DBT-North East Centre for
Agricultural Biotechnology
(DBT-NECAB)
Annual Report
Sept. 2018- Sept. 2019
Assam Agricultural University
Jorhat, 785013
Assam, India
i
Annual Report Sept. 2018-Sept. 2019
DBT-North East Centre for Agricultural
Biotechnology (DBT-NECAB)
Assam Agricultural University, Jorhat 785013, Assam;
Published by
© DBT-NECAB, Assam Agricultural University, 2019
Annual Report Preparation Committee:
Prof. Bidyut Kumar Sarmah, Chairman
Prof. Madhumita Barooah, Member
Dr. Aiswarya Baruah, Member
Mr. Manab Bikash Gogoi, Member
Dr. Sudipta Sankar Bora, Member
Mr. Rupjyoti Das, Member
Printed at:
Aayan’s World
B. B. Hall Market
Jorhat – 785001, Assam
ii
Acknowledgements
The DBT-NECAB is grateful to
Dr. Ashok Bhattacharyya,
Acting Vice Chancellor
and
Director of Research,
Assam Agricultural University,
for his advice and suggestions
in preparing the report.
We also acknowledge
the help and co-operation received from
Dr. Jayanta Deka, Dean, College of Agriculture;
Dr. Prasanna Kr. Pathak, Director, Extension Education, AAU.
iii
Contents
Scientists Associated and Objectives…………………..……………….1
Focus-Areas of DBT-NECAB ....................................................3
Summary.................................................................................. 5
Scientific Report (as per approved objectives) ........................ 9
Programme Objective I ................................................................... 11
Programme Objective II ................................................................ 27
Programme Objective III ............................................................... 39
Programme Objective IV a ............................................................. 55
Programme Objective IV b ............................................................. 67
Academics .............................................................................. 75
Human Resource Development and Capacity Building ................. 77
Training and Awareness ................................................................ 80
Projects through Extramural Grants .............................................. 85
Proceedings of 1st SAC meeting ............................................... 93
Financial Statement of Expenditure ...................................... 99
DBT-NECAB Annual Report, 2018-19
Scientists Associated 1
Scientists Associated
Dr. Bidyut K Sarmah, Director and Project Coordinator (DBT-NECAB)
Programme Objective I:
Genetic improvement of rice for abiotic and biotic stress tolerance using
molecular breeding, especially drought, submergence and bacterial blight disease
Dr. M. K. Modi, Prof. & Head, Dept. of ABT, AAU (Principal Investigator)
Dr. R. N. Sarmah, Prof., Dept. of Plant Breeding and Genetics
Dr. A. R. Baruah, Assistant Prof., Dept. of ABT, AAU
Dr. T. Ahmed, RARS, Titabar
Dr. S. Chetia, RARS, Titabar
Programme Objective II:
Genetic improvement of chickpea using gene technology for insect resistance
Dr. Sumita Acharjee, ABT, AAU, Jorhat (Principal Investigator)
Dr. T J V Higgins, CSIRO, Australia (Collaborator)
Dr S. Singh, PAU; Dr I S Katageri, UASD (Collaborators)
Programme Objective III:
Bioprospecting of soil microbes from acidic soils of N E region
Prof. Madhumita Barooah, Dept. of ABT (Principal Investigator)
Dr Robin C. Boro, Dept. of ABT, AAU
Programme Objective IV:
Development of efficient biofertilizers and biopesticides using novel microbial strains from NE soils.
a. Biofertilizers:
Dr. Rajen Baruah, Dept. of Soil Science, AAU (Principal Investigator)
b. Biopesticides:
Dr. L. C. Bora, Dept. of Plant Pathology (Principal Investigator),
Dr. D. K. Saikia, Principal Scientist, Dept. of Entomology, AAU
Dr. Bharat Chandra Nath, Asst. Prof., Dept of Plant Pathology, AAU
Focus Areas 2
DBT-NECAB Annual Report, 2018-19
3
Focus-Areas of DBT-NECAB
Research and development:
1. Allele/QTL mining and molecular breeding for stress tolerance
2. Gene technology for crop improvement
3. Gene prospecting from soil microbes
4. Generation of novel biofertilizers and biopesticides
Academics:
Human resource development
Extramural Grants obtained by Scientists Associated with the Centre
Recognitions to our scientists/researchers
Extension Services through Satellite Laboratories:
Promote Organic Farming in the NE region through provisioning of bioinputs
(Biopesticides and Biofertilizer) and also through providing trainings to the farmers and
entrepreneurs.
Summary
Summary 6
DBT-NECAB Annual Report, 2018-19
7
Highlights of Research, Academic and
Service Activities
Research and development (Salient findings)
Gene mining and molecular breeding of rice for biotic and abiotic stresses:
• Phenotyping of 300 Ahu rice germplasms for drought completed
• Phenotyping of 290 Sali rice germplasms completed, where submergence tolerant
lines identified; attempt to identify the gene(s)/QTL(s) responsible for the same in progress
• A total of 7 QTLs for yield and yield attributing traits identified from Banglami x Ranjit
Cross
• F6 generation of Banglami x Ranjit is phenotyped; Fine mapping of 7 identified QTLs in
progress
• BLB resistant gene incorporated into Luit and Dishang varieties. BC2F4 lines in the field
Bt Chickpea development:
• Redesigning of chloroplast targeted Bt gene constructs for IR chickpea
• Establishment of transformed lines using existing pBK203 (truncated Cry1Ac) and pBK209
(full-length Cry1Ac gene driven AraSSU promoter) binary vectors
• Marker-Assisted backcross breeding performed to introgress Cry1Ac Gene from transgenic
chickpea lines into cultivated chickpea varieties, PBG 7 (Desi) and L 552 (Kabuli) for
resistance to Helicoverpa armigera
• Comparative nutritional assessment, seed storage proteins profiling, and in-vitro protein
digestibility (using the simulated gastric fluid) performed to assure that homozygous progeny of
two lines, Cry1Ac.1 and Cry1Ac.2 lines are as safe as the non-transgenic chickpea
• Screening of Soil Microbes for Acid Tolerance Gene:
• Functionality of five up-regulated genes viz., spoA, proA, proC, cupin and gad have
been validated through site-directed mutagenesis
• Evaluation of promising PGP bacterial isolates in improving soil health, promotion of plant
growth and plant protection under progress
Biofertilizer:
• Successfully isolated compost accelerating bacteria from gut of white grub beetle
Lepidiota mansueta with cellulose degrading property
• Successfully started Mass multiplication of Arthospira platensis
Biopesticides:
• Important bio-agents isolated for biopesticides production: Trichoderma harzanium;
Trichoderma viride; Pseudomonas fluorescens; Metarhizium anisopliae; Beauveria
bassiana; Verticillium lecanii; Bacillus thuringiensis; Trichoderma parareesei;
Paecilomyces fumosoroseus; Aspergillus tamarii.
• Talc based bioformulations: Bio-Time; Biozin-PTB; Bio-Sona; Bio-llium, Bio-Meta; Bio-
Zium; Bio-veer; Biogreen; Biogreen-L; Organic based: Biofor-P
Summary 8
DBT-NECAB Annual Report, 2018-19
Total publication:
• Twenty-nine literatures (9 original research articles, 2 book chapters and 18 lecture notes)
published in different national and international journals by the scientists under the DBT-
NECAB
Hand-Books published:
• Six hand books/booklets published under various R&D programmes under the DBT-
NECAB
Conference presentation:
• Five research papers presented in different national and international conferences and
bagged first and third prizes. All papers published in the proceeding of the concerned
symposiums
Extramural grants obtained:
• Seven ongoing extramural projects under the scientists of DBT-NECAB from different
funding agencies like DBT, ICAR etc. with a total grand of Rs. 695.9 Lakhs.
Scholarship awarded:
• During this period seven Ph.D. scholars availed the PhD fellowship offered by DBT-
NECAB on merit basis.
Academic degree obtained:
• Nine M. Sc. and six PhD students obtained their degrees. One more PhD student already
submitted his thesis and supposed to obtain the degree during the current session.
Workshop conducted:
• The Inaugural Ceremony of DBT-NECAB and First Scientific Advisory Meeting held on
November 19-20, 2018
• An International Symposium on ‘Biotechnology for Food-Nutritional Security Organic
Agriculture’ held on March 25-26, 2019
• A National Workshop on ‘Potential Biotechnology Programmes Using Bioresources of the
NE Region’ held on September 12-14, 2019
Training to farmers and entrepreneurs:
• Seven (7) entrepreneurs trained on commercial production of Bio-inputs
• Eighteen (18) Small Tea-Growers (STGs) trained on organic agriculture
Training to the students and research scholars:
• Two Fellows (Dr. Sushil Kumar Singh, Mrs. Sandhani Saikia) participated in a short-term
training on NGS data analysis (4th March to 16th March 2019)
MOU signed with private / public partners for technology transfer:
• MoU signed with following enterprises to transfer the biopesticide production technology developed by Biopesticide lab of DBT-NECAB Centre under PPP mode-
• VRS Agritech, Guwahati
• School of Livelihood & Rural Development (SLRD), Shillong
• M/s Orgaman R&D Division, Jorhat
DBT-NECAB Annual Report, 2018-19
Scientific Reports
DBT-NECAB Annual Report, 2018-19
Scientific Repor
Scientific Report 11
DBT-NECAB Annual Report, 2018-19
Programme Objective I
Objective: Genetic improvement of rice for abiotic and biotic stress tolerance using
molecular breeding, especially drought, submergence and bacterial blight disease
Background and Rationale: Rice is one of the most important food crops consumed by almost half of the world’s
population. Globally 90% production of rice is in Asia, India is the second-largest producer
of rice. Rice is the staple food for more than 50% of the population in Asia, and South Asia.
Rice is the staple crop for more than 70% of the Indian people, and every day millions of
Indian finds comfort in it.
In Assam, rice is grown throughout the state in a wide range of seasons, soil types and
water regimes. On average, Assam receives 2586 mm of rainfall of which 650 mm is during
the summer (March-May) and 1702 mm is during monsoon session (July-September). But the
state is prone to rainfall deficiency to a tune of 40% according to economic survey of Assam
for 2013-14. Rainfed summer or ahu rice suffers from prolonged drought due to late arrival
of monsoon while transplanted Sali (June/July-October/November) is affected by intermittent
drought due to rainless periods during growing stages of the crop. Drought causes substantial
yield loss in rice when it occurs in the panicle initiation stage of the crop. According to the
Economic Survey of Assam, 2013-14, the total land covered under assured irrigation through
shallow tube wells (STWs) & low lift point irrigation system (LLPs) is 5.78 lakh ha (21% of
Net Cropped Area). Thus, rice in Assam, being a rainfed crop, suffers from water scarcity in
different stages of crop growth. In recent times, summer rice is gaining popularity in Assam
in the area under irrigated flood-free ecology with the increased provision of STW to a tune
of 5.84 lakh ha under STWs and LLPs (Economic Survey of Assam, 2014-15). However, in
the long run, an increased provision of irrigation might not be economically viable if all the
cost of providing water to the rice field is considered (cost of power for irrigation, cost of
runoff water etc.).
The convergence of enormous population growth, climate change, water shortage, and
global warming is expected to threaten agriculture and food security. Increasing incidences of
biotic and abiotic stresses under changing climate are major constraints to meet the ever-
growing demand for food and rapidly escalating population attain global food security. Severe
yield loss due to various biotic stresses like bacterial leaf blight (BLB) and Blast (disease) and
DBT-NECAB Annual Report, 2018-19
Scientific Report 12
abiotic stresses like submergence and drought are serious constraints to rice productivity
throughout the world. Therefore, it has become necessary to fortify the popular varieties with
genes/QTL’s that can impart tolerance to various biotic and abiotic stresses.
Genome-Wide Association Studies (GWAS) is regarded as a rapid approach of
identifying genes associated with phenotypic traits and to provide markers for these genes for
marker-assisted breeding. The identification of major QTL’s for drought, submergence
tolerance and several QTL’s for resistance against BLB and Blast in rice has provided new
opportunities for breeders to develop varieties that are tolerant against these biotic/abiotic
stresses.
Specific Objectives:
Objective 1. Identification of new QTL/candidate gene for tolerance to water stress from
local rice germplasm
a. Genome-Wide Association studies:
Under this programme, we aimed to identify markers tightly linked to traits contributing to
drought tolerance from among 250 diverse rice germplasm of Assam in the ahu season. The
principal goal of association approaches is to determine the importance of various loci or
regions of the genome on the expression of single or multiple traits.
The 250 ahu rice cultivars were evaluated for various yield traits including Sahbhagi
Dhan, Dehangi and Banglami as drought-tolerant checks and IR64 and Lachit as susceptible
checks under two different hydrological conditions viz., irrigated control (Table 2) and
artificial drought stress (Table 1) created in rainout shelter during ahu season (February 2019
– July 2019) in the experimental fields of RARS, Titabar (Plate 1) following Augmented
Randomized Block Design (Federer, 1986).
For drought stress trial, seeds were hand dibbled in dry soil. After 45 days of
emergence, uniform plant stand was maintained by thinning and gap filling. However, under
irrigated (non-stress) conditions, 45-day old seedlings were transplanted in the main field. A
single seedling was transplanted with 20 cm spacing between the hills in the row. While the
control plots were irrigated regularly to the field capacity, the drought stress plots were
irrigated by sprinkler twice a week during establishment and early vegetative growth. The
drought stress was imposed during panicle initiation to panicle emergence period
(reproductive stage withholding irrigation). The plots were irrigated only when soil water
tension fell below -50kPa and moisture content to 10% at 30 cm of soil depth, which was
measured by TDR meter (Time domain reflectometry).
Scientific Report 13
DBT-NECAB Annual Report, 2018-19
Plate 1. Screening of 250 Ahu rice cultivars in rainout shelter at RARS, Titabor
Data on days to 50% flowering, number of tillers, number of productive tillers, plant
height, panicle length, spikelet fertility (Plate 3), total biomass, harvest index, grain yield per
plant (Plate 2), relative leaf water content (Plate 4) and leaf rolling score were recorded. Based
on overall characteristics 'Koni Ahu' was found to be the best performing line under drought
condition. As such, Koni Ahu can be used as a parental line in future drought breeding
programme.
Plate 2. Grain yield/plant in Ahu rice cultivar
Scientific Report 14
DBT-NECAB Annual Report, 2018-19
Plate 3. Spikelet fertility percentage in Ahu rice cultivar
Plate 4. Relative Leaf Water Content in Ahu rice cultivars under drought
Scientific Report 15
DBT-NECAB Annual Report, 2018-19
Table 1. Mean performance of accessions under Drought stress condition
TRAITS MEAN SD CV CD Min Value Max VALUE
DFF 100.30 13.03 1.20 1.74 78.00 144.00
PH 84.61 18.74 0.90 1.02 38.35 140.05
NOT 4.44 2.02 4.49 0.88 1.16 13.62
NPT 3.12 1.53 11.8 3.10 1.00 14.11
SF 26.72 9.41 15.7 6.10 6.52 49.45
HI 25.68 10.41 25.6 10.55 4.57 44.64
GYP 3.30 1.29 20.5 1.05 0.96 7.89
RLWC 40.89 13.42 1.30 0.79 21.76 84.02
TBM 13.66 4.45 10.2 1.88 7.76 41.05
PL 18.52 3.29 1.7 0.45 7.70 27.53
LR 3.50 2.16 - - 1.00 7.00
Table 2. Mean performance of accessions under Irrigated condition
TRAIT MEAN SD CV CD Min Value Max VALUE
DFF 107.69 11.38 1.6 2.4 80.00 138.00
PH 108.13 17.06 1 1.5 57.00 149.66
NOT 10.93 2.33 17 2.61 5.66 16.66
NPT 8.87 2.13 18.9 2.3 4.66 15.00
SF 70.07 15.43 9.5 9.41 16.04 94.91
HI 32.30 7.80 17 7.95 11.34 45.66
GY/P 9.28 3.11 12.5 1.66 4.27 22.80
RLWC 63.33 13.67 1.5 1.34 25.00 96.77
PL 22.96 3.19 1.5 2.4 14.00 31.33
TBM 30.30 11.72 23.4 9.94 11.72 86.87
DFF- Days to 50 per cent flowering, PH- Plant height (cm), NOT- number of tillers per plant, NPT –
number of productive tillers per plant, SF- Spikelet fertility(%), HI –Harvest index(%), GYP- Grain
yield per plant, RLWC- Relative leaf water content, PL- Panicle length(cm), TBM- Total biomass.
Genotyping of all the 250 ahu rice cultivars is being pursued through GBS. DNA samples have
already been sent for sequencing and data is awaited. Bioinformatic analyses will be carried out to
identify molecular markers tightly linked to QTL’s associated with character contributing drought
tolerance after one more season of phenotyping to get a more accurate result.
Identification of QTL’s for submergence tolerance through GBS
An experiment was designed to conduct submergence screening of different Sali varieties
during Kharif 2019. A total of 291 Sali germplasms from Kharif 2018 were collected from
Regional Agricultural Research Station, Titabar to be used in this study. Three tolerant checks
namely FR13A, Ranjit Sub1, Swarna sub 1 and 3 susceptible checks - Ranjit, IR42 and Swarna
DBT-NECAB Annual Report, 2018-19
Scientific Report 16
were used. They were allowed to germinate in a 10x10x2m submergence tank via the direct seeded
method. The experiment was set up in the Augmented Design with eight blocks (Plate 5 & 6)
consisting of 42 germplasm lines and checks. The checks were placed at random in each block.
After 20 days from the date of sowing, the germplasms were subjected to an initial submergence
stress of 8 days and the water level was maintained at 100cm. After the above-mentioned period
of stress, excess water was removed and the germplasms were then allowed to stay in the de-
submerged condition for 10 days. The plants were re-submerged for another period of 15 days.
