA that is complementary to the gene of interest; complementary to the gene of interest; Used to locate a copy of the gene by Used to locate a copy of the gene by hybridizationhybridization

Add ProbeAdd ProbeProbe Binds to gene Probe Binds to gene

AGCTTAGCGATAGCTTAGCGATTCGAATCGCTATCGAATCGCTA

AATCGCAGCTTAGCGATAGCTTAGCGAT

TCGAATCGCTATCGAATCGCTA

Denature DNA by heatingDenature DNA by heating

Tools for Producing Tools for Producing Recombinant DNARecombinant DNA

Library: collection of DNA sequences Library: collection of DNA sequences from one donor that can be screened by from one donor that can be screened by a probe to detect the gene of interesta probe to detect the gene of interest– Genomic library = Genomic library = allall of the sequences of the sequences

from the genome of a single organismfrom the genome of a single organism– cDNA library= complementary DNA, cDNA library= complementary DNA,

made using mRNA as a template, made using mRNA as a template, used to study used to study transcribedtranscribed sequences sequences

Building Building aa

Genomic Genomic LibraryLibrary

Producing cDNA MoleculesProducing cDNA Molecules

TTTTTTTT

Exon 1 Exon 2 Exon 3G AAAAAAAA…… mRNA

Reverse transcriptaseOne strand of cDNA

TTTTTTTT

AAAAAAAADNA polymerase

TTTTTTTT

AAAAAAAA

Second strand of cDNA

nuclease nuclease

cDNA

To produce a cDNA library, each cDNA from the same cell

type would be inserted into a

vector

Using a Probe to Screen a Library for a Gene of Interest

Applying Your KnowledgeApplying Your Knowledge

Which one best describesWhich one best describes• An enzyme that cleaves DNA at specific sequences?An enzyme that cleaves DNA at specific sequences?• A sequence of DNA that is complementary to the gene A sequence of DNA that is complementary to the gene

of interest?of interest?• A collection of DNA molecules used to find a gene of A collection of DNA molecules used to find a gene of

interest?interest?• A small, independently replicating DNA molecule?A small, independently replicating DNA molecule?

1.1. ProbeProbe2.2. CloneClone3.3. PlasmidPlasmid4.4. LibraryLibrary5.5. Restriction EnzymeRestriction Enzyme

Biotechnological Methods: PCRBiotechnological Methods: PCRhttp://www.dnalc.org/ddnalc/resources/pcr.htmlhttp://www.dnalc.org/ddnalc/resources/pcr.html

PCR = Polymerase Chain Reaction PCR = Polymerase Chain Reaction

Amplifies a specific region in the DNAAmplifies a specific region in the DNA Used for identification, especiallyUsed for identification, especially if the amount of DNA is small if the amount of DNA is small Uses repeated cycles of heating to Uses repeated cycles of heating to denature DNA and cooling to synthesize denature DNA and cooling to synthesize new DNA new DNAInvolves the use of Involves the use of

---Taq polymerase (withstands heat)---Taq polymerase (withstands heat)

---primers to begin synthesis---primers to begin synthesis

Polymerase Chain Reaction:Polymerase Chain Reaction:One PCR CycleOne PCR Cycle

OriginalOriginalDouble-Double-helixhelixDNADNA

SeparateSeparateDNADNAStrandsStrands

90 °C90 °C

Primers &Primers &TaqTaqpolymerasepolymerasebindbind

50 °C50 °C

Taq PolymeraseTaq Polymerase PrimerPrimer

72 °C72 °C

DNADNAsynthesizedsynthesized

Polymerase Chain Reaction:Polymerase Chain Reaction:Multiple PCR CyclesMultiple PCR Cycles

DNADNAfragmentfragment

to beto beamplifiedamplified

2 copies2 copies 4 copies4 copies 8 copies8 copies

DNA Fingerprinting with PCRDNA Fingerprinting with PCR

Biotechnological Methods: RFLPBiotechnological Methods: RFLP

RFLP AnalysisRFLP Analysis

RRestriction estriction FFragment ragment LLength ength PPolymorphismolymorphism

• Use of a probe to identify specific DNA Use of a probe to identify specific DNA fragments derived from restriction enzyme fragments derived from restriction enzyme digestion digestion

• Shows variations in sizes of fragments Shows variations in sizes of fragments between different individuals between different individuals

Separation of Restriction Fragments by Size Separation of Restriction Fragments by Size

DNA separated by sizeDNA separated by sizeis transferred from is transferred from agarose gel to filteragarose gel to filter

DNA on filter is DNA on filter is exposed to probe exposed to probe to detect to detect complementary complementary sequences.sequences.

Southern Blotting for RFLP AnalysisSouthern Blotting for RFLP Analysis

RFLP Analysis used for Paternity TestingRFLP Analysis used for Paternity Testing

X

X

X

X

X

X

X

X

CC SSRR CCII EE

MM NNEE EE

RFLP Analysis in ForensicsRFLP Analysis in Forensics

11 22 33 44 55 66 77

SuspectsSuspects SuspectsSuspects

RFLP Analysis in Genetic TestingRFLP Analysis in Genetic Testing

On the basis of this analysis, the genotype of the fetus is 1. AS 2. AA 3. SS 4. Unknown


Top Related