Transcript
Page 1: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

Biology Unit Review Biology Unit Review GameGame

Page 2: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

Chapter 4Chapter 4

Name three differences between plant and Name three differences between plant and animal cells.animal cells.

A – Plant cells – cell wall, larger vacuoles, A – Plant cells – cell wall, larger vacuoles, chloroplasts. Animal cells – flagellum/cilia, chloroplasts. Animal cells – flagellum/cilia, smaller vacuolessmaller vacuoles

What is the purpose of the ribosome?What is the purpose of the ribosome?

A – Produces proteinsA – Produces proteins What is the power house of the cell?What is the power house of the cell?

A – MitochondriaA – Mitochondria

Page 3: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

Cell Parts ContinuedCell Parts Continued

What is the purpose of the endoplasmic What is the purpose of the endoplasmic reticulum?reticulum?

A – To transport materials within the cell.A – To transport materials within the cell. How do proteins leave the cell?How do proteins leave the cell?A – They are packaged in vesicles (at the A – They are packaged in vesicles (at the

end of the Golgi body) and are carried to end of the Golgi body) and are carried to the cell membrane.the cell membrane.

What would happen if the nucleus of a cell What would happen if the nucleus of a cell was taken out?was taken out?

A – The cell would die.A – The cell would die.

Page 4: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

DNADNA

Where is DNA found?Where is DNA found?A – The nucleusA – The nucleus What does DNA stand for?What does DNA stand for?A – deoxyribonucleic acidA – deoxyribonucleic acid What shape does DNA take?What shape does DNA take?A – Double helixA – Double helix What three parts make up DNA?What three parts make up DNA?A – Sugar, phosphate, and bases A – Sugar, phosphate, and bases

Page 5: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

DNADNA

What does A, G, C and T stand for?What does A, G, C and T stand for?A – adenine, guanine, cytosine, and A – adenine, guanine, cytosine, and

thyminethymine What does adenine pair with?What does adenine pair with?A – thymineA – thymine Most of the time, DNA exists in the Most of the time, DNA exists in the

nucleus in the form of what?nucleus in the form of what?A – chromatinA – chromatin What does DNA code for?What does DNA code for?A – proteinsA – proteins

Page 6: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

ChromosomesChromosomes

How many pairs of chromosomes are How many pairs of chromosomes are found in human cells?found in human cells?

A – 23 pairsA – 23 pairs If your 23If your 23rdrd pair of chromosomes is XY, pair of chromosomes is XY,

you would be a …you would be a …

A – male/boyA – male/boy Small segments of DNA are called what?Small segments of DNA are called what?

A - genesA - genes

Page 7: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

Genes/ProteinsGenes/Proteins

What is the importance of genes?What is the importance of genes?

A – stores information needed to produce A – stores information needed to produce specific proteins.specific proteins.

Which of the following are not specialized Which of the following are not specialized proteins: hormones, nucleolus, enzyme?proteins: hormones, nucleolus, enzyme?

A – nucleolusA – nucleolus Why are stomach cells different from skin Why are stomach cells different from skin

cells?cells?

A – different proteins have been made for A – different proteins have been made for each cell.each cell.

Page 8: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

Protein ProductionProtein Production

What does RNA stand for?What does RNA stand for?

A – ribonucleic acidA – ribonucleic acid How is the message for a protein to be made How is the message for a protein to be made

carried from the nucleus to the ribosomes?carried from the nucleus to the ribosomes?

A – DNA message for a specific protein is copied A – DNA message for a specific protein is copied into RNA which leaves through the nuclear pore into RNA which leaves through the nuclear pore and delivers the message to the ribosome.and delivers the message to the ribosome.

What is the function of the Golgi body?What is the function of the Golgi body?

A – To repackages the protein for transport out of A – To repackages the protein for transport out of the cell.the cell.

Page 9: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

MutationsMutations

What type of mutation is occurring in the What type of mutation is occurring in the following DNA sequence (and where):following DNA sequence (and where):

CATGCCTGACGTCTGATGCCACATGCCTGACGTCTGATGCCAMutation 1: CATGCCTGACCTCTGATGCCAMutation 1: CATGCCTGACCTCTGATGCCAA – Substitution – A – Substitution –

CATGCCTGACCATGCCTGACCCTCTGATGCCATCTGATGCCAMutation 2: CATGCCTGACGTCTGATGCCAAMutation 2: CATGCCTGACGTCTGATGCCAAA – Addition – CATGCCTGACGTCTGATGCCAA – Addition – CATGCCTGACGTCTGATGCCAAAMutation 3: CATCCTGACGTCTGATGCCAMutation 3: CATCCTGACGTCTGATGCCAA – Deletion - CAA – Deletion - CATCTCCTGACGTCTGATGCCACTGACGTCTGATGCCA

Page 10: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

Chapter 5 – Mitosis Chapter 5 – Mitosis What is the longest stage of the cell cycle?What is the longest stage of the cell cycle?A – interphaseA – interphase What occurs during interphase?What occurs during interphase?A – growth and preparation, DNA replication, A – growth and preparation, DNA replication,

protein synthesis.protein synthesis. What are the other two stages of the cell What are the other two stages of the cell

cycle?cycle?A – mitosis and cell division (cytokinesis)A – mitosis and cell division (cytokinesis) Why does a cell divide?Why does a cell divide?A – The surface area to volume ratio is small.A – The surface area to volume ratio is small.