This was followed by a de-submergence period of 10 days. The survival rate was recorded after
the second de-submergence period. Every germplasm lines and checks died out after the second
round of submergence except for two lines. Line no 89 (Plate 7) and line no 135 (Plate 8) were the
only lines that have survived. None of the checks has survived the second submergence stress.
Since there are only two extreme variants in the desired phenotype Marker-Trait
Association analysis is not feasible and we need to develop a bi-parental mapping population to
identify the submergence linked novel QTLs.
Plate 6: During the initial growing
phase just before the induction of stress
Plate 5: Preparation of sowing
Block in submergence tank
DBT-NECAB Annual Report, 2018-19
Scientific Report 17
Future line of work:
Molecular screening of both Line 89 and Line135 for Sub1 allele with FR13A and Ranjit
as tolerant and susceptible check respectably is being done. Line 89 and Line135 will be crossed
to a susceptible cultivar to develop bi-parental mapping population for mapping new QTL’s
followed by fine mapping of QTL’s to identify candidate gene.
a. Fine mapping of identified QTL’s:
Fine mapping and discovery of candidate genes associated with drought-tolerant traits are
important for the development of rice cultivar tolerant to low water stress. Here, by using a high-
resolution genetic map and genome-wide genetic variation detection aided by genome survey
sequencing, we aimed to fine map 7 (seven) already identified QTL's in the F2 generation and
discover candidate genes associated with drought-tolerant traits. F5 population derived from Ranjit
x Banglami was advanced to F6 generations plants. F6 population plants were grown in both
irrigated field condition (Plate 9) as well as drought stress condition in rainout shelter (Plate 10)
at RARS, Titabar. While the control plots were irrigated regularly to the field capacity, the drought
stress plots were irrigated by sprinkler twice a week during establishment and early vegetative
growth. The drought stress was imposed during panicle initiation to panicle emergence period
(reproductive stage withholding irrigation). The plots were irrigated only when soil water tension
fell below -50kPa and moisture content to 10% at 30 cm of soil depth. It was measured by TDR
meter (Time domain reflectometry).
Data on days to 50 per cent flowering, number of tillers, number of productive tillers, plant
height, panicle length, spikelet fertility, total biomass, grain yield per plant, leaf rolling and leaf
burning score were recorded.
Plate 7: Line 89 growing after the
second round of de-submergence
Plate 8: Line 135 growing after the
second round of de-submergence
DBT-NECAB Annual Report, 2018-19
Scientific Report 18
Plate 9. Screening of F6 population of a cross between Ranjit x Banglami in irrigated field condition
Plate 10. Screening of F6 population of a cross between Ranjit x Banglami in rainout shelter
Genotyping of these lines will be done through GBS. For this purpose, 190 lines from F6
population are being sent for sequencing. Single nucleotide variation among 200 lines will be
used for marker-trait association studies to finally fine map QTL’s.
Candidate gene identification - bioinformatics approach
The main aim of this study is to identify the likely candidate genes in the QTL's identified from
the F2 population of a cross between drought-tolerant line Banglami and susceptible line Ranjit.
For that purpose, the whole genome sequencing of the parents has been carried out. The
sequencing data generated using Oxford Nanopore and Illumina paired-end library from Ranjit
have already been assembled using a hybrid assembly approach (Plate 11) and the results are
given below:
N50: 9, 59,109
Number of scaffolds: 1295
Total Coverage: 401.87 Mb
DBT-NECAB Annual Report, 2018-19
Scientific Report 19
Plate 11: Sequence quality of Ranjit genome
For Banglami we already have some Illumina and 454 sequence data and some Oxford
Nanopore data is being generated. Once we have both the assemblies at hand, the regions
spanned by the QTLs identified by Verma et al. (2017) will be analyzed and probable candidate
genes will be flagged for validation in the wetlab.
Objective 2: Introgression of existing major water stress tolerance (drought and
submergence) and disease resistance (BLB and Blast) QTLs into the important rice
varieties of Assam.
a. Molecular breeding for Blast and BLB tolerance:
Jayamati is a popular Boro variety of Assam and Improved Ranjit (Ranjit-Sub1) is rapidly
replacing the mega variety Ranjit. However, both these varieties are susceptible to BLB and
Blast diseases. We already know that in Assam condition the genes xa5, xa13 and xa21 are
enough to counter the BLB disease. Almost 100 major blast resistant genes have been identified
and mapped among which Pi2 and Pi54 are the major genes which confer resistance to both
Neck Blast as well as Leaf Blast (Personal Communication with Dr Seshu Madhav, ICAR-
IIRR). An improved Samba Mahsuri line (MSM-BLBB) has been obtained from ICAR-IIRR
and parental polymorphism survey has been done across the parental lines using marker linked
to the 2 Blast and three BLB resistant genes to study the allelic distribution in the parents.
Foreground selection and Recombinant selection will be applied in F1, BC1F1 & BC2F1
populations. Background selection will be applied in BC1F1 and BC2F1 populations and self for
introgression of Pi54 and three BLB resistant genes xa5, xa13 and Xa21 into Jayamati and
Ranjit Sub1 background.
In RARS, Titabor, the boro rice variety, Jayamati was crossed with CB14001 for
introgression of BLB and blast resistance genes. All the F1 plants were germinated in the
greenhouse and allowed to screen for true F1 using foreground markers for Xa21, xa13 and xa5
Scientific Report 20
DBT-NECAB Annual Report, 2018-19
genes. It was found that only 4 plants (P-2, P-9, P-17 and P-22) out of 28 F1 plants showed
heterozygous banding pattern (Plate 12) and hence established the true F1 hybrids. Backcrossing
with Jayamati is being attempted in this Boro season to get BC1F1.
Plate 12: Gel picture of F1plants (Jaymati X CB14001) showing amplification of genes Xa21, xa13
and xa5. Where, L= 100bp ladder and red * indicate heterozygous band.
b. Molecular breeding for BLB, Drought and Submergence tolerance
Drought is one of the most important abiotic stresses causing drastic reductions of grain yield
in rainfed rice environments. Two popular short-duration rice varieties of Assam viz; Disang
and Luit were reported susceptible to biotic stress BLB and abiotic stresses drought and
submergence. These two varieties were crossed with IRBB60 to introgressed BLB resistance
genes Xa21, xa13 and xa5 and a BC2F2 population were developed (2014-2018). BC2F3
population were developed from BC2F2 (March 2019-august 2019). Foreground selection was
carried out in BC2F3 population plants. A total of 17 lines were found to be homozygous positive
for all the three BLB resistance genes xa5, xa13, and Xa21 as shown in plate 13, plate 14 and
plate 15 respectively.
Scientific Report 21
DBT-NECAB Annual Report, 2018-19
To identify best lines for further release of BLB resistance variety, phenotypic evaluation
of selected 17 homozygous lines were done in BC2F3 generation. Out of 17 homozygous lines
only 13 lines properly germinated in the field. These lines were grown in the experimental field
of ICR farm and allowed to self for the generation of B2F4 lines along with the selection of
better plants with good agronomic traits. Grain quality parameter will be done after harvesting
of plants. For the determination of yield penalty under biotic stress condition pathological
screening in required, however, pathological screening was not conducted in the same field for
evaluating phenotypes and hence, will be done in next season in a separate field of RARS,
Titabor, specially designated for pathological screening.
For successful development and release of BLB resistance rice variety, phenotypic
Plate 13. Screening of homozygous plants for xa5 gene M= 100bp ladder, 1=
IRBB60, 2= Luit, 3=Disang, 4-40=BC2F3 plants
Plate 14. Screening of homozygous plants for xa13 gene M= 100bp
ladder, 1= IRBB60, 2= Luit, 3=Disang, 4-43=BC2F3 plants
Plate 15. Screening of homozygous plants for Xa21gene M= 100bp
ladder, 1= IRBB60, 2= Luit, 3=Disang, 4-41=BC2F3 plants
Scientific Report 22
DBT-NECAB Annual Report, 2018-19
evaluation of agronomic traits is required. The phenotypic evaluation of plant height (Table 3)
determined that all the 13 selected line showed shorter height than their parents with the
minimum value of 46.5 cm in line L-24 whereas the maximum of 64.5 cm in line L-16. The
average lowest plant height of 50.5 cm in line L-11 and maximum of 61.42 cm in line L-23.
The characteristic of Panicle length (Table 4) showed the lowest value of 13 cm in line L-11
and D-73 while a maximum of 21.5 cm in line L-23. The average maximum of 17.96 cm in L-
29 and a minimum average of 14.5 cm in L-11. The characteristic of number of tillers (Table
5) showed the lowest value of 5 tillers in L-24 and maximum of 20 tillers in L-23 the minimum
average of 9 tillers in L-11 and a maximum average of 12.67 tillers in L-23 and L-24. Similarly,
the characteristic of an effective number of tillers (Table 6) showed a minimum number of 4
tillers in L-12 and the maximum number of 11 tillers in L-25. The minimum average of 6 tillers
in D-73 and a maximum average of 14.33 tillers in L-25. From these results, we will select the
best plant showing good plant type along with greater grain quality and allowed to self for the
generation of BC2F5 Plants.
Table 3. Phenotypic evaluation of Plant height
Cultivar Min Max Mean SD CV
Disang 60 73 67.83 4.435 6.54%
Luit 60 75 70.08 5.435 7.76%
IRBB60 68 83 76.67 5.279 6.89%
L11 47.5 54 50.5 3.279 6.49%
L12 49.5 57 53.58 2.746 5.13%
L16 50 64.5 55.58 4.944 8.89%
L17 61 64 62.5 1.5 2.40%
L21 58 63.5 60.33 2.229 3.69%
L22 51 59 54 4.359 8.07%
L23 54.5 67 61.42 5.219 8.50%
L24 46.5 59 56.33 5.017 8.91%
L25 54 60 57.75 2.185 3.78%
L26 55 66 59.85 4.406 7.36%
L27 54.5 62.2 57.27 2.738 4.78%
L29 56 67 60.5 3.834 6.34%
D73 59.5 63 61.17 1.756 2.87%
Scientific Report 23
DBT-NECAB Annual Report, 2018-19
Table 4. Phenotypic evaluation of Panicle length
Cultivar Min Max Mean SD CV
Disang 15 18 16.5 1.265 7.67%
Luit 15.5 20 17.67 1.571 8.89%
IRBB60 16 20.5 18.15 1.648 9.08%
L11 13 15.5 14.5 1.323 9.12%
L12 14 17 15.8 1.175 7.44%
L16 16 20 17.5 1.414 8.08%
L17 15.5 19 17 1.803 10.60%
L21 15.25 20 17.21 1.631 9.48%
L22 14.5 18 16.17 1.756 10.86%
L23 13.5 21.5 18 2.66 14.78%
L24 14.5 19.5 17 1.732 10.19%
L25 14.5 19 17.25 1.782 10.33%
L26 15.5 20 17.58 1.882 10.70%
L27 13.5 18 16.63 1.701 10.23%
L29 15.5 21 17.96 2.193 12.21%
D73 13 17 14.67 2.082 14.19%
Table 5. Phenotypic evaluation of Number of Tillers
Cultivar Min Max Mean SD CV
Disang 9 22 15.5 4.764 30.74%
Luit 6 13 9.333 2.422 25.95%
IRBB60 8 20 14.33 4.59 32.02%
L11 8 10 9 1 11.11%
L12 7 15 9.667 3.327 34.41%
L16 8 18 12.5 4.135 33.08%
L17 6 15 11 4.583 41.66%
L21 9 16 12.17 2.317 19.04%
L22 6 17 12.67 5.859 46.26%
L23 8 20 12.67 4.082 32.23%
L24 5 18 11.5 5.089 44.25%
L25 11 19 15 2.757 18.38%
L26 6 11 8.333 2.251 27.01%
L27 7 14 10.17 2.317 22.79%
L29 8 11 9.5 1.225 12.89%
D73 7 9 8.333 1.155 13.86%
Scientific Report 24
DBT-NECAB Annual Report, 2018-19
Table 6. Phenotypic evaluation of Effective Number of Tillers
Cultivar Min Max Mean SD CV
Disang 9 20 15.17 4.262 28.10%
Luit 6 12 9.167 2.137 23.31%
IRBB60 8 19 13.5 3.987 29.54%
L11 7 9 8 1 12.50%
L12 4 12 7.5 2.811 37.48%
L16 8 18 11.83 4.167 35.22%
L17 6 13 9.667 3.512 36.33%
L21 9 16 12 2.28 19.00%
L22 5 17 12.33 6.429 52.13%
L23 8 20 12.33 4.033 32.70%
L24 5 16 10.67 4.179 39.18%
L25 11 17 14.33 1.966 13.72%
L26 6 11 8.167 2.041 24.99%
L27 7 13 9.833 1.941 19.74%
L29 7 11 8.333 1.506 18.07%
D73 5 7 6 1 16.67%
To develop both abiotic and biotic stress tolerance rice variety, efforts were made to
introgressed submergence and drought tolerance QTLs into BLB resistance genes pyramided
rice lines of variety Luit and Disang. The crosses are being made between three BLB gene
homozygous lines from (Luit x IRBB60 and Dishang x IRBB60) and donor of submergence
and drought tolerance, CR DHAN-801. Initial screening as well as polymorphism studies for
SUB1 gene and Drought tolerant QTL’s qDTY1.1, qDTY2.1, qDTY3.1 is done in donor CR
Dhan 801 and also in two parental lines Luit and Dishang using QTL linked markers (Table 7,
Plate 16). Foreground and recombinant selection will be applied in F1, BC1F1 & BC2F1
populations. Background selection will be applied in BC1F1 and BC2F1 populations and self to
introgressed Sub-1 and qDTY1.1, qDTY 2.1, qDTY3.1 into Luit and Disang background.
DBT-NECAB Annual Report, 2018-19
Scientific Report 25
Table 7. List of QTL linked markers for foreground and recombinant selection.
QTLS linked Marker Forward primer Reverse primer
qDTY1.1 RM315 GAGGTACTTCCTCCGTTTCAC AGTCAGCTCACTGTGCAGTG
RM11943 CTTGTTCGAGGACGAAGATAGGG CCAGTTTACCAGGGTCGAAACC
RM431 TCCTGCGAACTGAAGAGTTG AGAGCAAAACCCTGGTTCAC
RM12023 TGCGTACCTCTGCTCCTCTCTGC GACGAAGCCGACCAAGTGAAGC
RM12233 CTTGAGTTCGAAGCGAGAAGACG CACTTGAGCTCGAGACGTAGCC
qDTY2.1 RM5791 GAAGCAGAATACGCTTTCGC ACGTCACAAAGGGTTCTTGC
RM327 CTACTCCTCTGTCCCTCCTCTC CCAGCTAGACACAATCGAGC
RM521 TTCCCTTATTCCTGCTCTCC GGGATTTGCAGTGAGCTAGC
RM3549 GATCCTCCACACCCAACAAC AACGAACGACCAACTCCAAG
RM324 CTGATTCCACACACTTGTGC GATTCCACGTCAGGATCTTC
RM6374 TGAGGACGCTGATTGTCAAC GCTGCCCCTATTATTTCACC
RM424 TTTGTGGCTCACCAGTTGAG TGGCGCATTCATGTCATC
qDTY3.1 RM15791 AGTAAGTTTGCCGCGGAGGAAGC CTCCTTGTCGATCACCACCATCG
RM416 GGGAGTTAGGGTTTTGGAGC TCCAGTTTCACACTGCTTCG
RM16030 GCGAACTATGAGCATGCCAACC GGATTACCTGGTGTGTGCAGTGTCC
RM520 AGGAGCAAGAAAAGTTCCCC GCCAATGTGTGACGCAATAG
Sub1 ART5 CAGGGAAAGAGATGGTGGA TTGGCCCTAGGTTGTTTCAG
Plate 16. Parental polymorphism survey was done across the parental lines using markers linked to
QTL 1.1, QTL 2.1, QTL 3.1 and Sub1 Where, M=100bp ladder, 1=CR DHAN 801, 2=Luit, 3=Dishang
Publications:
No recent publications yet.
Scientific Report: 27
DBT-NECAB Annual Report, 2018-19
Programme Objective II
Objective: Genetic improvement of chickpea using gene technology for insect resistance
Rationale:
Helicoverpa armigera is a significant insect pest of chickpea, causing complete damage to
the crop under favorable conditions for insect infestation. In proof-of-concept studies, we
optimized the genetic engineering method for chickpea and established several (>150)
transgenic lines expressing either Cry1Ac or Cry2Aa and selected lines based on their level of
expression, copy number, and insect mortality. The lines were incorporated into an
introgression breeding program at Punjab Agricultural University, Ludhiana; University of
Agricultural Sciences, Dharwad and The Sungro Seeds, New Delhi.
The lines expressing high levels (>50 ng/µg FW) of the Cry1Ac gene were resistant to
Helicoverpa. The phenotypes of the homozygous progeny were similar to the non-transgenic
counterpart. The lines expressing high levels (>120 ng/µg FW) of the Cry2Aa gene conferred
complete resistance; however, there was fitness cost associated with the level of expression.
Therefore, we plan to redesign the constructs to alleviate the phenotypic drag by targeting the
protein to plastid using a plastid transit peptide.
