annual report sept. 2018- sept. 2019dbtaau.ac.in/docs/dbt-necab-annual report 2018-19.pdfdbt-north...

DBT-North East Centre for

Agricultural Biotechnology

(DBT-NECAB)

Annual Report

Sept. 2018- Sept. 2019

Assam Agricultural University

Jorhat, 785013

Assam, India

i

Annual Report Sept. 2018-Sept. 2019

DBT-North East Centre for Agricultural

Biotechnology (DBT-NECAB)

Assam Agricultural University, Jorhat 785013, Assam;

Published by

© DBT-NECAB, Assam Agricultural University, 2019

Annual Report Preparation Committee:

Prof. Bidyut Kumar Sarmah, Chairman

Prof. Madhumita Barooah, Member

Dr. Aiswarya Baruah, Member

Mr. Manab Bikash Gogoi, Member

Dr. Sudipta Sankar Bora, Member

Mr. Rupjyoti Das, Member

Printed at:

Aayan’s World

B. B. Hall Market

Jorhat – 785001, Assam

ii

Acknowledgements

The DBT-NECAB is grateful to

Dr. Ashok Bhattacharyya,

Acting Vice Chancellor

and

Director of Research,

Assam Agricultural University,

for his advice and suggestions

in preparing the report.

We also acknowledge

the help and co-operation received from

Dr. Jayanta Deka, Dean, College of Agriculture;

Dr. Prasanna Kr. Pathak, Director, Extension Education, AAU.

iii

Contents

Scientists Associated and Objectives…………………..……………….1

Focus-Areas of DBT-NECAB ....................................................3

Summary.................................................................................. 5

Scientific Report (as per approved objectives) ........................ 9

Programme Objective I ................................................................... 11

Programme Objective II ................................................................ 27

Programme Objective III ............................................................... 39

Programme Objective IV a ............................................................. 55

Programme Objective IV b ............................................................. 67

Academics .............................................................................. 75

Human Resource Development and Capacity Building ................. 77

Training and Awareness ................................................................ 80

Projects through Extramural Grants .............................................. 85

Proceedings of 1st SAC meeting ............................................... 93

Financial Statement of Expenditure ...................................... 99

DBT-NECAB Annual Report, 2018-19

Scientists Associated 1

Scientists Associated

Dr. Bidyut K Sarmah, Director and Project Coordinator (DBT-NECAB)

Programme Objective I:

Genetic improvement of rice for abiotic and biotic stress tolerance using

molecular breeding, especially drought, submergence and bacterial blight disease

Dr. M. K. Modi, Prof. & Head, Dept. of ABT, AAU (Principal Investigator)

Dr. R. N. Sarmah, Prof., Dept. of Plant Breeding and Genetics

Dr. A. R. Baruah, Assistant Prof., Dept. of ABT, AAU

Dr. T. Ahmed, RARS, Titabar

Dr. S. Chetia, RARS, Titabar

Programme Objective II:

Genetic improvement of chickpea using gene technology for insect resistance

Dr. Sumita Acharjee, ABT, AAU, Jorhat (Principal Investigator)

Dr. T J V Higgins, CSIRO, Australia (Collaborator)

Dr S. Singh, PAU; Dr I S Katageri, UASD (Collaborators)

Programme Objective III:

Bioprospecting of soil microbes from acidic soils of N E region

Prof. Madhumita Barooah, Dept. of ABT (Principal Investigator)

Dr Robin C. Boro, Dept. of ABT, AAU

Programme Objective IV:

Development of efficient biofertilizers and biopesticides using novel microbial strains from NE soils.

a. Biofertilizers:

Dr. Rajen Baruah, Dept. of Soil Science, AAU (Principal Investigator)

b. Biopesticides:

Dr. L. C. Bora, Dept. of Plant Pathology (Principal Investigator),

Dr. D. K. Saikia, Principal Scientist, Dept. of Entomology, AAU

Dr. Bharat Chandra Nath, Asst. Prof., Dept of Plant Pathology, AAU

Focus Areas 2


3

Focus-Areas of DBT-NECAB

Research and development:

1. Allele/QTL mining and molecular breeding for stress tolerance

2. Gene technology for crop improvement

3. Gene prospecting from soil microbes

4. Generation of novel biofertilizers and biopesticides

Academics:

Human resource development

Extramural Grants obtained by Scientists Associated with the Centre

Recognitions to our scientists/researchers

Extension Services through Satellite Laboratories:

Promote Organic Farming in the NE region through provisioning of bioinputs

(Biopesticides and Biofertilizer) and also through providing trainings to the farmers and

entrepreneurs.

Summary

Summary 6


7

Highlights of Research, Academic and

Service Activities

Research and development (Salient findings)

Gene mining and molecular breeding of rice for biotic and abiotic stresses:

• Phenotyping of 300 Ahu rice germplasms for drought completed

• Phenotyping of 290 Sali rice germplasms completed, where submergence tolerant

lines identified; attempt to identify the gene(s)/QTL(s) responsible for the same in progress

• A total of 7 QTLs for yield and yield attributing traits identified from Banglami x Ranjit

Cross

• F6 generation of Banglami x Ranjit is phenotyped; Fine mapping of 7 identified QTLs in

progress

• BLB resistant gene incorporated into Luit and Dishang varieties. BC2F4 lines in the field

Bt Chickpea development:

• Redesigning of chloroplast targeted Bt gene constructs for IR chickpea

• Establishment of transformed lines using existing pBK203 (truncated Cry1Ac) and pBK209

(full-length Cry1Ac gene driven AraSSU promoter) binary vectors

• Marker-Assisted backcross breeding performed to introgress Cry1Ac Gene from transgenic

chickpea lines into cultivated chickpea varieties, PBG 7 (Desi) and L 552 (Kabuli) for

resistance to Helicoverpa armigera

• Comparative nutritional assessment, seed storage proteins profiling, and in-vitro protein

digestibility (using the simulated gastric fluid) performed to assure that homozygous progeny of

two lines, Cry1Ac.1 and Cry1Ac.2 lines are as safe as the non-transgenic chickpea

• Screening of Soil Microbes for Acid Tolerance Gene:

• Functionality of five up-regulated genes viz., spoA, proA, proC, cupin and gad have

been validated through site-directed mutagenesis

• Evaluation of promising PGP bacterial isolates in improving soil health, promotion of plant

growth and plant protection under progress

Biofertilizer:

• Successfully isolated compost accelerating bacteria from gut of white grub beetle

Lepidiota mansueta with cellulose degrading property

• Successfully started Mass multiplication of Arthospira platensis

Biopesticides:

• Important bio-agents isolated for biopesticides production: Trichoderma harzanium;

Trichoderma viride; Pseudomonas fluorescens; Metarhizium anisopliae; Beauveria

bassiana; Verticillium lecanii; Bacillus thuringiensis; Trichoderma parareesei;

Paecilomyces fumosoroseus; Aspergillus tamarii.