Page 11: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

DNA ReplicationDNA Replication What is the first step in DNA replication?What is the first step in DNA replication?A – DNA sides separateA – DNA sides separate What aids in separating the DNA sides?What aids in separating the DNA sides?A – enzymesA – enzymes What occurs in step 2 of DNA replication?What occurs in step 2 of DNA replication?A – New bases pair with the bases on the A – New bases pair with the bases on the

original DNAoriginal DNA Why is DNA replication important?Why is DNA replication important?A – So that when the cell divides, the new A – So that when the cell divides, the new

daughter cells will have all of the genetic daughter cells will have all of the genetic information.information.

Page 12: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

In the diagram to In the diagram to the right, what do the right, what do the two sister the two sister chromatids have in chromatids have in common?common?

A – They are A – They are replicated replicated chromosomes. chromosomes. They are identical They are identical copies of the DNA.copies of the DNA.

Page 13: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

What phase of What phase of mitosis is occurring mitosis is occurring in the diagram to the in the diagram to the right?right?

A – anaphaseA – anaphase What phase occurs What phase occurs

before anaphase?before anaphase?A – metaphaseA – metaphase What occurs during What occurs during

metaphase?metaphase?A – The chromosomes A – The chromosomes

line up across the line up across the middle (equator) of middle (equator) of the cellthe cell

Page 14: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

What is being produced during telophase of What is being produced during telophase of mitosis?mitosis?

A – two nuclei A – two nuclei What are two difference between What are two difference between

mitosis/cytokinesis in plants and animals?mitosis/cytokinesis in plants and animals?

A – Plants doen’t have centrioles and animals A – Plants doen’t have centrioles and animals don’t produce a cell plate.don’t produce a cell plate.

If you started out with 365 chromosomes in the If you started out with 365 chromosomes in the parent cell, how many chromosomes would parent cell, how many chromosomes would each of the daughter cells have?each of the daughter cells have?

A – 365A – 365

Page 15: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

What is the correct order of the stages of What is the correct order of the stages of mitosis?mitosis?

A – prophase, metaphase, anaphase, A – prophase, metaphase, anaphase, telophasetelophase

What is another word for cell division?What is another word for cell division?

A – cytokinesisA – cytokinesis How many parents are there in asexual How many parents are there in asexual

reproduction?reproduction?

A - OneA - One

Page 16: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

Asexual ReproductionAsexual Reproduction

Which of the following is not a type Which of the following is not a type of asexual reproduction: spore of asexual reproduction: spore formation, gamete formation, binary formation, gamete formation, binary fission, budding, fragmentation, fission, budding, fragmentation, vegetative reproduction?vegetative reproduction?

A – gamete formationA – gamete formation Define clone.Define clone.A - A - a genetically identical offspring of

an single parent.

Page 17: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

Asexual ReproductionAsexual Reproduction

What type of asexual What type of asexual

reproduction is occurring reproduction is occurring

in the picture to the right?in the picture to the right?

A: buddingA: budding

Give an example of an Give an example of an

organism that reproduces organism that reproduces

this way.this way.

A: hydra, sponge, yeastA: hydra, sponge, yeast

Page 18: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

Asexual ReproductionAsexual Reproduction

What type of asexual What type of asexual

reproduction is occurring in reproduction is occurring in

the picture to the right?the picture to the right?

A: binary fissionA: binary fission How many cells are How many cells are

dividing?dividing?

A: OneA: One What is the benefit of this What is the benefit of this

type of reproduction?type of reproduction?

A: Genetically identical A: Genetically identical

offspring.offspring.

Page 19: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

Asexual ReproductionAsexual Reproduction

How do Eurasian milfoil and starfish How do Eurasian milfoil and starfish reproduce?reproduce?

A – fragmentationA – fragmentation A graft would be made during what type A graft would be made during what type

of asexual reproduction?of asexual reproduction?

A – vegetative reproduction.A – vegetative reproduction. Give an example that uses spore Give an example that uses spore

formation as it reproductive method.formation as it reproductive method.

A – bread mould, mosses, ferns, fungiA – bread mould, mosses, ferns, fungi

Page 20: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

Chapter 6 - MeiosisChapter 6 - Meiosis

An egg and sperm are produced An egg and sperm are produced where?where?

A: in the ovaries and testesA: in the ovaries and testes What is a haploid cell considered?What is a haploid cell considered?A: a gameteA: a gamete How many chromosomes will an egg How many chromosomes will an egg

or sperm cell have if the parent cell or sperm cell have if the parent cell had 46 chromosomes?had 46 chromosomes?