In India, Bollgard I (harbours cry1Ac gene) and II (harbours Cry1Ac and Cry2Ab genes)
cotton have been planted over a decade now; therefore, it is unlikely that chickpea having a
single Bt gene would be deregulated due to growing concerns about the evolution of resistance
in the Helicoverpa. The best options available to us for enhanced Insect Resistance
Management (IRM) in the field are; (a) pyramiding multiple Bt genes in chickpea by inserting
multiple Bt transgene cassettes, or (b) use breeding stacks the introgression breeding of different
Bt lines with different modes of action to Helicoverp
Under Phase- II (DBT-NECAB) of our programme, we aimed to generate pyramided IR
chickpea having both Cry1Ac and Cry2Aa genes in a single locus in the genome. We also
initiated a detailed characterization of selected Bt chickpea lines generated in the Phase-I (DBT-
AAU Centre). We determined the levels of Bt gene and selectable marker gene in various
tissues, presence of any vector backbone sequences, including the nutritional composition of
seeds compared to their non-transgenic counterpart.
DBT-NECAB Annual Report, 2018-19
Scientific Report: 28
Specific Objectives of Phase-II
I. Development of transgenic chickpeas using various versions of Bt genes (Cry1Ac, Cry2Aa,
and Vip) to confer protection against pod borers.
II. Generate information to T-DNA flanking sequences, levels of transgenic protein(s),
transgene(s) stability and transmission, homozygosity, and phenotype of lines
III. Collaborate with public partners within India and its neighboring countries for
introgression breeding programs and biosafety assessments using stable Bt-chickpea lines
to identify lines for evaluation through BRL trials.
Progress of Phase-II
a. Redesigning of chloroplast targeted Bt gene constructs for IR chickpea
When a codon-optimized Cry2Aa gene was expressed in chickpea cytosol we observed
abnormalities in plant development and fertility (Acharjee et al. 2010). Therefore, we have
resynthesized Cry2Aa gene to target it to plastids using a chloroplast transit peptide (CTP).
The chloroplast-targeting sequence, CTP, from the Arabidopsis Rubisco SSU 1A gene was
previously described (Wong et al., 1992). The CTP element consisted of the 55-amino acid
SSU chloroplast-targeting sequence plus the N-terminal 24 amino acids of the Rubisco SSU
protein. The native transit peptidase cleavage site at the junction of the targeting sequence and
the SSU sequence was preserved, and a second peptidase cleavage site with the CTP. The
sequence was ligated at the 5’ end of the Cry2Aa gene. A binary vector named pBK212 was
created having chloroplast targeted Cry2Aa gene driven by Arabidopsis Rubisco SSU 1A gene
promoter and Tobacco SSU gene terminator.
A second construct was also designed having the Cry2Aa gene cassette of pBK212 and a full-
length Cry1Ac gene regulated by CaMV 35S promoter. Both Bt genes were targeted to the
plastids using the above CTP sequences. The full-length Cry1Ac gene was used to enhance
the expression and also to ease the regulatory hurdles because commercial Bt soybean has a
full-length Cry1Ac gene targeted to plastid.
Fig. 1. Chloroplast targeted Cry gene expression cassette for the generation of Insect Resistant
(IR) chickpea
DBT-NECAB Annual Report, 2018-19
Scientific Report: 29
The above constructs (Fig. 1) were electroporated into Agrobacterium strain, AGL1 and used
for infiltration in Nicotiana benthamiana leaves to detect the transient expression of the Bt
genes and the selectable marker gene, nptII. After agroinfiltration leaves were collected and
total proteins were extracted for quantification by ELISA (Agdia Kits). We have observed the
expression of Bt genes and nptII gene in the N. benthamiana leaves (Table 1). The constructs
are now being used for the generation of transgenic chickpea lines.
b. Generation of Bt chickpea lines
The genetic transformation of chickpea was carried out using both existing and new constructs.
So, far we have established a few transformed lines using existing pBK203 (truncated
Cry1Ac) and pBK209 (full-length Cry1Ac gene driven AraSSU promoter) binary vectors,
respectively (Table 2). The highest (51 ng/ µg FW) level of expression of the full-length
Cry1Ac gene was recorded in the line 19-91A.
Table 2: Characterization of lines generated using pBK203 and pBK209
Sl.
No
Line Name
Construct PCR ELISA
Cry1Ac
1 19-83A pBK203 + 11.2
2 19-83C pBK203 + 0
3 19-82A pBK209 + 31.5
4 19-82D pBK209 + 15.0
5 19-91A pBK209 + 51.0
We have generated lines using the 2Bt gene construct pBK213 and performed molecular
analyses in a few lines to know the presence of transgene and levels of Bt proteins (Table3).
The line 19-86B expressed high both Cry1Ac and Cry2Aa compared to other lines established.
The generation of more chickpea transgenic lines using pBK213 is in progress.
Table 1: Agroinflitration of N. benthamiana followed by ELISA to quantify transient
protein expression
Constructs Protein concentration (ng/µg FW)
Cry2Aa Cry1Ac nptll
pBK212 28.0 - 0.368
pBK213 10.2 50.9 0.450
DBT-NECAB Annual Report, 2018-19
Scientific Report 30
Table 3: Characterization of lines generated using pBK213
c. Detailed molecular characterization of existing chickpea lines
i. Concentrations of Cry 1Ac and nptII protein in transgenic chickpea
The concentration of the transgenic proteins (Cry1Ac and nptII) was determined by the
Enzyme-Linked Immunosorbent Assay (ELISA). Total leaf proteins were isolated from the
homozygous Cry1Ac. The samples of leaf, flower, stem, pod, green cotyledon and dry seeds
were collected from the homozygous Cry1Ac and total proteins were extracted and used for
ELISA.
The highest level of Cry1Ac protein was detected in the flowers (100B; 94.5 µg/ g FW, and
100E; 126 µg/ g FW) followed by leaves (100B; 88 µg/ g FW, and 100E; 120 µg/ g FW). The
accumulation of Cry1Ac protein was found immature pods and stem, while very low levels of
Cry1Ac protein was detected in the roots and dry seeds (Table 4).
Table 4. The concentrations of Cry1Ac protein accumulation in the various tissues
of transgenic chickpea lines, 100B and 100E
Tissue Samples Cry1Ac protein (µg/g FW)
100 B 100E
Leaf 88 120
Stem 23 35
Flower 94.5 126
Pod 23 15
Immature Cotyledons 41 62
Root 0.22 0.54
Dry Seeds 1.1* 3.15*
*The concentration in the dry seed is calculated as microgram per gram of dry weight.
Sl.No Line
Name
PCR ELISA
Cry1Ac Cry2Aa
1 19-92A + 3.6 0
2 19-90C + 5.2 1.7
3 19-85A + 3.8 4.8
4 19-85H + 1 1.5
5 19-86B + 30 12.3
6 19-82A + 1.4 1.7
7 19-98B + 1.6 1.7
8 19-104D + 7.9 6.2
9 19-90E + 5.2 4.26
Scientific Report 31
DBT-NECAB Annual Report, 2018-19
The average concentrations of the nptII protein in the various tissues of transgenic lines were
determined. The highest nptII protein was detected in stem ranging from 0.33 to 0.45 µg/ g FW.
The nptII protein was not detected in pods, immature cotyledons and roots; however, the nptII
protein accumulated in the dry seeds (Table 5).
Table 5. The concentration of nptII protein in the various samples of transgenic
chickpea lines
Tissue samples NptII protein
(µg/g FW)
100B 100E 39C 40D
Leaf 0.329 0.302 0.241 0.316
Stem 0.413 0.459 0.332 0.359
Flower 0.368 0.150 0.264 0.115
Pod 0 0 0 0
Immature Cotyledons 0 0 0 0
Roots 0 0 0 0
Dry seeds 0.250 0.280 0.262 0.261
*The concentration in the dry seed is calculated as microgram per gram of dry weight.
ii. Presence of plasmid backbone sequences in the chickpea genome
A Southern Blotting was carried out using DNA from the transgenic lines to demonstrate the
lack of integration of any plasmid backbone sequence, including the sequences between the two
T-DNAs (Fig 2) in the transgenic lines. The DNA from each line was digested with EcoRI
restriction enzyme followed by separation of fragments in a gel and transferred to a nylon
membrane. The probe from the junction region between the twin T-DNA junction, a segment
of 1029 bp was used for hybridization. The Southern blot showed a hybridization of the probe
to the positive sample (plasmid DNA of pBK203). However, there was no hybridization of the
probe to the transgenic lines (Fig 3), which confirmed the lack of integration of any sequences
from the junction region. A positive sample containing the plasmid DNA of pBK203 showed a
hybridization of the probe of the expected size.
DBT-NECAB Annual Report, 2018-19
Scientific Report 32
Fig. 2
Figure 2. The region between the two T-DNAs of the binary plasmid, pBK203. The
region between the two T-DNA was 1029 bp, and a probe was designed from this
region to demonstrate lack integration of any sequences from this region
Fig. 3 The genomic DNA isolated from the parental line, Jimbour (J) and transgenic lines,
100B (B) and 100E (E) were digested with EcoRI enzymes followed by separation of fragments
in a gel and transfer to a nylon membrane. A probe of 1000 bp was used for hybridization with
the blot
The probe for hybridization with the membrane was generated by PCR and amplicons
having overlapping fragments of the vector backbone sequence were used as a probe (Fig.
4). When the DNA was hybridized with the backbone probe, no hybridization of the probe
was detected in both the Cry1Ac lines confirming a lack of integration of vector backbone
sequences (Fig 5 A and B). A positive sample containing plasmid DNA of pBK203 (Fig
5A) and pRM50 (Fig 5B) showed hybridization of the probe to the expected size fragment
of plasmid DNA.
DBT-NECAB Annual Report, 2018-19
Scientific Report 33
Fig 4. Map showing the vector backbone probe used for the Southern Blot hybridization for
both Cry1Ac (pBK203) and αAI (pRM50) lines
A B
Fig. 5 Southern blot to confirm lack of integration of vector backbone sequence in the
transgenic chickpea lines (A)The genomic DNA isolated from the parental line, Jimbour
(J) and transgenic lines, 100B (B) and 100E (E) were digested with EcoRI enzymes followed
by separation of fragments in a gel and transfer to a nylon membrane. PCR amplicons of
the vector backbone were used as a probe to hybridize with the blot. (B) The genomic DNA
isolated from the parental line, Semsem (S) and transgenic lines, 39C and 40D were
digested with EcoRI enzymes followed by separation of fragments in a gel and transfer to a
nylon membrane. PCR amplicons of the vector backbone were used as a probe to hybridize
with the blot.
pRM50 binary
16177 bp
nptII
tetA (tet Resistance)
trfA CDS
alphaAI-1 CDS
oriV region
oriT region
LB sequence
RB sequence
PHA 5'
SCSV 7 promoter
Vic ilin 3'
PHA 3' terminator
EcoRI (492)
DBT-NECAB Annual Report, 2018-19
Scientific Report 34
iii. Nutritional composition of transgenic chickpea seeds
Transgenic chickpeas expressing high levels of a truncated version of the cry1Ac (trcry1Ac)
gene conferred complete protection to Helicoverpa armigera in the glasshouse. Homozygous
progeny of two lines, Cry1Ac.1 and Cry1Ac.2, had similar growth and other morphological
characteristics, including seed yield, compared to the non-transgenic counterpart; therefore,
seed compositional analyses were carried out. These selected homozygous chickpea lines were
selfed for ten generations along with the non-transgenic parent under contained conditions
(greenhouse). Comparative nutritional assessment, seed storage proteins profiling, and in-vitro
protein digestibility were performed to assure that these lines are as safe as the non-transgenic
chickpea. Our analyses showed no significant difference in primary nutritional composition
between transgenics and non-transgenic chickpeas. In addition, the seed storage protein profile
also showed no variation between these chickpea samples. Seed protein digestibility assays
using the simulated gastric fluid revealed a similar rate of digestion of proteins from the
transgenic trCry1Ac lines compared to the non-transgenic line. Thus, our data suggest no
potential unintended effects due to the expression of the trcry1Ac gene on the nutritional
composition of transgenic chickpea seeds expressing a trcry1Ac gene.
In the previous report, we have compiled the data on proximates, seed storage protein, amino
acids and vitamins. Now we data on fatty acids and isoflavones composition has of homozygous
Bt chickpea lines (BS100B, BS100E) expressing high levels of Cry1Ac gene. Individual fatty
acids and isoflavones contents of lines were quantified concerning their non-transgenic
chickpea (control) seeds by the GC-MS analysis, where values >2.5 or <0.5 significantly high
or low fatty acids compared to non- transgenic line. In all 15 fatty acids, that included both
saturated and unsaturated fatty acids (Table 6) were identified and quantified along with
various isoflavones (Table 7) line relative to the non-transgenic chickpea seeds and levels were
both fatty acids and isoflavones were found to be similar to the non-transgenic parental lines.
DBT-NECAB Annual Report, 2018-19
Scientific Report 35
Table 6: Summary of results of relative quantification of fatty acids
Fatty Acids BsS100B vs
Control
BS100E vs
Control
Lauric Acid 0.704 0.7705
Myristic Acid 0.735 0.529412
Palmitic Acid 0.638 0.48936
Palmitoleic Acid 0.714 0.54762
Stearic Acid 1.101 0.4932
Oleic Acid 1.617 0.65957
Lineloic Acid 0.871 0.548387
Linolenic Acid 4.54 5.0
Arachidic Acid (Eicosanoic) 0.53 0.54
Gadoleic (Eicosenoic Acid) 0.88 2
Eicosadienoic acid 1.104 0.8
Behenic Acid 1.4324 1.4865
Erucic Acid 1.48936 1.404255
Lignoceric Acid 0.56716 1.791
Nervonic Acid 1.1538 1.5
Table 7: Summary of results of relative quantification of isoflavones
Isoflavones BS100B vs Control BS100E vs Control
Biochanin A 0.5556 0.555
Formononetin 1.789 0.684
Daidzein 0.714 0.548
Genistein 0.452 0.704
Matairesinol 0.665 0.765
iv. Progress made introgression breeding of existing lines
Marker-Assisted backcross breeding was performed to introgress Cry1Ac Gene from
transgenic chickpea lines into cultivated chickpea varieties, PBG 7 (desi) and L 552 (kabuli)
for resistance to Helicoverpa armigera. In 2014, the breeding program started and currently,
the BC3F2 population was raised and both foreground (Fig. 6) and background selection was
carried out to identify the desired plants. In 2019, a total of 10 progeny (Fig. 6; samples
highlighted with red color) were selfed to raise the BC3F2 population.
DBT-NECAB Annual Report, 2018-19
Scientific Report 36
Milestone set for the following year
Chickpea
1. Detail molecular characterization of new and existing lines
2. Identification of putative homozygous lines
3. Cloning of Vip3 gene for the introduction of the third gene in chickpea
Publications:
• Rabha M., Acharjee S., Sarmah B. K. (2018). Multilocus sequence typing for
phylogenetic view and vip gene diversity of Bacillus thuringiensis strains of the Assam
soil of North East India. World Journal of Microbiology and Biotechnology. 34.
10.1007/s11274-018-2489-5.
• Konwar T., Borah B., Handique A., Acharjee S., Sarmah B. K. (2018). An efficient in
vitro regeneration protocol to generate stable transgenic lines of black gram (Vigna
mungo L.). Indian Journal of Genetics and Plant Breeding. 78. 324-332.
10.31742/IJGPB.78.3.10.
• Meitei A. M., Bhattacharjee M., Dhar S., Chowdhury N., Sharma R., Acharjee S.,
Sarmah B. K. (2018) Activity of defense related enzymes and gene expression in
BC2F
2 Population : PBG 7 x BS 100B-T
5
Fig 6. PCR analysis using gene specific primers L: Ladder (50 bp); P
1: PBG 7, P
2: BS 100E-T
5; 1-83 BC
2F
2 plants;
757
bp
Scientific Report 37
DBT-NECAB Annual Report, 2018-19
• pigeon pea (Cajanus cajan) due to feeding of Helicoverpa armigera larvae, Journal
of Plant Interactions, 13:1, 231-238, DOI: 10.1080/17429145.2018.1466373
• Hazarika N., Boruah R. R., Handique P. J., Acharjee S., Sarmah B. K. (2019)
Reconstruction and validation of three different binary vectors suitable for generation
of genetically engineered Helicoverpa protected crops. Indian Journal of Genetics and
Plant Breeding. 79(1): 104-108. DOI: https://doi/10.31742/IJGPB.79.1.15
• Hazarika N., Acharjee S., Boruah R. R., Babar K., Parimi S., Char B., Armstrong J.,
Moore A., Higgins T. J. V., Sarmah B. K. (2019) Enhanced expression of Arabidopsis
rubisco small subunit gene promoter regulated Cry1Ac gene in chickpea conferred
complete resistance to Helicoverpa armigera. Journal of Plant Biochemistry and
Biotechnology.DOI:10.1007/s13562-019-00531-1
• Vasantrao J. M., Baruah I. K., Panda D., Bhattacharjee M., Acharjee S., Sarmah B. K.
(2019) Transcript profiling of chickpea pod wall revealed the expression of floral
homeotic gene AGAMOUS-like X2 (CaAGLX2). Mol Biol Rep. 2019
Dec;46(6):5713-5722. doi: 10.1007/s11033-019-05005-0
Scientific Report 39
DBT-NECAB Annual Report, 2018-19
Programme Objective III
Objective: Bioprospecting of soil microbes from acidic soils of N E region
Background and Rationale:
The rationale for this proposal is that gene(s) harbored by the soil bacteria that thrive in
acidic stress soil conditions are good candidates for development of efficient microbial
inoculum for organic farming and engineer plants to adapt themselves to the climate changes
anticipated in the 21st century. Acid soil condition is a major challenge for plant growth and
agricultural productivity in the northeast India. This challenge is further expected to exacerbate
in light of the expansion of agricultural activities in marginal areas, crucial in meeting the
growing food demands.