• Talc based bioformulations: Bio-Time; Biozin-PTB; Bio-Sona; Bio-llium, Bio-Meta; Bio-

Zium; Bio-veer; Biogreen; Biogreen-L; Organic based: Biofor-P

Summary 8


Total publication:

• Twenty-nine literatures (9 original research articles, 2 book chapters and 18 lecture notes)

published in different national and international journals by the scientists under the DBT-

NECAB

Hand-Books published:

• Six hand books/booklets published under various R&D programmes under the DBT-

NECAB

Conference presentation:

• Five research papers presented in different national and international conferences and

bagged first and third prizes. All papers published in the proceeding of the concerned

symposiums

Extramural grants obtained:

• Seven ongoing extramural projects under the scientists of DBT-NECAB from different

funding agencies like DBT, ICAR etc. with a total grand of Rs. 695.9 Lakhs.

Scholarship awarded:

• During this period seven Ph.D. scholars availed the PhD fellowship offered by DBT-

NECAB on merit basis.

Academic degree obtained:

• Nine M. Sc. and six PhD students obtained their degrees. One more PhD student already

submitted his thesis and supposed to obtain the degree during the current session.

Workshop conducted:

• The Inaugural Ceremony of DBT-NECAB and First Scientific Advisory Meeting held on

November 19-20, 2018

• An International Symposium on ‘Biotechnology for Food-Nutritional Security Organic

Agriculture’ held on March 25-26, 2019

• A National Workshop on ‘Potential Biotechnology Programmes Using Bioresources of the

NE Region’ held on September 12-14, 2019

Training to farmers and entrepreneurs:

• Seven (7) entrepreneurs trained on commercial production of Bio-inputs

• Eighteen (18) Small Tea-Growers (STGs) trained on organic agriculture

Training to the students and research scholars:

• Two Fellows (Dr. Sushil Kumar Singh, Mrs. Sandhani Saikia) participated in a short-term

training on NGS data analysis (4th March to 16th March 2019)

MOU signed with private / public partners for technology transfer:

• MoU signed with following enterprises to transfer the biopesticide production technology developed by Biopesticide lab of DBT-NECAB Centre under PPP mode-

• VRS Agritech, Guwahati

• School of Livelihood & Rural Development (SLRD), Shillong

• M/s Orgaman R&D Division, Jorhat


Scientific Reports


Scientific Repor

Scientific Report 11


Programme Objective I

Objective: Genetic improvement of rice for abiotic and biotic stress tolerance using


Background and Rationale: Rice is one of the most important food crops consumed by almost half of the world’s

population. Globally 90% production of rice is in Asia, India is the second-largest producer

of rice. Rice is the staple food for more than 50% of the population in Asia, and South Asia.

Rice is the staple crop for more than 70% of the Indian people, and every day millions of

Indian finds comfort in it.

In Assam, rice is grown throughout the state in a wide range of seasons, soil types and

water regimes. On average, Assam receives 2586 mm of rainfall of which 650 mm is during

the summer (March-May) and 1702 mm is during monsoon session (July-September). But the

state is prone to rainfall deficiency to a tune of 40% according to economic survey of Assam

for 2013-14. Rainfed summer or ahu rice suffers from prolonged drought due to late arrival

of monsoon while transplanted Sali (June/July-October/November) is affected by intermittent

drought due to rainless periods during growing stages of the crop. Drought causes substantial

yield loss in rice when it occurs in the panicle initiation stage of the crop. According to the

Economic Survey of Assam, 2013-14, the total land covered under assured irrigation through

shallow tube wells (STWs) & low lift point irrigation system (LLPs) is 5.78 lakh ha (21% of

Net Cropped Area). Thus, rice in Assam, being a rainfed crop, suffers from water scarcity in

different stages of crop growth. In recent times, summer rice is gaining popularity in Assam

in the area under irrigated flood-free ecology with the increased provision of STW to a tune

of 5.84 lakh ha under STWs and LLPs (Economic Survey of Assam, 2014-15). However, in

the long run, an increased provision of irrigation might not be economically viable if all the

cost of providing water to the rice field is considered (cost of power for irrigation, cost of

runoff water etc.).

The convergence of enormous population growth, climate change, water shortage, and

global warming is expected to threaten agriculture and food security. Increasing incidences of

biotic and abiotic stresses under changing climate are major constraints to meet the ever-

growing demand for food and rapidly escalating population attain global food security. Severe

yield loss due to various biotic stresses like bacterial leaf blight (BLB) and Blast (disease) and



abiotic stresses like submergence and drought are serious constraints to rice productivity

throughout the world. Therefore, it has become necessary to fortify the popular varieties with

genes/QTL’s that can impart tolerance to various biotic and abiotic stresses.

Genome-Wide Association Studies (GWAS) is regarded as a rapid approach of

identifying genes associated with phenotypic traits and to provide markers for these genes for

marker-assisted breeding. The identification of major QTL’s for drought, submergence

tolerance and several QTL’s for resistance against BLB and Blast in rice has provided new

opportunities for breeders to develop varieties that are tolerant against these biotic/abiotic

stresses.

Specific Objectives:

Objective 1. Identification of new QTL/candidate gene for tolerance to water stress from

local rice germplasm

a. Genome-Wide Association studies:

Under this programme, we aimed to identify markers tightly linked to traits contributing to

drought tolerance from among 250 diverse rice germplasm of Assam in the ahu season. The

principal goal of association approaches is to determine the importance of various loci or

regions of the genome on the expression of single or multiple traits.

The 250 ahu rice cultivars were evaluated for various yield traits including Sahbhagi

Dhan, Dehangi and Banglami as drought-tolerant checks and IR64 and Lachit as susceptible

checks under two different hydrological conditions viz., irrigated control (Table 2) and

artificial drought stress (Table 1) created in rainout shelter during ahu season (February 2019

– July 2019) in the experimental fields of RARS, Titabar (Plate 1) following Augmented

Randomized Block Design (Federer, 1986).