A – 23 chromosomes.A – 23 chromosomes.

Page 21: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

Meiosis IMeiosis I What stage of meiosis is What stage of meiosis is

occurring in the picture to occurring in the picture to the right?the right?

A: metaphase IA: metaphase I What has lined up along the What has lined up along the

equator?equator?A: homologous chromosomes.A: homologous chromosomes. What occurs during What occurs during

anaphase I?anaphase I?A: A: Homologous chromosome Homologous chromosome

pairs are pulled away from pairs are pulled away from each other towards opposite each other towards opposite ends of the cell. Sister ends of the cell. Sister chromatids still attached.chromatids still attached.

Page 22: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

Meiosis IIMeiosis II

What occurs during anaphase II?What occurs during anaphase II?

A: The sister chromatids are split apart at the A: The sister chromatids are split apart at the centromere and move to opposite poles.centromere and move to opposite poles.

How many chromosomes are in each of the How many chromosomes are in each of the daughter cells at the end of meiosis?daughter cells at the end of meiosis?

A: Half the number as the parent cell.A: Half the number as the parent cell. Why does meiosis occur?Why does meiosis occur?

A: So that sperms and eggs only have half the A: So that sperms and eggs only have half the number of chromosomes so when meet, full number of chromosomes so when meet, full set.set.

Page 23: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

When a egg and sperm cell meet, When a egg and sperm cell meet, what is this process called?what is this process called?

A: fertilizationA: fertilization What is the cell called when What is the cell called when

fertilization occurs?fertilization occurs?A: a zygoteA: a zygote A zygote is considered what type of A zygote is considered what type of

cell; haploid or diploid?cell; haploid or diploid?A: diploidA: diploid

Page 24: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

When looking at a karyotype of a When looking at a karyotype of a person that has the Edwards syndrome, person that has the Edwards syndrome, what will be different on the karyotype what will be different on the karyotype from someone who does not have the from someone who does not have the Edwards syndrome?Edwards syndrome?

A: There is an extra chromosome at site A: There is an extra chromosome at site 12.12.

What other syndrome would have an What other syndrome would have an extra chromosome in each cell?extra chromosome in each cell?

A: Down syndromeA: Down syndrome

Page 25: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

What are two advantages of asexual What are two advantages of asexual reproduction?reproduction?

A: genetically identical offspring, lots A: genetically identical offspring, lots of offspring can be reproduced of offspring can be reproduced quickly.quickly.

What is the major advantage of What is the major advantage of sexual reproduction?sexual reproduction?

A: Genetic diversityA: Genetic diversity

Page 26: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

Embryonic DevelopmentEmbryonic Development

List the following stages of human List the following stages of human development in order: blastula, zygote, development in order: blastula, zygote, fetus, gastrula, morulafetus, gastrula, morula

A: zygote, morula, blastula, gastrula, fetusA: zygote, morula, blastula, gastrula, fetus Which of the stages above would consist Which of the stages above would consist

of a ball of cells?of a ball of cells?A: morulaA: morula Which of the stages above would consist Which of the stages above would consist

of a hollow ball of cells?of a hollow ball of cells?A: bastulaA: bastula

Page 27: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

What to Study What to Study Multiple ChoiceMultiple Choice

Chapter 4Chapter 4 Know the organelles and their functionsKnow the organelles and their functions Know what makes up DNA and its purposeKnow what makes up DNA and its purpose What do each of the bases pair up withWhat do each of the bases pair up with Know the general idea of how proteins are Know the general idea of how proteins are

mademade Know what a mutation is and the different Know what a mutation is and the different

types – deletion, addition, substitutiontypes – deletion, addition, substitution

Page 28: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

What to Study continued…What to Study continued…

Chapter 5Chapter 5 Stages of the cell cycle – interphase, Stages of the cell cycle – interphase,

mitosis, cytokinesismitosis, cytokinesis DNA replicationDNA replication Mitosis stages – what occurs at each Mitosis stages – what occurs at each

stagestage What is the purpose of mitosisWhat is the purpose of mitosis What is the end result of mitosisWhat is the end result of mitosis Different types of asexual reproductionDifferent types of asexual reproduction

Page 29: Biology Unit Review Game. Chapter 4 Name three differences between plant and animal cells. Name three differences between plant and animal cells. A –

What to Study continued…What to Study continued…

Chapter 6Chapter 6 What is the purpose of meisosisWhat is the purpose of meisosis Where does meiosis occur, what is Where does meiosis occur, what is

produced, what is the end result of meiosisproduced, what is the end result of meiosis Know stage I and II of meisosisKnow stage I and II of meisosis What occurs when egg and sperm cells joinWhat occurs when egg and sperm cells join Karyotypes – what can we detectKaryotypes – what can we detect Embryonic developmentEmbryonic development Don’t worry about assisted reproductive Don’t worry about assisted reproductive

technologies or internal/external fertilizationtechnologies or internal/external fertilization


Top Related