It is clear that genetic mechanism exists in the bacteria’s that enable them to survive and
function in acid soil stress condition. Our approaches in the first phase of the project have
resulted in: 1) A core set of bacterial population and identification of a model bacteria that has
developed strategies to thrive and survive in acid soil condition 2) Establishing the proteome
and transcriptome dynamics in Bacillus megaterium cells in response to acidic condition 3)
Identifying proteins and genes that are up-regulated/down regulated when challenged with acid
stress. The information revealed so far from our initial studies reflects the quantity and
amplitude of the genome level changes both at transcription and translation levels and further
analysis is needed to understand which specific genes or networks are modulated. Based on our
results we envision a need to integrate the “Omics” data sets to identify and validate the
prospected gene(s) and proteins involved with acid soil stress resistance by expression profiling
through quantitative real-time PCR followed by functional validation of potential acid-
tolerance genes. Until recently, understanding the regulatory behavior of cells was pursued
through independent analysis of the transcriptome or the proteome. Based on the central dogma,
it was generally assumed that there exists a direct correspondence between mRNA transcripts
and generated protein expressions. However, recent studies have shown that the correlation
between mRNA and protein expressions can be low due to various factors such as different
half-lives and post transcription machinery. A myriad of sensor networks, signaling molecules
and regulatory proteins are involved in pH homeostasis as well as in overlapping homeostatic
responses to sodium, osmotic, cell wall and reactive oxygen stresses. These networks typically
involve multiple transcription regulators, alternative RNA polymerase σ-factors and various
DBT-NECAB Annual Report, 2018-19
Scientific Report 40
DNA-binding proteins. Thus, a joint analysis of the transcriptomic and proteomic data can
provide useful insights that may not be deciphered from individual analysis of mRNA or protein
expressions.
Aluminium and iron are two major elements that accumulate in toxic levels in acidic soils
and affect crop growth. Under highly acidic soil conditions (pH<5.0), Al is solubilized into the
soil solution as Al3+. This is highly phytotoxic leading to stunted root system that inhibits both
water and nutrients uptake by the plant. Iron toxicity commonly occurs in a wide range of acid
soils, particularly in lowland rice with permanent flooding. Excess concentration of reduced
iron (Fe2+) results in a range of nutrient disorders and results in deficiencies of other major and
micro nutrients. Aluminum and iron toxicity are regarded as major concerns of low rice
productivity in lowland acid sulfate soils.
The ability of bacteria to tolerate different abiotic stress especially Al have received the
attention of scientific community and been used to improve plant growth under stress condition.
In the phase I of the project, we screened over 200 bacterial isolates for their plant growth
promotion properties both qualitative- and quantitatively and observed that the pH of the
medium had influence on the functionality of the isolates. The PGP activities of the isolates at
acidic pH reduced significantly (P≤0.05) compared to that of neutral pH. During that phase we
also identified a bacterial isolate Bacillus subtilis, B9 that could tolerate high concentration of
AlCl2 (10mM) and FeCl3 (6mM). In addition, the isolate also had several plant growth attributes
including phytohormone secretion, phosphate solubilization. We aim to use this isolate to test
its ability to ameliorate acid soil and its associated stress condition for crops.
The study of plant–microbe interactions is an important approach to improve agricultural
productivity under abiotic stress such as the acidic soil condition. Plant growth and ability to
tolerate abiotic stress condition is largely influenced by the interaction of the plant with
microbes as evident by the growing number of publications in this area. Microbial communities
and plants have coevolved to form diverse and complex associations that besides providing
mutual benefits also aid in ameliorating abiotic stress in plants. Deciphering the cross-talk
between the microbe and the response of plant during abiotic stress will serve as an important
resource to design the crop plants for productivity in a sustainable manner in marginal lands
under variable climatic conditions. Keeping the above facts in view, the following objectives
were formulated to continue in the next phase of research:
DBT-NECAB Annual Report, 2018-19
Scientific Report 41
Specific Objectives:
1. Integrate proteomic and transcriptomic analyses from Phase I to identify genes
involved with acid stress
2. Functional validation of the differentially expressed genes (from Phase I)
3. Study the growth promotion and abiotic stress (acid and associated stress-Al,
Fe) alleviation ability of the acid and Al tolerant native bacterial isolates
(characterized in the phase I of the project) on crop plant under those stress
condition
4. Decipher the cross-talk between the bacterial isolates and the plant
during acidic and its associated stress condition
Achievements: Generation of mutants:
Homologous recombination-based gene disruption mutation in Bacillus species was
created through the integration vector pMUTIN4 (Bacillus Genetic Stock Centre, BGSC). The
pMUTIN4 vector was cleaved with restriction enzymes BamHI and HindIII at their respective
restriction sites present in the multiple cloning site (MCS). Partial sequences of the target genes
were amplified with gene specific primers containing terminal restriction sites for BamHI and
HindIII restriction sites. Amplified PCR products were also restriction digested as described
above, and ligated into the pMUTIN4 vector. The ligated plasmids were cloned into
Escherichia coli JM109. Plasmids from the screened positive clones were extracted and
transformed into B. megaterium or B. amyloliquefaciens cells as per the standard protocol of
BGSC. Mutants of B. megaterium were generated for proA and proC gene related to proline
biosynthesis, metABC transporter of methionine. Mutant of B. amyloliquefaciens also
generated for cupin gene related to cell wall remodeling
Deciphering the role of proline in conferring acid tolerance to B. megaterium G18
Measurement of extracellular and intracellular proline content of B. megaterium was
performed under normal and acid stress conditions. Bacterial cells were grown in minimal
media with pH 7.0 or pH4.5. Extracellular and intracellular proline concentration significantly
increased in pH 4.5 indicating high production of proline during acid stress condition.
DBT-NECAB Annual Report, 2018-19
Scientific Report 42
Extracellular proline concentration Intracellular proline concentration
Fig. 1 Extracellular and intracellular proline content in B. megaterium during normal and acid stress
conditions.
To confirm the role of proline in acid stress tolerance of B. megaterium, the growth
characteristics of knock-down mutants for the genes proA and proC were studied during acid
stress condition. Bacillus megaterium G18 wild type was used as control. The mutants were
unable to survive in acid stress condition due to the disruption of the proline biosynthetic
pathway, whereas the wild type tolerated acid stress. However, the mutants showed similar
growth pattern as the wild type upon supplementation of 1mM proline to the culture medium
(Fig.1).
Growth characteristics of B. megaterium ΔproC (BM13A) in minimal media under
different osmoticum (proline, glutamate, mannitol and sorbitol) were also tested. The results
indicated that the ΔproC cells were able to grow in presence of proline and glutamate as
compared to the wild type cells; however, the growth rate was slow in presence of glutamate.
No growth was recorded in presence of mannitol and sorbitol (Fig. 2 D).
DBT-NECAB Annual Report, 2018-19
Scientific Report 43
Fig. 2 Growth characteristics of B. megaterium wild type and mutants for proline biosynthesis in acid
stress condition
Validation of extracellular proline production
Bacillus megaterium ΔproA and ΔproC cells were used for validation of extracellular
proline production. The BM WT cells were grown on minimal media of pH 4.5 for 16 h. The
supernatant was collected through centrifugation and filter sterilized through 0.22 µm syringe
filter. The filtered supernatant was used to study the growth characteristics of B. megaterium
ΔproA and ΔproC cells. The cells grown in supernatant of BM WT cells (under acid stress
condition) showed normal growth characteristics in 5 h (Fig. 3). Bacillus megaterium ΔproA
and ΔproC cells grown in proline supplemented minimal medium (pH 4.5) were used for
comparison. The results suggested that extracellular proline production by BM WT cells
supplemented the culture supernatant which could be utilized by the ΔproA and ΔproC cells
under acid stress condition.
Fig. 3 Growth characteristics of B. megaterium ΔproA and ΔproC when cultured in proline
supplemented minimal medium or proline rich culture supernatant.
DBT-NECAB Annual Report, 2018-19
Scientific Report 44
Effect of sulfur on the growth of B. megaterium G18 under acid stress
A single colony of each B. megaterium wild type and B. megaterium ΔmetABC (BM5) cells was
inoculated in NB in separate conical flask and grown at 30°C until the OD600 reach 1.0. Cells were
subsequently diluted with fresh NB and minimal media-lacking S-source and adjusted to pH 4.5 and pH
7.0. The media were supplemented with 2 mM filter sterilized methionine, cysteine and MgSO4.7H2O
separately. The growth of the cells was measured per hour up to 4h and on 16h of incubation at 30 °C
and compared with the cells grown without methionine, cysteine and MgSO4.7H2O and in normal NB
& minimal media adjusted to pH 4.5. No significant difference in the growth rate of BM WT cells in
both neutral and acid stress conditions in absence or presence of SO42- or sulphur containing amino
acids: methionine or cysteine. The BM ΔmetABC also showed similar growth rate at pH 7.0 under the
aforesaid conditions. However, these cells were unable to show normal growth rate at pH 4.5 in absence
of SO42- and sulphur containing amino acids: methionine and cysteine, which was complemented in
presence of any of the above sources of sulphur (Fig. 4).
Fig. 4 Effect of sulfur on the growth of B. megaterium WT and ΔmetABC (BM5) under acid stress.
Acid tolerance by B. amyloliquefaciens MBMC
Bacillus amyloliquefaciens MBMC was isolated from acidic soil and identified based on
morphological and biochemical features as well as 16S ribosomal RNA gene sequence. Acid
tolerance response of B. amyloliquefaciens MBNC under various pH conditions was studied.
The pH of the culture medium was adjusted to 7.0, 6.0 and 4.5 using HCl. The bacterial growth
characteristics were studied in pH 4.5 with or without prior exposure to pH 6.0and the growth
rates were compared to that in pH 7.0. The bacterial cells were unable to show logarithmic
growth rate when they directly transferred from pH 7.0 to pH 4.5 after initial cell density of
O.D. 0.3. However, the growth rate increased upon a longer pre-culture of cells up to an initial
cell density of O.D. 1.0. Best results were obtained after a pre-exposure of the cells at pH 6.0
up to an initial cell density of O.D. 1.0 (Fig. 5). The results suggested that, pre-exposure to
moderate acid enable the cells to survive under extreme acidic condition, a process known as
acid tolerance response (ATR).
DBT-NECAB Annual Report, 2018-19
Scientific Report 45
Fig. 5 Acid tolerance response of B. amyloliquefaciens MBNC under
various conditions
Acid tolerance response by B. amyloliquefaciens MBNC was also studied in pH 4.0 and
4.5 in presence of different acids. The media pH was adjusted to 4.0 and 4.5 using HCl, HNO3,
H2SO4, acetic acid, citric acid, tartaric acid and acetate buffer. The cell density was observed
after 2, 4 and 6 h, which indicated that the cell density (O.D. 600 nm) was higher in pH 4.5
compared to pH 4.0. The cells were able to tolerate the acidic pH adjusted using inorganic acids,
i.e., HCl, HNO3 and H2SO4. The cells were also able to tolerate the acidic pH adjusted using
organic acids: citric acid and tartaric acid, however, no significant growth was observed in
acetic acid and acetate buffer till 6 h of incubation (Fig. 6).
Fig. 6 Acid tolerance response of B. amyloliquefaciens MBNC in different media in presence of
inorganic and organic acids
DBT-NECAB Annual Report, 2018-19
Scientific Report 46
Quantitative gene expression analysis in B. amyloliquefaciens MBNC
Quantitative real-time PCR was performed to study the expression of selected genes under
different acid stress conditions. Primers were designed for those genes with expected product
size <200 bp. Genes were selected based on their putative roles in acid stress response. As per
the literatures, the cell wall plays a major role in the maintenance of acid stress tolerance. This
was also supported by our earlier results on B. megaterium and B. amyloliquefaciens, as the
osmoticum production and exopolysaccharide production bythe bacterium is directly related to
acid stress tolerance. Hence, few genes of B. amyloliquefaciens related to cell wall re-modeling
viz., cupin, flotilin, pdp (penicillin binding protein), mbp (murein binding protein), pdaA
(polysaccharide deacetylase) and spoA (sporulation factor) were tested. The constitutively
expressed 16S ribosomal RNA gene was used for normalization of the amplification process. It
was observed that there was upregulation in cupin and pbp expression during all acid stress
conditions compared to pH 7.0, where cells in pH 4.5 adjusted with acetic acid showed highest
expression of both the genes. Similarly, mbp gene also showed about 1.8 fold up-regulations in
all the acidic conditions. There was no significant difference in the expression of pda gene
among all the tested conditions, while flotilin and spoA gene showed down-regulation in pH
4.5, compared to pH 7.0 (Fig. 7).
Fig. 7 Differential expression of different genes of B. amyloliquefaciens MBNC in different
acid stress conditions
DBT-NECAB Annual Report, 2018-19
Scientific Report 47
Deciphering the role of cupin gene in conferring acid tolerance to B. amyloliquefaciens MBNC
As the cupin gene showed very high level of expression in acidic conditions, B.
amyloliquefaciens Δcupin was generated and growth characteristics were studied in pH 7.0 and
pH 4.5 to validate the function of cupin in acid stress response. Wild type was used for the
comparison of growth characteristics. It was observed that B. amyloliquefaciens Δcupin cells
showed almost similar growth with the wild type at pH 7.0. However, the growth rate of the
cupin mutant was slower at pH 4.5 compared to pH 7.0. There was no significant difference in
the growth rate of the wild type cells at both pH conditions (Fig. 8). These results suggested
that the cupin gene has a potent role in acid stress tolerance. This was further confirmed by the
evidence from the colony morphology. When the colony characteristics of the mutant were
compared to the wild type, it was observed that the colonies lack the rough surface properties,
which is an important feature of B. amyloliquefaciens wild type (Fig. 9).
Fig. 8 Growth characteristics of B. amyloliquefaciens WT and Δcupin calls at neutral and acidic pH
Fig. 9 Colony characteristics of B. amyloliquefaciens wild type and Δcupin cells grown on nutrient
agar plates.
Detection of exopolysaccharides production by B. amyloliquefaciens MBNC
The rough, scaly appearance of the colonies in B. amyloliquefaciens is due to the
production of exopolysaccharides. In case of the Δcupin cells, the colony morphology did not
show this feature. Therefore, it was hypothesized that there may be interruption in the
DBT-NECAB Annual Report, 2018-19
Scientific Report 48
exopolysaccharide production in the B. amyloliquefaciens Δcupin cells. To confirm this,
scanning electron microscopy was performed to study the cell surface morphology of the wild
type and mutant cells. Scanning electron microscopy clearly revealed the production of
exopolyscaccharides by wild type cells, characterized by very rough cell surface morphology
and extracellular layers of exopolysaccharides that increased with time. In contrast, the cell
surface morphology of the mutant was smooth and lacked the extracellular polysaccharides.
Moreover, the cells became irregular in shape with increased time, which may be due to the
loss of integrity in the cell was polysaccharides (Fig. 10).
Fig. 10 Scanning electron micrographs of the (a) and (b): Bacillus amyloliquefaciens wild
type showing active exopolysaccharides production; (c): Δcupin cell with no
exopolysaccharides production
The results indicate that B. amyloliquefaciens MBNC shows acid tolerance with the help
of a cell wall remodelling factor belonging to the cupin super-family. This protein helps in the
maintenance of cell wall integrity; loss of function mutation in cupin gene inhibits the
exopolysaccharide production in the mutants and thereby making the cells susceptible towards
acidic environment.
Plant-growing promoting activities of few promising bacterial isolates under Al-stress:
Gnotobiotic inoculation experiments were performed in rice cultivars Luit. It is a semi-
dwarf variety with low tillering (6-7 EBT/plant) and can be grown in both Ahu and Sali seasons.
In the controlled experiment, strains of Bacillus megaterium G18, Bacillus subtilis B3B9, B.
amyloliquefaciens RHS11 and Microbacterium testaceum MK_LS01 were used, and compared
with controls. These PGPR can enhance plant growth through nutrient recycling (soil health),
IAA production and solubilisation of nutrients such as P and Zn. Pot-experiments were
performed in sterile soil (acidic and neutral) amended with 100 mM AlCl3. For these assays,
220 mL from a 108 CFU/mL inoculum were mixed with 5.5 kg of sterile soil, to reach a
DBT-NECAB Annual Report, 2018-19
Scientific Report 49
concentration of 105 CFU/g and sterile water used as negative control. Each treatment included
three biological replicates, and three plants were grown in each plot. Subsequently, germinated
seedlings were planted inside the pot and plants were kept in the greenhouse at 25°C for 90
days post-inoculation. Biometric properties (tiller number, number of panicles, yield per plant,
root and shoot fresh weight, plant dry weight, and length) were recorded 90 days post-
transplantation.
(c)
Fig. 11 Seedlings growth (before transferring to pots) in (a) acidic soil (pH<4.5) with100 mM AlCl3;
(b) normal soil with 100 mM AlCl3; (c) Root growth under acidic soil with 100 mM AlCl3.
As shown in Fig. 11, it was evident that Bacillus subtilis B3B9 effectively promoted lateral
and adventitious root growth in rice plant as compared to other the isolate. Bacillus megaterium
G18 showed only lateral root growth under Al-stress. Root-pruning which, leads to decreased
productivity was observed in the control set (no bioinoculum)
Screening of Indica rice varieties for Al tolerance
The effect of Al on root growth in rice (Oryza sativa L.) seedlings to detect the relative Al
toxicity tolerance of rice genotypes was studied. Rice genotypes (68 varieties) were collected
from the Regional Agriculture Research Station (RARS), Titabar, Assam. Properly surface
sterilized rice seeds were germinated for three days in petri plates with moisten filter paper. The
healthy germinated seeds were then transferred into plastic containers (400 ml) containing
Hoagland nutritive medium. Plants were grown for a period of 5 days in a growth chamber
under white light after which these were pretreated with 500 μM CaCl2 (pH 4.5) for a day. Pre-
treatment solution was then removed and treated with aluminum chloride (AlCl3) at different
concentration (0, 25, 50 and 100 μM) containing 500 μM CaCl2 (pH 4.5) for 12, 24, 48 h. The
accumulation of aluminum in plant tissue was observed by staining with hematoxylin.