For drought stress trial, seeds were hand dibbled in dry soil. After 45 days of

emergence, uniform plant stand was maintained by thinning and gap filling. However, under

irrigated (non-stress) conditions, 45-day old seedlings were transplanted in the main field. A

single seedling was transplanted with 20 cm spacing between the hills in the row. While the

control plots were irrigated regularly to the field capacity, the drought stress plots were

irrigated by sprinkler twice a week during establishment and early vegetative growth. The

drought stress was imposed during panicle initiation to panicle emergence period

(reproductive stage withholding irrigation). The plots were irrigated only when soil water

tension fell below -50kPa and moisture content to 10% at 30 cm of soil depth, which was

measured by TDR meter (Time domain reflectometry).



Plate 1. Screening of 250 Ahu rice cultivars in rainout shelter at RARS, Titabor

Data on days to 50% flowering, number of tillers, number of productive tillers, plant

height, panicle length, spikelet fertility (Plate 3), total biomass, harvest index, grain yield per

plant (Plate 2), relative leaf water content (Plate 4) and leaf rolling score were recorded. Based

on overall characteristics 'Koni Ahu' was found to be the best performing line under drought

condition. As such, Koni Ahu can be used as a parental line in future drought breeding

programme.

Plate 2. Grain yield/plant in Ahu rice cultivar



Plate 3. Spikelet fertility percentage in Ahu rice cultivar

Plate 4. Relative Leaf Water Content in Ahu rice cultivars under drought



Table 1. Mean performance of accessions under Drought stress condition

TRAITS MEAN SD CV CD Min Value Max VALUE

DFF 100.30 13.03 1.20 1.74 78.00 144.00

PH 84.61 18.74 0.90 1.02 38.35 140.05

NOT 4.44 2.02 4.49 0.88 1.16 13.62

NPT 3.12 1.53 11.8 3.10 1.00 14.11

SF 26.72 9.41 15.7 6.10 6.52 49.45

HI 25.68 10.41 25.6 10.55 4.57 44.64

GYP 3.30 1.29 20.5 1.05 0.96 7.89

RLWC 40.89 13.42 1.30 0.79 21.76 84.02

TBM 13.66 4.45 10.2 1.88 7.76 41.05

PL 18.52 3.29 1.7 0.45 7.70 27.53

LR 3.50 2.16 - - 1.00 7.00

Table 2. Mean performance of accessions under Irrigated condition

TRAIT MEAN SD CV CD Min Value Max VALUE

DFF 107.69 11.38 1.6 2.4 80.00 138.00

PH 108.13 17.06 1 1.5 57.00 149.66

NOT 10.93 2.33 17 2.61 5.66 16.66

NPT 8.87 2.13 18.9 2.3 4.66 15.00

SF 70.07 15.43 9.5 9.41 16.04 94.91

HI 32.30 7.80 17 7.95 11.34 45.66

GY/P 9.28 3.11 12.5 1.66 4.27 22.80

RLWC 63.33 13.67 1.5 1.34 25.00 96.77

PL 22.96 3.19 1.5 2.4 14.00 31.33

TBM 30.30 11.72 23.4 9.94 11.72 86.87

DFF- Days to 50 per cent flowering, PH- Plant height (cm), NOT- number of tillers per plant, NPT –

number of productive tillers per plant, SF- Spikelet fertility(%), HI –Harvest index(%), GYP- Grain

yield per plant, RLWC- Relative leaf water content, PL- Panicle length(cm), TBM- Total biomass.

Genotyping of all the 250 ahu rice cultivars is being pursued through GBS. DNA samples have

already been sent for sequencing and data is awaited. Bioinformatic analyses will be carried out to

identify molecular markers tightly linked to QTL’s associated with character contributing drought

tolerance after one more season of phenotyping to get a more accurate result.

Identification of QTL’s for submergence tolerance through GBS

An experiment was designed to conduct submergence screening of different Sali varieties

during Kharif 2019. A total of 291 Sali germplasms from Kharif 2018 were collected from

Regional Agricultural Research Station, Titabar to be used in this study. Three tolerant checks

namely FR13A, Ranjit Sub1, Swarna sub 1 and 3 susceptible checks - Ranjit, IR42 and Swarna



were used. They were allowed to germinate in a 10x10x2m submergence tank via the direct seeded

method. The experiment was set up in the Augmented Design with eight blocks (Plate 5 & 6)

consisting of 42 germplasm lines and checks. The checks were placed at random in each block.

After 20 days from the date of sowing, the germplasms were subjected to an initial submergence

stress of 8 days and the water level was maintained at 100cm. After the above-mentioned period

of stress, excess water was removed and the germplasms were then allowed to stay in the de-

submerged condition for 10 days. The plants were re-submerged for another period of 15 days.

This was followed by a de-submergence period of 10 days. The survival rate was recorded after

the second de-submergence period. Every germplasm lines and checks died out after the second

round of submergence except for two lines. Line no 89 (Plate 7) and line no 135 (Plate 8) were the

only lines that have survived. None of the checks has survived the second submergence stress.

Since there are only two extreme variants in the desired phenotype Marker-Trait

Association analysis is not feasible and we need to develop a bi-parental mapping population to

identify the submergence linked novel QTLs.

Plate 6: During the initial growing

phase just before the induction of stress

Plate 5: Preparation of sowing

Block in submergence tank



Future line of work:

Molecular screening of both Line 89 and Line135 for Sub1 allele with FR13A and Ranjit

as tolerant and susceptible check respectably is being done. Line 89 and Line135 will be crossed

to a susceptible cultivar to develop bi-parental mapping population for mapping new QTL’s

followed by fine mapping of QTL’s to identify candidate gene.

a. Fine mapping of identified QTL’s:

Fine mapping and discovery of candidate genes associated with drought-tolerant traits are

important for the development of rice cultivar tolerant to low water stress. Here, by using a high-

resolution genetic map and genome-wide genetic variation detection aided by genome survey

sequencing, we aimed to fine map 7 (seven) already identified QTL's in the F2 generation and

discover candidate genes associated with drought-tolerant traits. F5 population derived from Ranjit

x Banglami was advanced to F6 generations plants. F6 population plants were grown in both

irrigated field condition (Plate 9) as well as drought stress condition in rainout shelter (Plate 10)

at RARS, Titabar. While the control plots were irrigated regularly to the field capacity, the drought

stress plots were irrigated by sprinkler twice a week during establishment and early vegetative

growth. The drought stress was imposed during panicle initiation to panicle emergence period

(reproductive stage withholding irrigation). The plots were irrigated only when soil water tension

fell below -50kPa and moisture content to 10% at 30 cm of soil depth. It was measured by TDR

meter (Time domain reflectometry).

Data on days to 50 per cent flowering, number of tillers, number of productive tillers, plant

height, panicle length, spikelet fertility, total biomass, grain yield per plant, leaf rolling and leaf

burning score were recorded.

Plate 7: Line 89 growing after the

second round of de-submergence

Plate 8: Line 135 growing after the

second round of de-submergence



Plate 9. Screening of F6 population of a cross between Ranjit x Banglami in irrigated field condition

Plate 10. Screening of F6 population of a cross between Ranjit x Banglami in rainout shelter

Genotyping of these lines will be done through GBS. For this purpose, 190 lines from F6

population are being sent for sequencing. Single nucleotide variation among 200 lines will be

used for marker-trait association studies to finally fine map QTL’s.

Candidate gene identification - bioinformatics approach

The main aim of this study is to identify the likely candidate genes in the QTL's identified from

the F2 population of a cross between drought-tolerant line Banglami and susceptible line Ranjit.

For that purpose, the whole genome sequencing of the parents has been carried out. The

sequencing data generated using Oxford Nanopore and Illumina paired-end library from Ranjit

have already been assembled using a hybrid assembly approach (Plate 11) and the results are

given below:

N50: 9, 59,109

Number of scaffolds: 1295

Total Coverage: 401.87 Mb



Plate 11: Sequence quality of Ranjit genome

For Banglami we already have some Illumina and 454 sequence data and some Oxford

Nanopore data is being generated. Once we have both the assemblies at hand, the regions

spanned by the QTLs identified by Verma et al. (2017) will be analyzed and probable candidate

genes will be flagged for validation in the wetlab.

Objective 2: Introgression of existing major water stress tolerance (drought and

submergence) and disease resistance (BLB and Blast) QTLs into the important rice

varieties of Assam.

a. Molecular breeding for Blast and BLB tolerance:

Jayamati is a popular Boro variety of Assam and Improved Ranjit (Ranjit-Sub1) is rapidly

replacing the mega variety Ranjit. However, both these varieties are susceptible to BLB and

Blast diseases. We already know that in Assam condition the genes xa5, xa13 and xa21 are

enough to counter the BLB disease. Almost 100 major blast resistant genes have been identified

and mapped among which Pi2 and Pi54 are the major genes which confer resistance to both

Neck Blast as well as Leaf Blast (Personal Communication with Dr Seshu Madhav, ICAR-

IIRR). An improved Samba Mahsuri line (MSM-BLBB) has been obtained from ICAR-IIRR

and parental polymorphism survey has been done across the parental lines using marker linked

to the 2 Blast and three BLB resistant genes to study the allelic distribution in the parents.

Foreground selection and Recombinant selection will be applied in F1, BC1F1 & BC2F1

populations. Background selection will be applied in BC1F1 and BC2F1 populations and self for

introgression of Pi54 and three BLB resistant genes xa5, xa13 and Xa21 into Jayamati and

Ranjit Sub1 background.

In RARS, Titabor, the boro rice variety, Jayamati was crossed with CB14001 for

introgression of BLB and blast resistance genes. All the F1 plants were germinated in the

greenhouse and allowed to screen for true F1 using foreground markers for Xa21, xa13 and xa5



genes. It was found that only 4 plants (P-2, P-9, P-17 and P-22) out of 28 F1 plants showed

heterozygous banding pattern (Plate 12) and hence established the true F1 hybrids. Backcrossing

with Jayamati is being attempted in this Boro season to get BC1F1.

Plate 12: Gel picture of F1plants (Jaymati X CB14001) showing amplification of genes Xa21, xa13

and xa5. Where, L= 100bp ladder and red * indicate heterozygous band.

b. Molecular breeding for BLB, Drought and Submergence tolerance

Drought is one of the most important abiotic stresses causing drastic reductions of grain yield

in rainfed rice environments. Two popular short-duration rice varieties of Assam viz; Disang

and Luit were reported susceptible to biotic stress BLB and abiotic stresses drought and

submergence. These two varieties were crossed with IRBB60 to introgressed BLB resistance

genes Xa21, xa13 and xa5 and a BC2F2 population were developed (2014-2018). BC2F3

population were developed from BC2F2 (March 2019-august 2019). Foreground selection was

carried out in BC2F3 population plants. A total of 17 lines were found to be homozygous positive

for all the three BLB resistance genes xa5, xa13, and Xa21 as shown in plate 13, plate 14 and

plate 15 respectively.



To identify best lines for further release of BLB resistance variety, phenotypic evaluation

of selected 17 homozygous lines were done in BC2F3 generation. Out of 17 homozygous lines

only 13 lines properly germinated in the field. These lines were grown in the experimental field

of ICR farm and allowed to self for the generation of B2F4 lines along with the selection of

better plants with good agronomic traits. Grain quality parameter will be done after harvesting

of plants. For the determination of yield penalty under biotic stress condition pathological

screening in required, however, pathological screening was not conducted in the same field for

evaluating phenotypes and hence, will be done in next season in a separate field of RARS,

Titabor, specially designated for pathological screening.

For successful development and release of BLB resistance rice variety, phenotypic

Plate 13. Screening of homozygous plants for xa5 gene M= 100bp ladder, 1=

IRBB60, 2= Luit, 3=Disang, 4-40=BC2F3 plants

Plate 14. Screening of homozygous plants for xa13 gene M= 100bp

ladder, 1= IRBB60, 2= Luit, 3=Disang, 4-43=BC2F3 plants

Plate 15. Screening of homozygous plants for Xa21gene M= 100bp

ladder, 1= IRBB60, 2= Luit, 3=Disang, 4-41=BC2F3 plants



evaluation of agronomic traits is required. The phenotypic evaluation of plant height (Table 3)

determined that all the 13 selected line showed shorter height than their parents with the

minimum value of 46.5 cm in line L-24 whereas the maximum of 64.5 cm in line L-16. The

average lowest plant height of 50.5 cm in line L-11 and maximum of 61.42 cm in line L-23.

The characteristic of Panicle length (Table 4) showed the lowest value of 13 cm in line L-11

and D-73 while a maximum of 21.5 cm in line L-23. The average maximum of 17.96 cm in L-

29 and a minimum average of 14.5 cm in L-11. The characteristic of number of tillers (Table

5) showed the lowest value of 5 tillers in L-24 and maximum of 20 tillers in L-23 the minimum

average of 9 tillers in L-11 and a maximum average of 12.67 tillers in L-23 and L-24. Similarly,

the characteristic of an effective number of tillers (Table 6) showed a minimum number of 4

tillers in L-12 and the maximum number of 11 tillers in L-25. The minimum average of 6 tillers

in D-73 and a maximum average of 14.33 tillers in L-25. From these results, we will select the

best plant showing good plant type along with greater grain quality and allowed to self for the

generation of BC2F5 Plants.