DBT-NECAB Annual Report, 2018-19
Scientific Report 50
Fig. 12 Histochemical detection of aluminum uptake in root tips of rice seedlings.
Microscopic views of hematoxylin stained root tips. Intense stained colour represents
hematoxylin-Al complexes by the root cells at 48h.
Aluminum chloride (AlCl3) at 100μM concentration was used in the germination assay
(Fig 13). Rice verities with more sensitive root growth to Al at germination stage were screened
out. At this condition, root growth in germinating seeds of tolerant genotypes was not
significantly affected, while for some genotypes root growth was drastically inhibited.
Tolerant rice varieties:
Rice varieties 10: Bami-sokuwa; 20: Boss Joha; 27: Gomi 2; 32: Jalbi-Sali; 45: Miyatang; 47:
Na-gaya; 48: Nalbani; 55: Rangi bau 1; 56: Ronga-dherepa; 57: Rongdoi; 60: Siyal-Sali
Moderately sensitive rice varieties:
Rice varieties 2: AC Sali; 3: Adoliya-bau; 5: Akuwa-Bora; 11: Barma-black;16: Bogi-Sali; 17:
Bora; 24: Dhameswar Bau; 35: Kabra Bang; 53: Piroi-Sali; 54: Pura Benu; 65: Sunajuli-Bau
Susceptible rice varieties:
Rice varieties 1: Aath-bau; 4: Akhum-Sali; 6: Badal-bau 2; 7: Baji 8: Baji-lahi; 9: Bak-kapahi; 12:
Beji 13: Bhakat khali; 14: Boga khamtilai; 15: Boga-bet; 18: Bor-juli Bau; 19: Borseni lai; 26:
Buruli-bau; 28: Gondho-biyoi; 29: Hawai1; 30: Hawai2; 31: Holseni-lahi; 33: Jarkho-mosolu; 34:
Joha-sorukola; 36: Kalamdani; 37: Kar-kholi; 38: Kham-tila; 39: Kola-Bora; 40: Kola-Sali; 41:
Lalbihari; 42: Maigutiya; 43: Mathunga; 44: Misiri; 46: Mosuri-bau; 49: Naukheliya; 50:
Negheribai 2; 51: Nekheli-bau; 52: Phool-bakhori; 58: Satuki; 59: Seni-lahi; 61: Soklong; 63:
Sukapha Bau; 64: Suna-bau; 66: Tripura red; 67: Ranjit; 68: Luit
DBT-NECAB Annual Report, 2018-19
Scientific Report 51
Fig. Screening of rice verities based on germination ability under 100μM AlCl3
Plant-growing promoting activities of few promising bacterial isolates:
Two experiments, one in controlled condition (pot-experiment) and one in field plot
(Instructional cum Research Farm, AAU) were conducted. In the controlled experiment, the
above-mentioned bioinoculum were used, and compared with controls. Initially, rice seeds
(Oryza satuva var. Luit) were thoroughly surface-sterilized. Microbiolization of rice seeds was
performed by shaking the seeds with saline suspension of freshly grown (A540=0.5)
Tolerant rice varieties:
Rice varieties 10: Bami-sokuwa; 20: Boss Joha; 27: Gomi 2; 32: Jalbi-Sali; 45: Miyatang; 47:
Na-gaya; 48: Nalbani; 55: Rangi bau 1; 56: Ronga-dherepa; 57: Rongdoi; 60: Siyal-Sali
Moderately sensitive rice varieties:
Rice varieties 2: AC Sali; 3: Adoliya-bau; 5: Akuwa-Bora; 11: Barma-black;16: Bogi-Sali; 17:
Bora; 24: Dhameswar Bau; 35: Kabra Bang; 53: Piroi-Sali; 54: Pura Benu; 65: Sunajuli-Bau
Susceptible rice varieties:
Rice varieties 1: Aath-bau; 4: Akhum-Sali; 6: Badal-bau 2; 7: Baji 8: Baji-lahi; 9: Bak-kapahi; 12:
Beji 13: Bhakat khali; 14: Boga khamtilai; 15: Boga-bet; 18: Bor-juli Bau; 19: Borseni lai; 26:
Buruli-bau; 28: Gondho-biyoi; 29: Hawai1; 30: Hawai2; 31: Holseni-lahi; 33: Jarkho-mosolu; 34:
Joha-sorukola; 36: Kalamdani; 37: Kar-kholi; 38: Kham-tila; 39: Kola-Bora; 40: Kola-Sali; 41:
Lalbihari; 42: Maigutiya; 43: Mathunga; 44: Misiri; 46: Mosuri-bau; 49: Naukheliya; 50:
Negheribai 2; 51: Nekheli-bau; 52: Phool-bakhori; 58: Satuki; 59: Seni-lahi; 61: Soklong; 63:
Sukapha Bau; 64: Suna-bau; 66: Tripura red; 67: Ranjit; 68: Luit
DBT-NECAB Annual Report, 2018-19
Scientific Report 52
rhizobacteria of each of the four strains for 2 hours at 10ºC. These seeds were then transferred
into glass flasks (15 cm × 4 cm) minimally moistened with sterile water and kept for 11 days
in laboratory conditions before hardening and transferring to pot soils.
Fig. 12 Biopriming of rice seeds with different bacteria induced visibly appreciable growth on 7 days post
inoculation
Sterile neutral soil without any amendment was used to grow the bioprimed Oryza sativa
var. Luit seedlings. Biometric parameters were recorded as mentioned above.
(a) (b) (c)
(d) (e) (f)
Fig. 13 Pot-experiment of rice grown in the net-house; rice inoculated with (a) Bacillus megaterium (b)
Microbacterium testaceum (c) B. amyloliquefaciens (d) Bacillus subtilis, (e) control (no bacterial
treatment). (f) Roots of rice grown under these conditions
Bacillus megaterium Microbacterium
testaceum
Bacillus amyloliquefaciens
Bacillus subtilis
No bacterial treatment
DBT-NECAB Annual Report, 2018-19
Scientific Report 53
Table: Few biometric data of rice-plants grown in pots Bioinoculum Leaf numbers Plant height No. of tillers
Bacillus megaterium 30.25±5.3 58.4 ± 5.2 8.4 ± 1.0
Microbacterium testaceum 27.15±4.9 57.3 ± 4.8 7.95 ± 1.3
Bacillus amyloliquefaciens 23.75 ±5.6 58.1 ± 56.3 7.1 ±1.3
Bacillus subtilis 23.0±6.15 55.6 ± 6.6 7.7 ± 0.98
Control 17.8 ± 2.5 49.9 ± 2.9 5.6 ± 0.99
To evaluate the effects of PGPR in field experiment, we considered two varieties of rice,
Luit and Aghuni (a glutinous rice of long duration; ~180 days). Seeds were primed with the
bioinoculum as described above with non-primed seeds kept as control groups.
(a) (b)
(c) (d)
Fig. 14 (a) Number of rice leaves (b) Plant height- inoculated with the four PGPRs
Lorenz curve of inequality for: (c) no. of rice leaves from non-primed seeds (d) no. of rice leaves from
bioprimed seeds rice leaves
Although the overall plant growth and yield was more in bioinoculated rice samples, non-
bioprimed seeds showed a significant increase in the inequality of total biomass, as compared
to the bioprimed seeds (CV: 16.5% in bioprimed seeds vs. 36% in non-bioprimed seeds. Similar
significant results were observed with both plant height and tiller number and were reflected in
the Gini coefficient (index) and the Gini Mean of Differences. A notable feature of the Lorenz
asymmetry coefficients was that those for control plants were always less than one (0.9907143),
while those for treated plants were all greater than one (>1.100769). The former indicated that
the majority of control plants were uniform, while the latter indicated that some large
individuals occurred when bacteria were applied.
DBT-NECAB Annual Report, 2018-19
Scientific Report 54
Academic accomplishment:
• Gunajit Goswami (former Research Associate) received his PhD on the topic ‘A
study on the transcriptome profile of Bacillus megaterium during acid stress’ from the
Department of Life Sciences, Dibrugarh University in the year 2019.
• Naimisha Chowdhury, a PhD student under the Department of Agricultural
Biotechnology, Assam Agricultural University, Jorhat is submitting her PhD thesis
entitled ‘Validating the role of genes upregulated during acid stress in Bacillus
megaterium’.
Paper publication:
• Deka P, G Goswami, P Das, T Gautom, N Chowdhury, RC Boro, M Barooah
(2019) Bacterial exopolysaccharide promotes acid tolerance in Bacillus
amyloliquefaciens and improves soil aggregation. Molecular biology reports 46 (1),
1079-1091
• DJ Hazarika, G Goswami, T Gautom, A Parveen, P Das, M Barooah (2019)
Lipopeptide mediated biocontrol activity of endophytic Bacillus subtilis against fungal
phytopathogens. BMC microbiology 19 (1), 71
• Keot J., Bora S. S., Kangabam R., Barooah M., (2020) Assessment of microbial
quality and health risks associated with traditional rice wine starter Xaj-pitha of Assam,
India: a step towards defined and controlled fermentation (under production)
Book Chapters:
• Barooah M., Bora S. S., G. Goswami (2020) Ethnic Fermented Foods and
Beverages of Assam; In: Jyoti Prakash Tamang (Eds): Ethnic Fermented Foods and
Beverages of India: Science History and Culture, Springer Nature (under production)
Milestones to be achieved:
• Functional validation of the remaining differentially expressed genes (from Phase I)
• Study the growth promotion and Al-Fe stress alleviation ability of the bacterial
isolates in rice and lentil
• Gene expression study of Al-tolerance genes in these plants treated with
bioinoculum
•
DBT-NECAB Annual Report, 2018-19
Scientific Report 55
Programme Objective IV
Objective: Development of efficient biofertilizers and biopesticides using novel microbial
strains from NE soils.
a. Biofertilizer:
Rationale:
The North Eastern Region is endowed with natural resources including diverse
communities of untapped microorganisms and due to continuous use of chemical fertilizers not
only the soil quality is affected but also the agricultural productivity is depleting day by day.
Soil acidity is a serious constraint for crop production in the NE Region accompanied by the
high rainfall in NE Region and undulating topography. However, the major growth-limiting
factors associated with acid soil infertility include toxicity of aluminium (Al), Iron (Fe) and
manganese (Mn), thereby decreasing availability of certain essential elements. It is generally
accepted that Al toxicity is a primary factor limiting plant growth in acid soils (Kochian, 1995).
So, the scope of increasing crop productivity is invariably linked with addressing the low soil
pH levels. Therefore, environmental-friendly strategies to increase agricultural production
should be appreciated. In this context, microbial technology has emerged as an inevitable
component in the present-day agriculture in the context of world-wide importance of organic
farming. Hence, development of bioformulations using novel strains can be implemented as an
alternative way for extensification of the agricultural programme on low pH land. On the other
hand, the Biofertilizer Production Unit has already explored different cultures of biofertilizer
agents for commercialization during Phase I. Different biofertilizer agents produced in this unit
include Rhizobium, Azotobacter, Azospirillum, PGPRs and PSB cultures through screening
and evaluating efficient microbes. Although, during the first phase of the project, the acid
tolerance of the biofertilizer microbes, its plant microbe interactions and its bioefficacy in
relation to commercial strains was not determined. Therefore, in this context during the second
phase a comparative study will be conducted with the already present biofertilizer organisms
of this unit and the microbes having acid tolerant genes under Programme III along with the
new acid tolerant strains to be isolated during Phase II. In this way, potential acid tolerant strains
will be finally evaluated with the commercial stains for its efficacy and selected strains will be
used in development of bioformulation.
DBT-NECAB Annual Report, 2018-19
Scientific Report 56
Specific Objectives:
1. a. Comparative analysis of organic inputs developed during Phase I under
Programme IV over recommended dose of fertilizer through field trials.
b. Harnessing of novel strains having acid tolerance with plant growth promoting
traits as biofertilizer agents.
2. Development of superior bio-formulation with acidity tolerance suitable for acidic
soil.
3. Comparison of efficacy of the commercially available bio-formulations with the
formulations developed from novel strains of NE Region.
4. Phylogenetic and Cluster analysis of selected isolates.
5. Plant-microbial interaction studies for enhanced abiotic stress tolerance with respect
to Aluminium and Iron in lowland rice.
6. Commercialization of efficient microbial bioformulation.
Technical programme for the year
1. Comparative analysis of organic inputs developed during Phase I under Programme IV
over recommended dose of fertilizer through field trials.
a. Validation of biofertilizer and enriched compost through field trials in farmer’s
field with Rice - Toria cropping sequence.
b. Evaluation of existing biofertilizers and acid tolerant bacteria collected from
Programme III in ICR Farm with rice as test crop (under progress).
2. Harnessing novel strains having acid tolerance with plant growth promoting traits as
biofertilizer agents.
3. Production of biofertilizer, enriched compost and Azolla.
Milestone for the year and progress made
1. Comparative analysis of organic inputs developed during Phase I under Programme
IV over recommended dose of fertilizer through field trials.
a. Validation of biofertilizer and enriched compost through field trials in farmer’s field under
Rice - Toria cropping sequence.
The present investigation was carried out during 2018-19 in rice and toria under rice-
DBT-NECAB Annual Report, 2018-19
Scientific Report 57
toria sequence at Ramgaon village of Patharighat SDAO circle, Darrang district of Assam to
assess the changes in soil biological and chemical parameters due to application of organic
inputs in soil. Yield and yield parameters were also assessed. The experimental details adopted
during the present experimentation are mentioned below:
Experimental details
a. Number of treatments: 6 (six)
b. Number of replications: 4 (four)
c. Experimental design: Randomized Block Design (RBD)
d. Total number of plots: 24 (twenty-four)
e. Individual plot size: 10 m X 5 m
Crops:
Rice variety (Medium duration): TTB 404 (Shravani)
Toria Variety (Late sown toria variety): TS 67
Date of sowing and harvesting
Rice was sown on 20-6-18 and transplanted on 20-07-18 and harvested on 10-11-2018. Toria
was sown on 25-11-18 and harvested on 26-02-19.
Cropping sequence: Rice-Toria cropping sequence
Treatment details
Treatments for HYV rice crop variety TTB 404 (Shraboni) as kharif (winter) crop:
T1: Control
T2: 50% RDF + 50% Biofertilizer
T3: 50% RDF + 50% Enriched composts
T4: 100 % Recommended dose of fertilize (RDF) (60: 20: 40 :: N: P2O5:K2O kg/ha)
T5: 100% Biofertilizers (5 kg/ha) (PSB + Azospiriluum)
T6: 100 % Enriched compost (3 t/ha)
Treatments for HYV of toria variety TS 67 as rabi crop:
T1: Control
T2: 50% RDF (Recommended dose of fertilizer) + 50% Biofertilizer
T3: 50% RDF + 50% Enriched composts
T4: 100 % RDF (87kg urea, 220 kg SSP and 25 kg MOP per ha)
T5: 100% Biofertilizers (5 kg/ha) (PSB + Azotobacter)
T6: 100 % Enriched compost (3 t/ha)
DBT-NECAB Annual Report, 2018-19
Scientific Report 58
Results
The data were recorded at various stages of crop growth and soil samples were analysed
for biochemical characters at different stages of rice and toria crops. The results showed that
the INM treatment (T3) consisting of 50% EC and 50% RDF recorded the highest
accumulation of N (262.60 and 252.08 kg/ha), P (23.14 and 22.84 kg/ha), and K (151.33 and
147.58 kg/ha) at maximum tillering stage of rice and flowering stage of toria respectively but
remained at par with 100% RDF treatment in both the crops during the period of investigation.
The accumulation of organic carbon (12.35 g/kg soil in rice and 12.03 g/kg soil in toria) was
found significantly at par with 100% RDF treatment at both the stages of crops. Soil
accumulation of OC, N and K was found higher in 100% EC treatment over 100% biofertilizer
treatment. However, soil accumulation of Organic carbon (OC), nitrogen (N), phosphorus (P)
and potash (K) gradually declined from maximum tillering stages of rice and flowering stage
of toria to harvesting stage of both the crops. Although no significant changes in soil pH was
observed, but the lowest pH was recorded in RDF treatment in both the crops ranging from
pH 5.20 to pH 5.22, even lower than the initial soil pH 5.24. The results showed that the
bacterial, fungal and actinomycetes population varied with the treatments and with the age of
the crops. The treatments, T3 recorded the highest bacterial population of 19.50 cfu x105/g
and 18.50 cfu x105/g soil at flowering stages of rice and toria respectively and declined
thereafter. The fungal population recorded highest in T3 (8.50 cfu x105/g soil in rice and 8.25
cfu x105/g soil in toria). Actinomycetes population recorded in treatment T3 remained
significantly with T6 in both the crops. The microbial diversity in INM and organically
treatments found significantly higher than 100% RDF and control treatment. Soil respiration,
microbial biomass carbon, and tested soil enzymes (fluorescein di-acetate activity,
dehydrogenase activity, acid phosphatase activity and urease activity) behaved differently
with different treatment where T3 (50% EC + 50% RDF) exhibited the best performance over
other treatments at all the stages of rice and toria crop. All the biological parameters were
found at their peak at flowering stages and declined thereafter at harvesting stages of both the
crops. All the bio-chemical properties in treated plots in rice-toria sequence were found
significantly higher than the untreated control and even over the initial values of each
parameters. Unlike soil bio-chemical properties, agronomic parameters of rice (no. of
tillers/hill, plant height, panicle length, grain and straw yield) and toria (plant height, no. of
siliqua/plant, grain and stover yield) crops recorded higher values in 100% RDF treatment
DBT-NECAB Annual Report, 2018-19
Scientific Report 59
which remained at par with, 50% EC + 50% RDF treatment (T3). The grain yield of rice
(44.15 q/ha) and toria (889.25 q/ha) in the 100% fertilized plots were found at par with INM
(T3) treatments (42.60 q/ha in rice 875.50 q/ha in toria) receiving 50% EC and 50% RDF, but
both recorded significantly higher yield over sole application of biofertilizer, enriched
compost and control treatment. The beneficial effect of INM treatment (T3) that facilitated
favourable soil conditions were reflected in grain yield of both rice and toria crops which was
equivalent even with 100% RDF treatments.