Table 3. Phenotypic evaluation of Plant height

Cultivar Min Max Mean SD CV

Disang 60 73 67.83 4.435 6.54%

Luit 60 75 70.08 5.435 7.76%

IRBB60 68 83 76.67 5.279 6.89%

L11 47.5 54 50.5 3.279 6.49%

L12 49.5 57 53.58 2.746 5.13%

L16 50 64.5 55.58 4.944 8.89%

L17 61 64 62.5 1.5 2.40%

L21 58 63.5 60.33 2.229 3.69%

L22 51 59 54 4.359 8.07%

L23 54.5 67 61.42 5.219 8.50%

L24 46.5 59 56.33 5.017 8.91%

L25 54 60 57.75 2.185 3.78%

L26 55 66 59.85 4.406 7.36%

L27 54.5 62.2 57.27 2.738 4.78%

L29 56 67 60.5 3.834 6.34%

D73 59.5 63 61.17 1.756 2.87%



Table 4. Phenotypic evaluation of Panicle length


Disang 15 18 16.5 1.265 7.67%

Luit 15.5 20 17.67 1.571 8.89%

IRBB60 16 20.5 18.15 1.648 9.08%

L11 13 15.5 14.5 1.323 9.12%

L12 14 17 15.8 1.175 7.44%

L16 16 20 17.5 1.414 8.08%

L17 15.5 19 17 1.803 10.60%

L21 15.25 20 17.21 1.631 9.48%

L22 14.5 18 16.17 1.756 10.86%

L23 13.5 21.5 18 2.66 14.78%

L24 14.5 19.5 17 1.732 10.19%

L25 14.5 19 17.25 1.782 10.33%

L26 15.5 20 17.58 1.882 10.70%

L27 13.5 18 16.63 1.701 10.23%

L29 15.5 21 17.96 2.193 12.21%

D73 13 17 14.67 2.082 14.19%

Table 5. Phenotypic evaluation of Number of Tillers


Disang 9 22 15.5 4.764 30.74%

Luit 6 13 9.333 2.422 25.95%

IRBB60 8 20 14.33 4.59 32.02%

L11 8 10 9 1 11.11%

L12 7 15 9.667 3.327 34.41%

L16 8 18 12.5 4.135 33.08%

L17 6 15 11 4.583 41.66%

L21 9 16 12.17 2.317 19.04%

L22 6 17 12.67 5.859 46.26%

L23 8 20 12.67 4.082 32.23%

L24 5 18 11.5 5.089 44.25%

L25 11 19 15 2.757 18.38%

L26 6 11 8.333 2.251 27.01%

L27 7 14 10.17 2.317 22.79%

L29 8 11 9.5 1.225 12.89%

D73 7 9 8.333 1.155 13.86%



Table 6. Phenotypic evaluation of Effective Number of Tillers


Disang 9 20 15.17 4.262 28.10%

Luit 6 12 9.167 2.137 23.31%

IRBB60 8 19 13.5 3.987 29.54%

L11 7 9 8 1 12.50%

L12 4 12 7.5 2.811 37.48%

L16 8 18 11.83 4.167 35.22%

L17 6 13 9.667 3.512 36.33%

L21 9 16 12 2.28 19.00%

L22 5 17 12.33 6.429 52.13%

L23 8 20 12.33 4.033 32.70%

L24 5 16 10.67 4.179 39.18%

L25 11 17 14.33 1.966 13.72%

L26 6 11 8.167 2.041 24.99%

L27 7 13 9.833 1.941 19.74%

L29 7 11 8.333 1.506 18.07%

D73 5 7 6 1 16.67%

To develop both abiotic and biotic stress tolerance rice variety, efforts were made to

introgressed submergence and drought tolerance QTLs into BLB resistance genes pyramided

rice lines of variety Luit and Disang. The crosses are being made between three BLB gene

homozygous lines from (Luit x IRBB60 and Dishang x IRBB60) and donor of submergence

and drought tolerance, CR DHAN-801. Initial screening as well as polymorphism studies for

SUB1 gene and Drought tolerant QTL’s qDTY1.1, qDTY2.1, qDTY3.1 is done in donor CR

Dhan 801 and also in two parental lines Luit and Dishang using QTL linked markers (Table 7,

Plate 16). Foreground and recombinant selection will be applied in F1, BC1F1 & BC2F1

populations. Background selection will be applied in BC1F1 and BC2F1 populations and self to

introgressed Sub-1 and qDTY1.1, qDTY 2.1, qDTY3.1 into Luit and Disang background.



Table 7. List of QTL linked markers for foreground and recombinant selection.

QTLS linked Marker Forward primer Reverse primer

qDTY1.1 RM315 GAGGTACTTCCTCCGTTTCAC AGTCAGCTCACTGTGCAGTG

RM11943 CTTGTTCGAGGACGAAGATAGGG CCAGTTTACCAGGGTCGAAACC

RM431 TCCTGCGAACTGAAGAGTTG AGAGCAAAACCCTGGTTCAC

RM12023 TGCGTACCTCTGCTCCTCTCTGC GACGAAGCCGACCAAGTGAAGC

RM12233 CTTGAGTTCGAAGCGAGAAGACG CACTTGAGCTCGAGACGTAGCC

qDTY2.1 RM5791 GAAGCAGAATACGCTTTCGC ACGTCACAAAGGGTTCTTGC

RM327 CTACTCCTCTGTCCCTCCTCTC CCAGCTAGACACAATCGAGC

RM521 TTCCCTTATTCCTGCTCTCC GGGATTTGCAGTGAGCTAGC

RM3549 GATCCTCCACACCCAACAAC AACGAACGACCAACTCCAAG

RM324 CTGATTCCACACACTTGTGC GATTCCACGTCAGGATCTTC

RM6374 TGAGGACGCTGATTGTCAAC GCTGCCCCTATTATTTCACC

RM424 TTTGTGGCTCACCAGTTGAG TGGCGCATTCATGTCATC

qDTY3.1 RM15791 AGTAAGTTTGCCGCGGAGGAAGC CTCCTTGTCGATCACCACCATCG

RM416 GGGAGTTAGGGTTTTGGAGC TCCAGTTTCACACTGCTTCG

RM16030 GCGAACTATGAGCATGCCAACC GGATTACCTGGTGTGTGCAGTGTCC

RM520 AGGAGCAAGAAAAGTTCCCC GCCAATGTGTGACGCAATAG

Sub1 ART5 CAGGGAAAGAGATGGTGGA TTGGCCCTAGGTTGTTTCAG

Plate 16. Parental polymorphism survey was done across the parental lines using markers linked to

QTL 1.1, QTL 2.1, QTL 3.1 and Sub1 Where, M=100bp ladder, 1=CR DHAN 801, 2=Luit, 3=Dishang

Publications:

No recent publications yet.

Scientific Report: 27


Programme Objective II

Objective: Genetic improvement of chickpea using gene technology for insect resistance

Rationale:

Helicoverpa armigera is a significant insect pest of chickpea, causing complete damage to

the crop under favorable conditions for insect infestation. In proof-of-concept studies, we

optimized the genetic engineering method for chickpea and established several (>150)

transgenic lines expressing either Cry1Ac or Cry2Aa and selected lines based on their level of

expression, copy number, and insect mortality. The lines were incorporated into an

introgression breeding program at Punjab Agricultural University, Ludhiana; University of

Agricultural Sciences, Dharwad and The Sungro Seeds, New Delhi.

The lines expressing high levels (>50 ng/µg FW) of the Cry1Ac gene were resistant to

Helicoverpa. The phenotypes of the homozygous progeny were similar to the non-transgenic

counterpart. The lines expressing high levels (>120 ng/µg FW) of the Cry2Aa gene conferred

complete resistance; however, there was fitness cost associated with the level of expression.

Therefore, we plan to redesign the constructs to alleviate the phenotypic drag by targeting the

protein to plastid using a plastid transit peptide.

In India, Bollgard I (harbours cry1Ac gene) and II (harbours Cry1Ac and Cry2Ab genes)

cotton have been planted over a decade now; therefore, it is unlikely that chickpea having a

single Bt gene would be deregulated due to growing concerns about the evolution of resistance

in the Helicoverpa. The best options available to us for enhanced Insect Resistance

Management (IRM) in the field are; (a) pyramiding multiple Bt genes in chickpea by inserting

multiple Bt transgene cassettes, or (b) use breeding stacks the introgression breeding of different

Bt lines with different modes of action to Helicoverp

Under Phase- II (DBT-NECAB) of our programme, we aimed to generate pyramided IR

chickpea having both Cry1Ac and Cry2Aa genes in a single locus in the genome. We also

initiated a detailed characterization of selected Bt chickpea lines generated in the Phase-I (DBT-

AAU Centre). We determined the levels of Bt gene and selectable marker gene in various

tissues, presence of any vector backbone sequences, including the nutritional composition of

seeds compared to their non-transgenic counterpart.



Specific Objectives of Phase-II

I. Development of transgenic chickpeas using various versions of Bt genes (Cry1Ac, Cry2Aa,

and Vip) to confer protection against pod borers.

II. Generate information to T-DNA flanking sequences, levels of transgenic protein(s),

transgene(s) stability and transmission, homozygosity, and phenotype of lines

III. Collaborate with public partners within India and its neighboring countries for

introgression breeding programs and biosafety assessments using stable Bt-chickpea lines

to identify lines for evaluation through BRL trials.

Progress of Phase-II

a. Redesigning of chloroplast targeted Bt gene constructs for IR chickpea

When a codon-optimized Cry2Aa gene was expressed in chickpea cytosol we observed

abnormalities in plant development and fertility (Acharjee et al. 2010). Therefore, we have

resynthesized Cry2Aa gene to target it to plastids using a chloroplast transit peptide (CTP).

The chloroplast-targeting sequence, CTP, from the Arabidopsis Rubisco SSU 1A gene was

previously described (Wong et al., 1992). The CTP element consisted of the 55-amino acid

SSU chloroplast-targeting sequence plus the N-terminal 24 amino acids of the Rubisco SSU

protein. The native transit peptidase cleavage site at the junction of the targeting sequence and

the SSU sequence was preserved, and a second peptidase cleavage site with the CTP. The

sequence was ligated at the 5’ end of the Cry2Aa gene. A binary vector named pBK212 was

created having chloroplast targeted Cry2Aa gene driven by Arabidopsis Rubisco SSU 1A gene

promoter and Tobacco SSU gene terminator.

A second construct was also designed having the Cry2Aa gene cassette of pBK212 and a full-

length Cry1Ac gene regulated by CaMV 35S promoter. Both Bt genes were targeted to the

plastids using the above CTP sequences. The full-length Cry1Ac gene was used to enhance

the expression and also to ease the regulatory hurdles because commercial Bt soybean has a

full-length Cry1Ac gene targeted to plastid.

Fig. 1. Chloroplast targeted Cry gene expression cassette for the generation of Insect Resistant

(IR) chickpea



The above constructs (Fig. 1) were electroporated into Agrobacterium strain, AGL1 and used

for infiltration in Nicotiana benthamiana leaves to detect the transient expression of the Bt

genes and the selectable marker gene, nptII. After agroinfiltration leaves were collected and

total proteins were extracted for quantification by ELISA (Agdia Kits). We have observed the

expression of Bt genes and nptII gene in the N. benthamiana leaves (Table 1). The constructs

are now being used for the generation of transgenic chickpea lines.

b. Generation of Bt chickpea lines

The genetic transformation of chickpea was carried out using both existing and new constructs.

So, far we have established a few transformed lines using existing pBK203 (truncated

Cry1Ac) and pBK209 (full-length Cry1Ac gene driven AraSSU promoter) binary vectors,

respectively (Table 2). The highest (51 ng/ µg FW) level of expression of the full-length

Cry1Ac gene was recorded in the line 19-91A.

Table 2: Characterization of lines generated using pBK203 and pBK209

Sl.

No

Line Name

Construct PCR ELISA

Cry1Ac

1 19-83A pBK203 + 11.2

2 19-83C pBK203 + 0

3 19-82A pBK209 + 31.5

4 19-82D pBK209 + 15.0

5 19-91A pBK209 + 51.0

We have generated lines using the 2Bt gene construct pBK213 and performed molecular

analyses in a few lines to know the presence of transgene and levels of Bt proteins (Table3).

The line 19-86B expressed high both Cry1Ac and Cry2Aa compared to other lines established.

The generation of more chickpea transgenic lines using pBK213 is in progress.