Photographs of (a) bacterial and (b) fungal colonies from experimental filed
Microphotographs of actinomycetes colonies with their mycelial and spore view isolated
from experimental field
a b
DBT-NECAB Annual Report, 2018-19
Scientific Report 60
Rice crop at maximum tillering stage
Rice crop at maturity stage
DBT-NECAB Annual Report, 2018-19
Scientific Report 61
Toria crop at flowering stage
Toria crop at maturity stage
DBT-NECAB Annual Report, 2018-19
Scientific Report 62
b. Evaluation of existing biofertilizers and acid tolerant bacteria collected from
Programme III in ICR Farm with rice as test crop (under progress).
A field experiment with rice as the test crop variety Ranjit has been carried out in the ICR
Farm, AAU, Jorhat to evaluate the efficiency of the existing biofertilizers of the unit and
three acid tolerant bacterial cultures collected from Prog III (PI- Dr. M. Barooah). The
evaluation of the soil chemical and biological properties is under process. Rice seed was
sown on 15th July, 2019 and line transplanting was done on 19th August, 2019 and harvested
on 21st December, 2019. The treatment combinations adopted during the present
experimentation are mentioned below:
Design: Randomized Block Design
Treatment: 9
Replication: 4
Plot size: 20 cm2
Treatment details
T1 = Control (Absolute)
T2 = B1 + 20 kg Optimal compost
T3 = B2 + 20 kg Optimal compost
T4 = B3 + 20 kg Optimal compost
T5 = Azosp + 20 kg Optimal compost
T6 = Azoto + 20 kg Optimal compost
T7 = PSB + 20 kg Optimal compost
T8 = Enriched Compost
T9 = Standard + 20 kg Optimal compost
Acid Tolerant Bacterial strains
B1 = G18
B2 = G20
B3 = MBNC
Biofertilizer organisms
Azosp: Azospirillum 71
Azoto = Azotobacter 5
PSB = Phosphate solubilising bacteria (PSB 25)
Fertilizer and organic input rate
NPK: 40:20:20 kg/ha of N, P2O5, K2O Enriched compost: 5t/ha
Biofertilizer: 5kg/h
DBT-NECAB Annual Report, 2018-19
Scientific Report 63
2. Harnessing of novel strains having acid tolerance with plant growth promoting traits
as biofertilizer agents.
Rhizosphere soils in bulk along with roots were collected from different rice fields located
under Jorhat and Golaghat district of Assam. Altogether, thirty (30) samples at random were
collected. The root samples along with their adhering soil particles were separated from the
bulk soil for the isolation of acid tolerant bacteria. Isolation of acid tolerant bacteria was
conducted using enrichment technique in Luria Bertani media. Samples at 10 gram each
collected from different rice ecosystem was weighed and dispensed into 90 ml Luria Bertani
broth in 250 ml Erlenmeyer flasks. To screen bacteria which could resist acidic condition and
higher aluminium concentration, the pH value of the media was adjusted to 5.5 before
autoclaving at 1210C for 15 minutes. After this medium was autoclaved, Al sterilized using a
0.2µm filter was added to a final concentration of 100 ppm. Since, Aluminium-toxicity in
acidic soil is a major limiting factor for plant growth therefore, aluminium is also used as a
criterion for screening of bacterial cultures.
The culture flasks were incubated at 30 ± 1ºC until individual pure bacterial colonies with
varying colour and size were observed after 4-5 days. Isolated colonies were picked up,
purified by repeated sub culture technique. For this all the test isolates were streaked in Luria
Bertani agar plates and incubated at 30±1°C for 3 to 4 days until colonies of different age and
size appeared. Out of the 30 collected soil and root samples, altogether, 62 bacterial cultures
were isolated on the basis of color, elevation, margin, shape, staining behaviour, purity,
survivability and growth character in media as described. The results revealed the colony
morphology ranged from flat to convex with entire margin, mostly gram negative. The isolated
cultures were purified and maintained at 4°C for further studies.
A screening was attempted to select microorganisms that tolerate high concentrations of
H + ions and aluminium concentration. Therefore, an incubation study was performed using
Luria bertani as the growth medium and the pH was adjusted to 5.0 in the presence of 100
ppm of Al as Al2(SO4)3.16H2O. The bacterial cultures which could grow in the presence of
high concentration of H + ions and 100 ppm of Al concentration were selected for further
evaluation. The effect of bacterial inoculation on pH of the growth medium was also
determined. It was observed most of the cultures survived at pH 5.0 in the presence of 100
ppm Al concentration. On the other hand, media pH was increased up to 6.5. It means that the
increase in pH by the action of the bacterial inoculation in growing medium may be due to the
masking of Al by the bacterial cells. The masked Al appeared to form Al complexes, because
DBT-NECAB Annual Report, 2018-19
Scientific Report 64
the culture medium became turbid and very viscous during the growth of the isolates.
To ascertain the plant growth promoting traits by individual cultures indole acetic acid
production was determined spectrophotometrically (Wohler 1997). It was observed most of
the isolated bacterial cultures were efficient producer of IAA and it ranged between 0.09 to
54.50 ppm.
Enrichment, isolation and purification of acid tolerant bacteria
IAA production by acid tolerant bacterial cultures
DBT-NECAB Annual Report, 2018-19
Scientific Report 65
Publications:
Book Chapters:
• Fourteen lecture notes published in the “Compendium of lectures on ICAR
sponsored training on “Techniques in Bio-fertilizers and Biopesticides Production for
Organic Agriculture” CAFT 2018
• Four lecture notes published in the “Compendium of lectures on ICAR sponsored
training on “Developments in Organic Agriculture” CAFT 2019.
Poster presentation:
• Phukan A, Baruah R, Paul A; Methanotrophic bacteria: potential as future microbial
inoculants; presented at the International symposium on biotechnology for food-
nutritional security and organic agriculture organized by DBT-NECAB, AAU, Jorhat,
25 - 26th March, 2019.
Milestone set for the following year:
1. Evaluation of organic trial conducted in ICR Farm and farmers field
3. Characterization & screening of acid tolerant bacteria
4. Molecular characterization of efficient strains
5. Production of Biofertilizers and its quality control
6. Homestead Azolla cultivation
7. Compost production and enrichment
Scientific Report 67
DBT-NECAB Annual Report, 2018-19
Programme Objective IV
b. Biopesticides
Vision:
Help to Convert Assam and other North Eastern Region of India to Organic Region
Specific Objectives:
• To explore advance technologies for enhancing Production and Productivity of
Biopesticides
• Develop and Screen aggressive strains of Bio inoculants for refinement of Biopesticides
for wider adoptability.
• Develop consortium of beneficial microbes and widen network of Organic Agriculture
Technologies.
• Capacity building of Satellite production units in the KVKs of AAU and Initiating AAU-
Private sector partnership module for Entrepreneurship development.
Progress Made
(A) PRODUCTS PRODUCED IN BIOPESTICIDE LAB
Altogether, twenty-two (22) numbers of different bioformulations were prepared.
Following microbial bioagent and insect parasitoids were used for production of these
products in the bioformulation production facility of “Programme on Biopesticides”-
Fungal agents: Trichoderma harzanium, T. viride, T. parareesei, Metarhizium anisopliae,
Beauveria bassiana, Verticellium lecanii, Paecilomyces fumosoroseus, Actinomycetes
Bacterial agents: Pseudomonas fluorescens, Bacillus thuringiensis, B. subtilis
Liquid Formulations: Six liquid formulations of Trichoderma viride, Metarhizium
anisopliae, Beauveria bassiana, Verticellium lecanii, Pseudomonas fluorescens, Bacillus
thuringiensis were new addition
Capsule based Formulations: Six new Capsule based formulations of T. viride
(Biocap_TV), Metarhizium anisopliae (Biocap_MA), Beauveria bassiana (Biocap_BB),
Verticellium lecanii, (Biocap_VL), Pseudomonas fluorescens (Biocap_PF), Bacillus
thuringiensis (Biocap_TT) has been prepared and their evaluation protocols were made.
Actinomycetes based bioformulation: Another two (2) Two Actinomycetes based
bioformulation production protocols were prepared and evaluation processes are in progress.
Insect Parasitoids: Trichogramma sp. were continuously prepared and distributed to the
farmers
DBT-NECAB Annual Report, 2018-19
Scientific Report 68
A (1): Liquid formulations of different Biopesticides Newly developed:
A (2): Capsule based formulations of different Biopesticides Newly developed:
DBT-NECAB Annual Report, 2018-19
Scientific Report 69
(B) QUANTITATIVE DATA OF BIOFORMULATION PRODUCTION
Sl.
No. Products Qnt. (In MT/LTR)
Talc based formulations (In MT)
1 Bio-Time 1.70
2 Biozin-PTB 1.80
3 Bio-Sona 0.30
4 Bio-llium 0.15
5 Bio-Meta 0.50
6 Bio-zium 0.50
7 Bio-veer 4.90
8 Biogreen 1.50
Vermicompost based formulations (In MT)
9 Biofor-Pf 2 8.90
Liquid based formulations (In Lts)
10 Biogreen-L 190.00
Total production (in MT)
Talc based 11.20
Organic based 8.90
Total (solid based) 20.10
Liquid 1240.00 lits
Production (Solid/Liquid) unit wise total production Till Dec’ 2018
Head Quarter 260.10
Satellite units 8.20
HQ (Liquid formulations) 1240.00 lits
Revenue Earned till Dec’2018 (In lakh)
Head Quarter 14.10
Satellite units 8.20
Total 22.30
(C) OFT RESEARCH FINDINGS
C.1. PGPM formulation mediated suppression of major diseases and pests of tea (Camellia
sinensis) biochemical changes and enhancement of plant defense responses
Finding: PGPM based consortia formulation improves host defense responses in tea plant and
enhances productivity and quality of tea
OFT was conducted on organic management of tea pest and diseases with four in house
developed biopesticides viz. Biosona, Biotime, Biogreen-5 and Biogreen-L. Among the tested
formulations, Biogreen-5 exhibited significantly high reduction of tea mosquito bug (89.06%),
DBT-NECAB Annual Report, 2018-19
Scientific Report 70
red spider mite (92.04%), looper caterpillar (91.47%), aphid (92.53%) and grey blight disease
(91.20%) along with increase in the green leaf yield (10.40q/ha) when applied as spray @ 2%
at 15 days interval. These results are at par with the standard chemical check. Besides,
controlling insect pests the cited treatment significantly improves caffeine content (3.9 %) in
produced tea as compared to control (1.2 %).
General view of the Experimental area
Table. Efficacy of different PGPM based formulations in reduction of Tea pests and disease
incidence
Treatment Incidence (%)
Tea
mosquito
bug
red spider
mites
Looper
caterpillar
Grey
Blight
Biosona 53.82
(47.18)b
53.05
(46.72)b
40.27
(39.35)b
60.56
(51.06)b
Biotime 35.33
(36.45)c
34.96
(36.21)c
24.19
(29.47)c
24.55
(29.67)c
Biogreen-5 17.79
(24.88)d
16.23
(23.73)d
12.83
(20.96)d
12.25
(20.53)cd
Biogreen-L 58.84
(50.07)eb
65.69
(54.15)e
55.53
(48.16)e
40.36
(39.47)ce
Chemical
check
10.43
(18.81)df
4.91
(12.79)f
9.32
(17.76)df
9.45
(17.85)df
Control 88.89
(70.54)a
92.07
(73.57)a
89.69
(71.28)a
88.60
(70.27)a
S.Ed(±) 5.01 4.88 3.90 5.52
CD (0.05) 10.47 10.19 8.15 11.53
Data in the parenthesis are angular transformed values
DBT-NECAB Annual Report, 2018-19
Scientific Report 71
C.2. Efficacy of microbe based bioformulations in management of bacterial leaf blight
(BLB) of rice and enhancement of plant growth attributes
Finding: Microbe based bioformulation suppresses BLB of rice and enhances plant growth
attributes
OFT was made on organic management of major rice disease (BLB) with five in house
developed biopesticides viz. Bioveer, Biotime, Biogreen-5, Biosona, and Biofor-Pf. The
Biogreen-5 @ 2% exhibited significantly highest reduction of BB (59.38%), along with increase
in yield. Antibiotic used as a chemical check however showed better reduction of BLB pathogen
in vitro and disease in field.
C.2. In vitro efficacy of bioformulation against BLB pathogen Xoo
DBT-NECAB Annual Report, 2018-19
Scientific Report 72
Table. Field efficacy of microbe based bioformulations in reduction (%) of bacterial leaf
blight (BLB) of rice and enhancement of grain yield
Treatments Disease incidence
(%)
Disease reduction
over control (%)
Grain yield (q/ha)
T1:Bioveer @2%+ Xoo 36.09
de(36.87) 54.00 26.52
T2:Biotime @2%+ Xoo 48.36
c(44.03) 41.73 22.08
T3 :Biogreen @2%+ Xoo 30.71
ef(32.82) 59.38 29.86
T4
:Biosona @2%+ Xoo 57.76b(49.43) 32.33 19.72
T5:Biofor-Pf @2%+ Xoo 40.19
cd (39.29) 49.90 25.83
T6:
Copper oxychloride @ 0.2%+
Xoo 43.20
c(41.09) 46.89 17.50
T7 :[email protected]% + Xoo 32.81
e(34.49) 57.28 19.40
T8 : Control Xoo alone 90.09
a(71.57) 10.71
S.Ed. ± 3.09 2.07
CD (P=0.05
) 6.33 4.25
• Data in the parenthesis are angular transformed values.
C (2.I) A rice field showing typical symptoms of BLB in rice in different crop stages
A B
BLB infected (A) rice field leaf (B) rice leaf
A B C
Plates 1(A-C). Three typical stages of BLB of rice in field
DBT-NECAB Annual Report, 2018-19
Scientific Report 73
C (2.II) OFT Experimental plots of rice showing effect of best bioformulation ‘Biogreen-5’ at
maturity stage (year 2018)
On-Going Research Activities
• Bioprospecting Actinobacteria of Assam for some rice disease management and
growth promotion
• Isolation and characterization of fluorescent Pseudomonads, their biocontrol ability
against bacterial wilt pathogen Ralstonia solanacearum
• Molecular characterization of aroid germplasms of North East India–assessment of
host resistance and biological management of bacterial
• Bioengineering microbial antagonists with Jatropha (Jatropha curcas) oil and
resultant suppression of bacterial wilt (Ralstonia solanacearum) of tomato
• Bioremediation of Arsenic (As) with consortia of arsenic degrading bacteria and
plant growth promoting microbes
• Consortia of Methanotrophic Bacteria and Plant Growth Promoting Microbes for
Management of Rice Diseases and Suppression of Methane Emission
Earmarked Future Thrusts
• Enhance Production and Productivity of Biopesticides
• Develop and Screen aggressive strains of Bioinoculants
• Develop and refine Protocols for New biopesticides
• Develop more consortia of antagonist s along with PGPR
• More FLDs in different crops
• More Training and motivational programme to be organized among farming
community
• Combined efficacy of Parasitoid-Fungal-Bacterial biopesticides to be tested
particularly in tea and rice sector.
• Exploring botanical biodiversity of Assam and North East and development of
botanical based bioformulation
DBT-NECAB Annual Report, 2018-19
Scientific Report 74
Publications:
Book Chapter
• Bora L. C., Bora P., Gogoi M., Potential of Trichoderma spp. for Pest
management and Plant Growth Promotion in NE India. In: Trichoderma -Host
Pathogen Interactions and applications, Sharma P. & Sharma A. K.; Springer
Publications
Others:
Authorized inspection team of the FairCert Certification Services Pvt. Ltd., an accredited
inspection and certification body under NPOP visited the Biopesticide lab of DBT-AAU
Centre, Jorhat in order to certify the developed bioformulations as per the standards of
NSOP/NPOP.
Acknowledgements:
The scientific staffs acknowledge the DBT, GoI, Centre Director, DBT_AAU Centre, AAU,
Jorhat, for generous funding and Assam Agricultural University, Jorhat for providing
administrative facilities and support.
Inspection team checking standard protocols and Stock Register
Academics
DBT-NECAB Annual Report, 2018-19
HRD and Capacity Building 77
DBT-NECAB Annual Report, 2018-19
Human resource development and capacity
building
National/International level scientific Workshop/Meeting attended:
Dr. Bidyut K. Sarmah, ICAR National Professor and Director, DBT-AAU Centre attended the
kick-off meeting of AdaptNET, under Erasmus+ programme of the European Commission, held
at Athens during March 7-8, 2019.
Mr. Manab B Gogoi Assistant professor Attended and Participated in “International
Conference on trends in Plant Sciences and Agrobiotechnology 2019” held at Indian Institute
of Technology Guwahati, during 14-16 February, 2019, organized by Department of
Biosciences & Bioengineering and Centre for Rural Technology, IIT Guwahati, India in
association with Plant Tissue Culture Association- India (PTCA-I)
Mr. Manab B Gogoi Assistant professor Participated in 3-day National workshop on “Potential
Biotechnology Programme Using Bioresources of NE Region” from September 12-14, 2019
organized by DBT- North East Centre for Agricultural Biotechnology (DBT-NECAB), AAU
Jorhat.
Ms. Rubi Gupta PhD Scholar participated in 6th Annual South Asia Biosafety Conference held
in Dhaka on 15th September 2018
Ms. Rubi Gupta PhD Scholar selected and participated in the international biosafety and
biotechnology programme at Michigan state university, USA.
Dr. Moloya Gohain, Dr. Sudipta Sankar Bora and Dr. Rajib Das, Project Scientists under
the DBT-NECAB visited major agricultural biotechnology research organizations and institutes
in New Delhi, under the ‘Scientific-exchange programme’.
Dr. Sushil Kumar Singh, RA, has participated in workshop-cum training on NGS data
analysis held on 14th March to 16th March 2019, organized by Distributed Information Centre
(DIC), Department of Agricultural Biotechnology, AAU, Jorhat.
Mrs. Sandhani Saikia, JRF, has participated in Workshop-cum Training on NGS data
analysis held on 14th March to 16th March 2019, organized by Distributed Information Centre
(DIC), Department of Agricultural Biotechnology, AAU, Jorhat.
Recognitions to our scientists/researchers
Dr Bidyut K. Sarmah, ICAR National Professor and Director, DBT-NECAB appointed as
member of newly constituted STAG (Scientific and Technical Appraisal and Advisory Group),
the highest body to review projects under agriculture animal science and plant science for North
East region.
Dr. Bidyut Kumar Sarmah, ICAR National Professor and Director, DBT-NECAB recognized
as Outstanding Reviewer by the Indian Society of Genetics and Plant Breeding (ISGPB)
HRD and Capacity Building 78
DBT-NECAB Annual Report, 2018-19
Prof. Madhumita Barooah, selected to hold a joint workshop under UKIERI initiative of
DST, India and UK India Education & Research Initiative (UKIERI) foundation
Dr Prasant Das, Assistant Professor selected by DBT, Govt of India for his post-doctoral
research at IRRI, Philippines
Dr Indrani Baruah student of Professor Bidyut Kumar Sarmah selected for postdoctoral
research at Agricultural Research Service (ARS) Research program under the mentor Dr. Bryan
Bailey at the Sustainable Perennial Crops Laboratory (SPCL) located at Baltimore, Maryland,
USA.
Dr Tankeswar Nath, Assistant Professor and Dr. Moloya Gohain, Project Scientist selected
for 4-weeks AdaptNET Training in three (3) European Institution and ICRISAT, India.
Mrs. Sandhani Saikia is selected for 3-month training program in one of the European
AdaptNET organizations. AdaptNET (Strengthening education, research and innovation for
climate smart crops in India) is an ERASMUS+ CAPACITY BUILDING project, funded by
the European Commission.
Invited talk presented by the Director:
• Talk on “DBT-AAU Centre at a glance” at Anand Agricultural University, Gujarat on
13.11.2018.
• Talk on “Transgenic technology: opportunities and challenges” in ISCB symposium under
Indo-Swiss Collaboration in Biotechnology during Dec. 3-4, 2018. Also chaired the session.
• Talk (invited) entitled “Entrepreneurship: scope in N E India and role of DBT-AAU Centre”
delivered and acted as and panel member in “Innovation cum entrepreneur meet” at CSIR-
NEIST, May 8 – 11, 2019
• Delivered key note address in 4th edition of National Green summit, and acted as a panel
member, on “Biotechnology interventions on sustainable development and utilization of
Bioresources for environmental management and livelihood generations in North east
region” at IIT, Guwahati on 3rd Nov, 2019.
• Delivered key note address in National conference on “Bio exploration for human welfare-
An integrative approach” on 9th Nov, 2019 at Assam down town University
• .
Scholarships and Extension 79
DBT-NECAB Annual Report, 2018-19
Scholarships for PhD Scholars:
A total of seven Ph.D. scholars have received a scholarship for the FY 2019-20; the academic
year 2017-18 under DBT-NECAB, Assam Agricultural University, Jorhat. Below is the list of
scholars:
Sl No Name of the Candidate Institution in where PhD pursued
2018-19
1. Chandrika Buragohain ABT, AAU, Jorhat
2. Lipika Khataniar ABT, AAU, Jorhat
3. D Shephrou Helena ABT, AAU, Jorhat
4. Reshma Ahmed ABT, AAU, Jorhat
5. Snigdha Bora ABT, AAU, Jorhat
6. Panchashree Das ABT, AAU, Jorhat
7. Jyotsna Dayma ABT, AAU, Jorhat
Fellowship awarded to PhD student for training:
Student(s) On
Year
Institute where training obtained
Ms. Rubi Gupta 2018-19 Michigan state university, USA, and Dhaka University, Bangladesh
Mr. Dharmendra Singh Lagoriya 2019-Present
University of California, Davis
Satellite Labs under DBT-NECAB
DBT-NECAB has sanctioned total amount of 75 lakhs and released 15 lakhs each to the
following five institutes for infrastructure development according to the budget provided by
DBT- GoI to setup satellite laboratories under DBT-NECAB.
1. Nagaland University, School of Agricultural Sciences & Rural Development,
Medziphema Campus
2. Central Agricultural University, Iroisemba, Imphal, Manipur
3. School of Post Graduate Studies, Central Agricultural University, Umiam,
Meghalaya
4. College of Agriculture, Tripura Lembucherra, West Tripura
5. Dept. of Biotechnology, School of Life Sciences, Mizoram University, Aizwal
Report on Progress received from Tripura and Mizoram Centre.
Training and Awareness 80
DBT-NECAB Annual Report, 2018-19
Meetings, Symposium, Workshops, Scientific Trainings and
Awareness Programmes
INAUGURAL CEREMONY OF DBT-NECAB AND FIRST SCIENTIFIC ADVISORY
MEETING
November 19-20, 2018
The Department of Biotechnology, Ministry of Science and Technology, GOI-funded-the North
East Centre for Agricultural Biotechnology (DBT-NECAB) was formally inaugurated on the 19th
Nov, 2018 at Assam Agricultural University, Jorhat by the Honourable Vice Chancellor, Dr. K.
M. Bujarbaruah in presence of Dr T. J. Higgins, an world expert in the field of Genetic
Engineering from CSIRO, Canberra, Australia and Chairman of the Scientific Advisory
Committee of the Centre; Dr. Mohd. Aslam, Adviser, DBT, GoI, and Dr T. Madhan Mohan,
Consultant Advisor, NERBPMC, DBT. Earlier, Dr. B. K. Sarmah, Director, DBT Centre
welcomed all dignitaries and others present in the ceremony.
INTERNATIONAL SYMPOSIUM: BIOTECHNOLOGY FOR FOOD-NUTRITIONAL
SECURITY & ORGANIC AGRICULTURE March 25-26, 2019
The two-day long scientific meet was carried out
with discussions on various issues of Food
Nutrition and Organic Farming. Inaugurated by
the Honorable Vice Chancellor Prof. K. M.
Bujarbaruah as the Chief Guest and Prof. N. K.
Singh, ICAR- National Professor (B P Pal Chair)
& Director, NRCPB, New Delhi, as the Guest of
Honour, the symposium was graced with the
presence of well-known educationist and scientist Padmashree Prof. S. K. Sopory, Ex. Vice
Chancellor, JNU, New Delhi and eminent scientist Prof. Douglas Cook, Director, Feed and Future
Innovation Lab, U C Davis, USA. Along with technical sessions, a competition of Poster
Presentation was organized where more than eighty participants presented scientific posters.
DBT-NECAB Annual Report, 2018-19
Training and Awareness 81
NATIONAL WORKSHOP: POTENTIAL BIOTECHNOLOGY PROGRAMMES USING
BIORESOURCES OF THE NE REGION
September 12-14, 2019
The National workshop was
organized with the aim of
bioprospecting the available
bioresources as a multidisciplinary
challenge, strengthening public-
private partnerships in scientific
research and value addition of
resulting products. The Keynote
Speakers included Prof. Prabhakar
Ranjekar (Eminent Biotechnologist, Retd. Director, IRSHA & Retd. Head, Biochemistry, NCL,
Pune); Dr. Kuldeep Singh (Director, ICAR-NBPGR, New Delhi); Dr. P. M. Bulakh (Director,
BCUD, Bharati Vidyapeeth University) and Dr. Arvind Kumar (Director, IRRI-SARC,
Varanasi). Dr. T Madhan Mohan, Consultant Adviser, DBT-NERBPMC, GoI, New Delhi,
addressed the gathering as the Guest of Honour. A short documentary film on various activities
of DBT-AAU Centre entitled ‘ABHASHA - A glimpse of the Technology Renaissance in NE
India’ was released.
DBT-NECAB Annual Report, 2018-19
Training and Awareness 82
On Site Awareness and Training Programmes
Trainings were conducted among STGs of Assam to enlighten about utility of developed
biopesticides for production of organic tea. Moreover, trainings were also conducted in
different locations of Assam, Arunachal Pradesh and Meghalaya states on organic cultivation
of vegetables, zinger, black pepper and betel vine.
Training Programme on Organic Agriculture in different locations (East Khasi Hills, Meghalaya)
A (III) Training Programme on organic agriculture in different locations (Namsai, Arunachal)
Training and Awareness 83
DBT-NECAB Annual Report, 2018-19
A(IV) Training programmes: ‘Biofertilizer Group’ (Programme Objective IV)
Sl.
No
Title of Events
Attended
Organized
by
Period Sponsored by Venue
1 Advances in organic
Farming and INM
EEI in
collaboration
with Tripura
Govt
10-13
July, 2018
Directorate of
Agriculture,
Govt of
Tripura
T-Sameti,
Agartala,
Tripura
2 Promotion of organic
farming in Nagaland
EEI in
collaboration
with
Nagaland
Govt
17-20
July, 2018
Directorate of
Agriculture,
Govt of
Nagaland
Sameti,
Medziphema,
Nagaland
3 Promotion of organic
farming in Manipur
EEI in
collaboration
with Manipur
Govt
17-20, Jan
2019
Directorate of
Agriculture,
Govt of
Manipur
Sameti,
Imphal,
Manipur
4 Promotion of
Bioinputs for
enhancing organic
Agriculture in Tripura
EEI in
collaboration
with Tripura
Govt
06-09,
Aug,2019
Directorate of
Agriculture,
Govt of
Tripura
T-Sameti,
Agartala,
Tripura
5 Techniques in Bio-
fertilizers and
Biopesticides
Production for
Organic Agriculture
CAFT, ICAR 21 days ICAR, Govt of
India
Dept. of Soil
Science, AAU,
Jorhat.
6 Developments in
Organic Agriculture
CAFT, ICAR 21 days ICAR, Govt of
India
Dept. of Soil
Science, AAU,
Jorhat.
7 Beneficial microbes in
organic farming
CAFT, ICAR 21 days ICAR, Govt of
India
Dept. of Soil
Science, AAU,
Jorhat.
Training and Awareness
84
DBT-NECAB Annual Report, 2018-19
(B) TECHNOLOGY TRANSFERRED
MoU signed with following enterprises to transfer the biopesticide production technology developed
by Biopesticide lab of DBT-AAU Centre under PPP mode-
1) VRS Agritech, Guwahati
2) School of Livelihood & Rural Development (SLRD), Shillong
3) M/s Orgaman R&D Division, Jorhat
(C) ENTREPRENEUR DEVELOPED
Training has been provided to following Seven (7) entrepreneurs on commercial production of Bio-
inputs-
1. M/S Balaji Chemicals; Poprietor: Mr. Somit Poddar, Lepetkata, Dibrugarh
2. M/S Rupom; Proprietor: Mr. Prantic Bora, Jail Road, Jorhat
3. M/S O-Green; Proprietor: Mr. Annada S. Kalita, Sootea, Sonitpur
4. M/S Eastern Bio-Tech Solution; Proprietor: Mr. Arif Ali, Jorhat
5. M/S Bordoloi Associates; Proprietor: Dr. Bijit Bhattacharyya, Dibrugarh
6. Sanjiv Goswami, Panigoan, Nagoan
7. M/S Madhuram; Prop: Mr Ratul Baruah, Tiliki Aam, Jorhat
8. M/S Bordoloi Associates, Dibrugarh
9. Prop: Dr. Bijit Bhattacharyya
10. Mr. Abhijit Saikia; Biotech Centre, Dibrughar University, Assam
(D) PRODUCT COMMERCIALIZED
One biopesticide product (Bioveer) released for commercialization with CIB registration.
DBT-NECAB Annual Report, 2018-19
Projects through Extramural Grants
85
Ongoing projects of Associated Scientists
obtained through Extramural Grants
1. Project Title: Study of mitochondrial electron transport chain (ETC) dysfunction that
modulates aging and development in C. elegans through CEP-1, the worm homolog of
mammalian p53
Principal Investigator:
Dr. Aiswarya Baruah, Asst Prof., DBT-AAU Centre, AAU
Funding Agency: DBT, Govt. of India
Nature of the Project: DBT - U-EXCEL
Duration: 3 years (2016-2019)
Grant total for 3 years: `123.56 lakhs
2. Project Title: Genetic studies to understand mitochondrial electron transport chain
dysfunction using Caenorhabditis elegans
Associated Scientists:
Dr. Aiswarya Baruah (PI and Co-ordinator), Asst Prof., DBT-AAU Centre, AAU
Dr. Arnab Mukhopadhyay (PI), NII, New Delhi
Dr. Bidyut Kumar Sarmah (Co-PI), ICAR National Professor
Funding Agency: DBT, Govt. of India
Nature of the Project: DBT - Twinning
Duration: 3 years (2016-2019)
Grant total for 3 years: `121.45 Lakhs
3. Project Title: Studies on role of endophytes in variation of acaricidal properties of two
acaricide producing plant species NBA22/f1 andNBA18/D1
Associated Scientists:
Dr Tankeswar Nath (PI and Coordinator), Asst Prof., DBT-AAU Centre, AAU
Mr Manab Bikash Gogoi (Co- PI), Asst Prof., DBT-AAU Centre, AAU
Dr. K. Swarnalakshmi (PI), ICAR - IARI, New Delhi
Dr. Shoma Paul Nandi (PI), Amity University, NOIDA
Dr. Sarad Sriva stava (PI), CSRI- NBRI, Lucknow
Dr. Srikant Ghosh (PI), ICAR - IVRI, Izatnagar
Funding Agency: DBT, Govt. of India
Duration: 3 years (2017-2019)
Grant total for 3 years: `144.46 lakhs
4. Project Title: Functional validation of yield related genes in black rice.
Principal Investigator:
Dr. Prasanta Kr Das (PI), Asst Prof., DBT-AAU Centre, AAU
Funding Agency: DBT, Govt. of India
DBT-NECAB Annual Report, 2018-19
Projects through Extramural Grants
86
Duration: 3 years (2016-2019)
Grant total for 3 years: `40.8 lakhs.
5. Project Title: Understanding the molecular mechanism of anaerobic germination in
hypoxia tolerant rice germplasms of Assam through functional genomics study.
Principal Investigator:
Dr. Prasanta Kr Das (PI), Asst Prof., DBT-AAU Centre, AAU
Funding Agency: DBT, Govt. of India
Duration: 3 years (2017-2020)
Grant total for 3 years: `118.42 lakhs.
6. Project Title: Screening of indigenous rice germplasms of Assam for tolerance to
anaerobic condition during germination and marker assisted introgression of traits into elite
Rice Variety".
Principal Investigator:
Dr. Prasanta Kr Das (PI), Asst Prof., DBT-AAU Centre, AAU
Funding Agency: DBT, Govt. of India
Duration: 3 years (2016-2019)
Grant total for 3 years: `63.16 lakhs.
*Progress report has not been included as PI is under training abroad.
7. Project Title: Seedless plant production and mass scale propagation of Musa balbisiana
(Bhimkol banana) of NER using in vitro approach
Principal investigator: Mr Manab Bikash Gogoi, Asst. Prof., DBT-AAU Centre, AAU, Jorhat
Co-Principal investigator:
Dr. Priyadarshini Bhorali, Asst. Prof., DBT-AAU Centre, AAU, Jorhat
Partner Institutes: IIT, Guwahati; JNU, New Delhi
Funding Agency: DBT, Govt. of India (DBT/NE/U-Excel/2014).