Table 1: Agroinflitration of N. benthamiana followed by ELISA to quantify transient

protein expression

Constructs Protein concentration (ng/µg FW)

Cry2Aa Cry1Ac nptll

pBK212 28.0 - 0.368

pBK213 10.2 50.9 0.450



Table 3: Characterization of lines generated using pBK213

c. Detailed molecular characterization of existing chickpea lines

i. Concentrations of Cry 1Ac and nptII protein in transgenic chickpea

The concentration of the transgenic proteins (Cry1Ac and nptII) was determined by the

Enzyme-Linked Immunosorbent Assay (ELISA). Total leaf proteins were isolated from the

homozygous Cry1Ac. The samples of leaf, flower, stem, pod, green cotyledon and dry seeds

were collected from the homozygous Cry1Ac and total proteins were extracted and used for

ELISA.

The highest level of Cry1Ac protein was detected in the flowers (100B; 94.5 µg/ g FW, and

100E; 126 µg/ g FW) followed by leaves (100B; 88 µg/ g FW, and 100E; 120 µg/ g FW). The

accumulation of Cry1Ac protein was found immature pods and stem, while very low levels of

Cry1Ac protein was detected in the roots and dry seeds (Table 4).

Table 4. The concentrations of Cry1Ac protein accumulation in the various tissues

of transgenic chickpea lines, 100B and 100E

Tissue Samples Cry1Ac protein (µg/g FW)

100 B 100E

Leaf 88 120

Stem 23 35

Flower 94.5 126

Pod 23 15

Immature Cotyledons 41 62

Root 0.22 0.54

Dry Seeds 1.1* 3.15*

*The concentration in the dry seed is calculated as microgram per gram of dry weight.

Sl.No Line

Name

PCR ELISA

Cry1Ac Cry2Aa

1 19-92A + 3.6 0

2 19-90C + 5.2 1.7

3 19-85A + 3.8 4.8

4 19-85H + 1 1.5

5 19-86B + 30 12.3

6 19-82A + 1.4 1.7

7 19-98B + 1.6 1.7

8 19-104D + 7.9 6.2

9 19-90E + 5.2 4.26



The average concentrations of the nptII protein in the various tissues of transgenic lines were

determined. The highest nptII protein was detected in stem ranging from 0.33 to 0.45 µg/ g FW.

The nptII protein was not detected in pods, immature cotyledons and roots; however, the nptII

protein accumulated in the dry seeds (Table 5).

Table 5. The concentration of nptII protein in the various samples of transgenic

chickpea lines

Tissue samples NptII protein

(µg/g FW)

100B 100E 39C 40D

Leaf 0.329 0.302 0.241 0.316

Stem 0.413 0.459 0.332 0.359

Flower 0.368 0.150 0.264 0.115

Pod 0 0 0 0

Immature Cotyledons 0 0 0 0

Roots 0 0 0 0

Dry seeds 0.250 0.280 0.262 0.261

*The concentration in the dry seed is calculated as microgram per gram of dry weight.

ii. Presence of plasmid backbone sequences in the chickpea genome

A Southern Blotting was carried out using DNA from the transgenic lines to demonstrate the

lack of integration of any plasmid backbone sequence, including the sequences between the two

T-DNAs (Fig 2) in the transgenic lines. The DNA from each line was digested with EcoRI

restriction enzyme followed by separation of fragments in a gel and transferred to a nylon

membrane. The probe from the junction region between the twin T-DNA junction, a segment

of 1029 bp was used for hybridization. The Southern blot showed a hybridization of the probe

to the positive sample (plasmid DNA of pBK203). However, there was no hybridization of the

probe to the transgenic lines (Fig 3), which confirmed the lack of integration of any sequences

from the junction region. A positive sample containing the plasmid DNA of pBK203 showed a

hybridization of the probe of the expected size.



Fig. 2

Figure 2. The region between the two T-DNAs of the binary plasmid, pBK203. The

region between the two T-DNA was 1029 bp, and a probe was designed from this

region to demonstrate lack integration of any sequences from this region

Fig. 3 The genomic DNA isolated from the parental line, Jimbour (J) and transgenic lines,

100B (B) and 100E (E) were digested with EcoRI enzymes followed by separation of fragments

in a gel and transfer to a nylon membrane. A probe of 1000 bp was used for hybridization with

the blot

The probe for hybridization with the membrane was generated by PCR and amplicons

having overlapping fragments of the vector backbone sequence were used as a probe (Fig.

4). When the DNA was hybridized with the backbone probe, no hybridization of the probe

was detected in both the Cry1Ac lines confirming a lack of integration of vector backbone

sequences (Fig 5 A and B). A positive sample containing plasmid DNA of pBK203 (Fig

5A) and pRM50 (Fig 5B) showed hybridization of the probe to the expected size fragment

of plasmid DNA.



Fig 4. Map showing the vector backbone probe used for the Southern Blot hybridization for

both Cry1Ac (pBK203) and αAI (pRM50) lines

A B

Fig. 5 Southern blot to confirm lack of integration of vector backbone sequence in the

transgenic chickpea lines (A)The genomic DNA isolated from the parental line, Jimbour

(J) and transgenic lines, 100B (B) and 100E (E) were digested with EcoRI enzymes followed

by separation of fragments in a gel and transfer to a nylon membrane. PCR amplicons of

the vector backbone were used as a probe to hybridize with the blot. (B) The genomic DNA

isolated from the parental line, Semsem (S) and transgenic lines, 39C and 40D were

digested with EcoRI enzymes followed by separation of fragments in a gel and transfer to a

nylon membrane. PCR amplicons of the vector backbone were used as a probe to hybridize

with the blot.

pRM50 binary

16177 bp

nptII

tetA (tet Resistance)

trfA CDS

alphaAI-1 CDS

oriV region

oriT region

LB sequence

RB sequence

PHA 5'

SCSV 7 promoter

Vic ilin 3'

PHA 3' terminator

EcoRI (492)



iii. Nutritional composition of transgenic chickpea seeds

Transgenic chickpeas expressing high levels of a truncated version of the cry1Ac (trcry1Ac)

gene conferred complete protection to Helicoverpa armigera in the glasshouse. Homozygous

progeny of two lines, Cry1Ac.1 and Cry1Ac.2, had similar growth and other morphological

characteristics, including seed yield, compared to the non-transgenic counterpart; therefore,

seed compositional analyses were carried out. These selected homozygous chickpea lines were

selfed for ten generations along with the non-transgenic parent under contained conditions

(greenhouse). Comparative nutritional assessment, seed storage proteins profiling, and in-vitro

protein digestibility were performed to assure that these lines are as safe as the non-transgenic

chickpea. Our analyses showed no significant difference in primary nutritional composition

between transgenics and non-transgenic chickpeas. In addition, the seed storage protein profile

also showed no variation between these chickpea samples. Seed protein digestibility assays

using the simulated gastric fluid revealed a similar rate of digestion of proteins from the

transgenic trCry1Ac lines compared to the non-transgenic line. Thus, our data suggest no

potential unintended effects due to the expression of the trcry1Ac gene on the nutritional

composition of transgenic chickpea seeds expressing a trcry1Ac gene.