Grant: 39.5 lakhs
Duration: 3 years (March, 2018- March, 2021
DBT-NECAB Annual Report, 2018-19
Projects through Extramural Grants
87
PROGRESS MADE
Efficacy evaluation of encapsulated fungal formulation for improving crop
phosphorus nutrition
Principal investigator: Dr. Tankeswar Nath, Asst. Prof., DBT-AAU Centre, AAU, Jorhat
Co-PI/Co-Investigator: Dr. Robin Chandra Boro, Asst. Prof., DBT-AAU Centre, AAU, Jorhat
Funding Agency: DBT, Govt. of India (Twinning project)
Findings:
Effective fungal formulation for phosphate solubilization in acid soils of Assam has been
identified and applied in the Rape seed crop grown in ICR-Farm, AAU, Jorhat, during the year
2018-19. The incorporation of phosphate solubilising fungal formulation into the crop field
showed significant increase in yield as compared to the control plots. This increased in yield with
application of phosphate solublizing fungal formulation might be due to release of soil-bound
phosphate by the fungus of the formulation. It was also observed that where there was no
formulation applied P-level slightly decreased over the growing season but in other cases available
phosphorus almost remained same which might be due to slowly and continuous release of
phosphorus from the bound form by the applied fungal formulation. Potassium contents were found
higher where there was combination of P- and recommended doses of P-fertilizer. At 30DAS the
potassium content increases then gradually decreases again. This increase potassium might have
some interaction with applied encapsulated fungal formulation, their metabolic activity as well as
interaction with other soil microbial activities
Assessment the persistence and traceability of microbial strains applied with bio-
formulation and its effect on autochthonous soil microorganisms has to be established (under
progress)
DBT-NECAB Annual Report, 2018-19
Projects through Extramural Grants
88
Studies on role of endophytes in variation of acaricidal properties of two
acaricide producing plant species NBA 22/F1 and NBA18/D1 from North
Eastern States
Principal investigator: Dr. Tankeswar Nath, Asst. Prof., DBT-AAU Centre, AAU, Jorhat
Co-PI/Co-Investigator: Mr. M. B. Gogoi, Asst. Prof., DBT-AAU Centre, AAU, Jorhat
Funding Agency: DBT, Govt. of India (Twinning project)
Grant: 144.46 lakhs
Duration: 3 years (Jan, 2017- Jul,2020)
Findings:
The plant samples of Argemone mexicana and Datura metel showing high and low acaricidal
activity was collected from different locations Assam. Presence of metabolites like Atropine and
Scopolamine in Datura and Berberine and Sanguinarine in case of Argemone were identified using
HPTLC for standardization of extracts. Acaricidal potential of these plant extracts was tested
against the field ticks collected from five different districts of Assam viz. Barpeta, Kamrup
Metropolitian, Morigaon, Nagaon and Sonitpur and Ri-Bhoi district of Meghalaya. The soil
properties as well as rhizopheric and endophytic microorganisms (bacteria and fungi) associated
with these plants were also determined. Among the endophytes identified, the Bacillus subtilis
species was found to be predominant bacteria in both A. mexicana and in D. metel. Among fungal
endophytes, the genus Aspergillus was found predominant in both the plant species. The
unculturable microrganisms in rhizospheric soils and plant tissues of D. metel showing highest and
lowest acaricidal activity was identified by next generation sequencing.
DBT-NECAB Annual Report, 2018-19
Projects through Extramural Grants
89
Study of mitochondrial electron transport chain (ETC) dysfunction that
modulates aging and development in C. elegans through CEP-1, the worm
homolog of mammalian p53
Principal investigator: Dr. Aiswarya Baruah, Asst. Prof., DBT-AAU Centre, AAU, Jorhat
Funding Agency: DBT, Govt. of India (DBT/NE/U-Excel/2014).
Grant: ₹ 123.56 lakhs
Duration: 3 years (March 10. 2016 to September 30. 2019)
Findings:
The mitochondrial ETC dysfunction either by genetic mutation (isp-1) or mitotoxicant paraquat
produces mitochondrial superoxide and reduces mitochondrial membrane potential. These
mitochondrial signals lead to the induction of cep-1 and its downstream target egl-1. Moderate
ETC dysfunction also increases C. elegans lifespan but reduce the progeny number. The concurrent
exposure to paraquat over generation effects mtDNA/nDNA ratio differently in cep-1 and isp-1
mutants compared to wt. Upon mitochondrial ETC dysfunction, cep-1 targeted, lipid metabolism
genes fat-2 (fatty acid desaturase), acs-2 (acyl CoA synthetase) and asah-1 (N-acylsphingosine
amidohydrolase) are involved in lifespan determination and fecundity.
DBT-NECAB Annual Report, 2018-19
Projects through Extramural Grants
90
Genetic studies to understand mitochondrial electron transport chain
dysfunction using Caenorhabditis elegans
Principal investigator: Dr. Aiswarya Baruah, Asst. Prof., DBT-AAU Centre, AAU, Jorhat
Dr. Arnab Mukhopadhyay, National Institute of Immunology, New Delhi
Funding Agency: DBT, Govt. of India (DBT-Twinning: BT/PR16823/NER/95/304/2015)
Grant: ₹121.45 lakhs
Duration: 3 years. (January 9. 2017 to January 9. 2020).
Findings:
The objectives of this study were to determine how CEP-1/p53 modulates lifespan
and development of ETC mutants in collaboration with PLRG1/PLRG-1 and the molecular
role of CEP-1/p53 in Dietary Restriction (DR)-mediated life span extension. The plrg-1 RNAi
knockdown causes embryonic lethality in worms in tested genotypes [N2, cep-1 (gk138), isp-
1 (qm150), gas-1(fc21) and cep-1(gk138); gas-1(fc21)]. The plrg-1 RNAi knockdown during
development of worm significantly reduced lifespan of wild type (N2), cep-1 (gk138), cep-
1(gk138); isp-1(qm150) and cep-1(gk138; gas-1(fc21) mutants. These results indicate that the
nuclear protein PLRG-1 is involved in determining lifespan, development and reproduction
in C. elegans. It was also found that the CEP-1 is specifically required for genetic paradigms
of Dietary Restriction (DR) and germline mediated lifespan extension.
DBT-NECAB Annual Report, 2018-19
Projects through Extramural Grants
91
Seedless Plant Production and Mass Scale Propagation of Musa Balbisiana
(Bhimkol Banana) of NER Using in vitro Approach
Principal investigator: Mr. Manab Bikash Gogoi, Asst. Prof., DBT-AAU Centre, AAU, Jorhat
Co-Principal investigator: Dr. Priyadarshini Bhorali, Asst. Prof., DBT-AAU Centre, AAU, Jorhat
Partner Institutes: IIT, Guwahati; JNU, New Delhi
Funding Agency: DBT, Govt. of India (DBT/NE/U-Excel/2014).
Grant: 39.5 lakhs
Duration: 3 years (March, 2018- March, 2021
Findings:
The objective of this work was to identify Musa balbisiana cv Bhimkol and to
establish an optimized protocol for anther culture and endosperm culture to obtain haploids
and triploids.
The banana explants of Bhimkol was collected from different agro-climatic zones of Assam
and these plants are being maintained at AAU, horticulture field and tissue culture laboratory
under Department of Agricultural Biotechnology, Initially we studied different morphological
parameters in Bhimkol accessions, like plant height, pseudostem diameter, no of
pseudostems/suckers, no. of seed per fruit, fruit length, fresh weight of seeds and dry weight
per banana fruit. We found that, bhimkol takes 24 months to flower in comparison to
commercially cultivated triploid species like Jahaji and Malbhog banana plants which flowers
in15 months.
Based on our objectives, the male flowers with five stamens were taken from the 20th
to 30th bract of the inflorescence (koldil) after 30 days of bunch shooting from field grown
plants. Anthers were carefully isolated and transferred into petriplates. Treatment of explants
with 70% ethanol for 2 minutes, 0.2% fungicide for 5 minutes and 1% mercuric chloride for
10 minutes. Anthers with uninucleate microspore stage were inoculated in to media and kept
in the dark, however blackening of anther tissues was observed due to high polyphenol
secretion from cut surface after 7 days. Callus development and shoot regeneration was
DBT-NECAB Annual Report, 2018-19
Projects through Extramural Grants
92
investigated on Murashige and Skoog (MS) basal medium supplemented with different
concentration of 2,4-D, and 6-Benzlyaminopurine (BAP) either alone or in combination with
Indole acetic acid (IAA). Callus formation was observed on MS medium supplemented with
BAP (1.0 mgL-1) and IAA (2.0mg L-1). However, regeneration is poor. based on our second
objective, seed morphology studies was carried out under bright field microscope where, we
found the presence of crimson color semi liquid endosperm in the immature seed; however,
in the mature bhimkol seeds the endosperm becomes blackish in color and turns very hard,
therefore, endosperm from immature seed is being used in vitro regeneration of triploid plants.
However, further research is under progress.
Fig1: Anther Culture Fig 2: Development of callus
Fig: Endosperm in the centre of immature seeds
under bright field microscopre. Fig4: Mature seeds
Proceedings of 1st SAC meeting
Proceedings of 1st SAC meeting 95
DBT-NECAB Annual Report, 2018-19
DBT-NECAB
Assam Agricultural University Jorhat, Assam
Minutes of Meeting: 1st Scientific Advisory Committee (SAC) held on 19th Nov, 2018 Venue: Meeting Room, DBT-AAU Centre
Members present:
- Dr T J V Higgins, Honorary Fellow, CSIRO Agriculture and Food, Canberra and Chairman
SAC
- Dr K M Bujarbaruah, Vice Chancellor, AAU and Co-Chairman, SAC
- Dr Md Aslam, Adviser, DBT, member
- Dr T Madhan Mohan, Consultant Adviser, DBT-NERBPMC and member
- Dr Sunil Mukherjee, Senior Scientist, INSA: DBT nominee and expert member
- Dr M V Deshpande, Emeritus Scientist, NCL, Pune: DBT nominee and expert member
- Dr M K Modi, Head of Department, Agril. Biotechnology and member
- Dr B K Sarmah, Director DBT-AAU Centre, Coordinator, DBT-NECAB and member,
Secretary
The Chairman, Dr T J V Higgins welcomed all members of the Scientific Advisory Committee
(SAC). This was the 1st SAC meeting after the Department of Biotechnology funded North
East Centre for Agricultural Biotechnology (DBT-NECAB) was sanctioned to Assam
Agricultural University, Jorhat on 1st Oct, 2018 to upgrade the DBT-AAU Centre established
in 2011. A ceremony was organized in which the DBT-NECAB was formally inaugurated by
the Honorable Vice Chancellor, Dr K M Bujarbaruah in presence of Dr T J Higgins, dignitaries
from DBT (Dr Md Aslam and Dr T Madhan Mohan); experts of the SAC (Dr S Mukherjee and
Dr M V Deshpande); all Deans and Directors of AAU; all Heads of the departments, AAU;
scientists, faculty, office staffs and students.
Dr Higgins welcomed the promising prospect of biotechnology in the N E region of the country
with the current funding and thanked the officials of DBT, GoI. Complementing the
Chairman’s remarks, Dr K M Bujarbaruah, Vice Chancellor and Co-Chairman of SAC
welcomed the members and acknowledged the valuable inputs made in the Steering Committee
meeting held prior to the SAC meeting on the same day. He offered special thanks to Dr
Higgins for coming from Australia and chairing the meeting.
Dr B.K Sarmah, Director DBT-AAU Centre and coordinator of NECAB briefly summarized
the progress made in Phase I by the five programmes. He highlighted the strategic plans of
NECAB to achieve the targeted goals approved by the DBT.
R&D Objectives of NECAB for the next 3 years
1. Genetic improvement of rice for abiotic and biotic stress tolerance using
molecular breeding, especially drought, submergence and bacterial blight disease
2. Genetic improvement of chickpea using gene technology for insect resistance
Proceedings of 1st SAC Meeting 96
DBT-NECAB Annual Report, 2018-19
3. Bioprospecting of soil microbes from acidic soils of N E region
a. Plant-microbe interaction especially with rice plants
b. Identification and isolation of acid tolerance genes
c. Metabolic engineering of rice to tolerate acidic conditions
4. Development of efficient biofertilizers and biopesticides using novel microbial strains from
NE soils.
In order to fulfil these objectives, following five research groups have been formed, Dr Sarmah
added.
Five major Research groups have been formed to fulfill our goals:
1. Rice molecular breeding (Dr M K Modi (PI) and Associates Dr R Sarma, Dr A Baruah)
2. Chickpea gene technology (Dr S Acharjee (PI), and Associates Dr A Baruah, Dr B K Sarmah,
with Mentor, Dr T J Higgins)
3. Bioprospecting of microbes from acid soil (Dr M Barooah(PI), and Associate Dr R Boro)
4. Biofertilizers (Dr R Baruah (PI), and Associate Dr T Nath)
5. Biopesticides (Dr L C Bora (PI), and Associates Dr P Bora and Dr D Saikia)
The DBT also sanctioned five satellite laboratories under DBT-NECAB in the different States
of N E other than Assam. During Phase-I, seven satellite laboratories were established in the
State of Assam. Dr Sarmah specified the Institutes and contact persons chosen as potential
organizations to set up satellite laboratories.
Potential Institutes wherein such labs may be established:
Tripura : College of Agriculture, (Contact: Dean)
Meghalaya : College of Agriculture, CAU, (Contact: Dean)
Nagaland : Nagaland University (Contact: Prof Akali Sema)
Manipur : CAU (Contact: Vice Chancellor)
Sikkim : Sikkim University (Contact: Prof Jyoti Prakash Tamang)
Arunachal : New DBT Centre at Kimin (Contact: Director)
Dr Sarmah elaborated that the new DBT Centre at Kimin, AP is being mentored by AAU
thereby facilitating the transfer of technology to that Centre. The other new satellite Centres
will be established with funding from DBT-NECAB sanctioned by the DBT. Primarily,
bioinput production technologies and tissue culture technology will be transferred for further
evaluation in the States and, if necessary, training will be provided to their scientists and
students on the application of such technologies. The funds will be transferred in instalments
upon submission of progress report from the respective Centres.
Dr Sarmah also reported on the recruitment of manpower (project scientists, RAs and JRFs) as
per sanction was complete and Technical Assistant positions had already been advertised. He
underlined the issue of insufficient manpower for various activities at the Centre including
research, academics and extension. He requested that positions sanctioned during Phase-I be
continued and additional manpower in Phase-II be sanctioned, considering the commitment
Proceedings of 1st SAC meeting 97
DBT-NECAB Annual Report, 2018-19
made for the programme. The advisers and experts of DBT recognized the issue and invited
the Director to submit a proposal to the DBT at the earliest for urgent action.
The SAC members proposed that each PI should submit a detailed project plan for the next
three years within two weeks. The plan will be critically reviewed by experts. The suggestions
and specific comments obtained will eventually help achieve goals of each programme. PIs
were asked to follow this strictly.
Dr T J Higgins summarized the recommendations of the SAC and emphasized the streamlining
of the project implementation strategies for the next phase. The major recommendations
included the sanction for additional manpower in Phase II and submission of detailed
project plan for the next three years within two weeks by each PI for expert review. The
Centre should focus on scientific evaluation in the field so that the farmers will benefit in time,
he added. Dr T Madhan Mohan commended the work executed by the Centre even before the
allotted timeframe. Dr Md. Aslam further assured the support of DBT in all capacities and
welcomed possibilities of offshoot partnerships from successful implementation of current
projects. The SAC experts fostered connections with prominent research laboratories to speed
up the implementation of the projects. The SAC also endorsed the suggestions put forward by
the steering committee to the PIs of different projects with regard to technical programme /
methodologies for successful implementation of the projects. The suggestions are stated below:
Project I: Genetic improvement of rice for abiotic and biotic stress tolerance using
molecular breeding, especially drought, submergence and bacterial blight
disease
Research Group: PI: Dr. M. K. Modi
Associates: Dr R. Sarma and Dr. A. Baruah
Suggestions of Steering committee:
1. Alternative approach for validation of QTLs besides qRT-PCR may be used
2. The varietal release process of Phase I should be streamlined and focused
3. Scientific record of the released varieties should be maintained
4. Collaboration with Dr. Ramesh V. Sonti at NIPGR on bacterial blight could speed
up the project as suggested by Dr Mukherjee.
Project II: Genetic improvement of chickpea using gene technology for insect resistance
Research Group: PI: Dr S Acharjee.
Associates: Dr A Baruah and Dr B K Sarmah
Mentor: Dr T J Higgins
Suggestions of Steering committee:
1. Dr Mukherjee suggested revisiting the gene construct maps before final construction. He
suggested using different promoters to express different Cry genes when placed within the
same T-DNA in order to avoid any possible gene silencing. Dr Mukherjee also suggested
use of miRNA gene constructs to control Helicoverpa sp.
Proceedings of 1st SAC meeting 98
DBT-NECAB Annual Report, 2018-19
Project III: Bioprospecting of soil microbes from acidic soils of N E region
Research Group: PI: Dr M Barooah
Associate: Dr R Boro
Suggestions of Steering committee:
1. Project should focus on cloning potential acid tolerance genes from already identified soil
microbes and their validation. High success rate must be properly validated.
2. Interaction of such microbes (acid tolerance) and their interactions with plant functions need
to be studied thoroughly.
3. Bioformulation that imparts tolerance to high concentration of Aluminum and acid should
also be developed in collaboration with biofertilizer group as such formulations have
significant demand in the field
Project IV: Development of efficient biofertilizers using novel strains of N E soils.
Research Group: PI: Dr R Baruah
Associates: Dr T Nath
Suggestions of Steering committee:
1. The enzyme activity of the soil after the treatment of the biofertilizers may be assessed
2. If focus is oriented to acid tolerant bacteria and tolerance to Al and Fe toxicity, lowland rice
farmers may be benefitted
3. Before mass multiplication, strategies for pilot scale demonstration must be optimized
4. Scientific data from the field scale and validation is mandatory before releasing to the
farmers and firms for commercialization
5. The endophytes in tea and rice may be checked if they have any effect as biofertilizers
6. Comparative analyses of AAU biofertilizers and commercial products will be made
7. Novelty of biofertilizing microbes isolated from N E soils will be studied using molecular
and biochemical tools
8. Interaction of biofertilizing microbes with plant system in acidic soils should be studied in
collaboration with Dr M Barooah
Project V: Development of efficient biopesticides using novel strains of N E soils.
Research Group: PI: Dr L C Bora
Associates: Dr P Bora and Dr D Saikia
Suggestions of Steering Committee:
1. Streamline the strategy for the scientific validation of the bioformulations before releasing
them for public use
2. Focus on a logical conclusion from Phase 1. For that the bioformulations generated during
Phase-I should be scientifically evaluated and validated in field conditions
3. Biodiversity issues and off-target impacts have to be addressed before training the farmers
and entrepreneurs
Following the remarks of the Chairman and the SAC experts, the session concluded with a vote
of thanks from Dr B K Sarmah.
(Bidyut Kumar Sarmah)
Statement of Expenditure 99
DBT-NECAB Annual Report, 2018-19
Financial Statement of Expenditure