In the previous report, we have compiled the data on proximates, seed storage protein, amino

acids and vitamins. Now we data on fatty acids and isoflavones composition has of homozygous

Bt chickpea lines (BS100B, BS100E) expressing high levels of Cry1Ac gene. Individual fatty

acids and isoflavones contents of lines were quantified concerning their non-transgenic

chickpea (control) seeds by the GC-MS analysis, where values >2.5 or <0.5 significantly high

or low fatty acids compared to non- transgenic line. In all 15 fatty acids, that included both

saturated and unsaturated fatty acids (Table 6) were identified and quantified along with

various isoflavones (Table 7) line relative to the non-transgenic chickpea seeds and levels were

both fatty acids and isoflavones were found to be similar to the non-transgenic parental lines.



Table 6: Summary of results of relative quantification of fatty acids

Fatty Acids BsS100B vs

Control

BS100E vs

Control

Lauric Acid 0.704 0.7705

Myristic Acid 0.735 0.529412

Palmitic Acid 0.638 0.48936

Palmitoleic Acid 0.714 0.54762

Stearic Acid 1.101 0.4932

Oleic Acid 1.617 0.65957

Lineloic Acid 0.871 0.548387

Linolenic Acid 4.54 5.0

Arachidic Acid (Eicosanoic) 0.53 0.54

Gadoleic (Eicosenoic Acid) 0.88 2

Eicosadienoic acid 1.104 0.8

Behenic Acid 1.4324 1.4865

Erucic Acid 1.48936 1.404255

Lignoceric Acid 0.56716 1.791

Nervonic Acid 1.1538 1.5

Table 7: Summary of results of relative quantification of isoflavones

Isoflavones BS100B vs Control BS100E vs Control

Biochanin A 0.5556 0.555

Formononetin 1.789 0.684

Daidzein 0.714 0.548

Genistein 0.452 0.704

Matairesinol 0.665 0.765

iv. Progress made introgression breeding of existing lines

Marker-Assisted backcross breeding was performed to introgress Cry1Ac Gene from

transgenic chickpea lines into cultivated chickpea varieties, PBG 7 (desi) and L 552 (kabuli)

for resistance to Helicoverpa armigera. In 2014, the breeding program started and currently,

the BC3F2 population was raised and both foreground (Fig. 6) and background selection was

carried out to identify the desired plants. In 2019, a total of 10 progeny (Fig. 6; samples

highlighted with red color) were selfed to raise the BC3F2 population.



Milestone set for the following year

Chickpea

1. Detail molecular characterization of new and existing lines

2. Identification of putative homozygous lines

3. Cloning of Vip3 gene for the introduction of the third gene in chickpea

Publications:

• Rabha M., Acharjee S., Sarmah B. K. (2018). Multilocus sequence typing for

phylogenetic view and vip gene diversity of Bacillus thuringiensis strains of the Assam

soil of North East India. World Journal of Microbiology and Biotechnology. 34.

10.1007/s11274-018-2489-5.

• Konwar T., Borah B., Handique A., Acharjee S., Sarmah B. K. (2018). An efficient in

vitro regeneration protocol to generate stable transgenic lines of black gram (Vigna

mungo L.). Indian Journal of Genetics and Plant Breeding. 78. 324-332.

10.31742/IJGPB.78.3.10.

• Meitei A. M., Bhattacharjee M., Dhar S., Chowdhury N., Sharma R., Acharjee S.,

Sarmah B. K. (2018) Activity of defense related enzymes and gene expression in

BC2F

2 Population : PBG 7 x BS 100B-T

5

Fig 6. PCR analysis using gene specific primers L: Ladder (50 bp); P

1: PBG 7, P

2: BS 100E-T

5; 1-83 BC

2F

2 plants;

757

bp



• pigeon pea (Cajanus cajan) due to feeding of Helicoverpa armigera larvae, Journal

of Plant Interactions, 13:1, 231-238, DOI: 10.1080/17429145.2018.1466373

• Hazarika N., Boruah R. R., Handique P. J., Acharjee S., Sarmah B. K. (2019)

Reconstruction and validation of three different binary vectors suitable for generation

of genetically engineered Helicoverpa protected crops. Indian Journal of Genetics and

Plant Breeding. 79(1): 104-108. DOI: https://doi/10.31742/IJGPB.79.1.15

• Hazarika N., Acharjee S., Boruah R. R., Babar K., Parimi S., Char B., Armstrong J.,

Moore A., Higgins T. J. V., Sarmah B. K. (2019) Enhanced expression of Arabidopsis

rubisco small subunit gene promoter regulated Cry1Ac gene in chickpea conferred

complete resistance to Helicoverpa armigera. Journal of Plant Biochemistry and

Biotechnology.DOI:10.1007/s13562-019-00531-1

• Vasantrao J. M., Baruah I. K., Panda D., Bhattacharjee M., Acharjee S., Sarmah B. K.

(2019) Transcript profiling of chickpea pod wall revealed the expression of floral

homeotic gene AGAMOUS-like X2 (CaAGLX2). Mol Biol Rep. 2019

Dec;46(6):5713-5722. doi: 10.1007/s11033-019-05005-0

https://doi/10.31742/IJGPB.79.1.15



Programme Objective III

Objective: Bioprospecting of soil microbes from acidic soils of N E region

Background and Rationale:

The rationale for this proposal is that gene(s) harbored by the soil bacteria that thrive in

acidic stress soil conditions are good candidates for development of efficient microbial

inoculum for organic farming and engineer plants to adapt themselves to the climate changes

anticipated in the 21st century. Acid soil condition is a major challenge for plant growth and

agricultural productivity in the northeast India. This challenge is further expected to exacerbate

in light of the expansion of agricultural activities in marginal areas, crucial in meeting the

growing food demands.

It is clear that genetic mechanism exists in the bacteria’s that enable them to survive and

function in acid soil stress condition. Our approaches in the first phase of the project have

resulted in: 1) A core set of bacterial population and identification of a model bacteria that has

developed strategies to thrive and survive in acid soil condition 2) Establishing the proteome

and transcriptome dynamics in Bacillus megaterium cells in response to acidic condition 3)

Identifying proteins and genes that are up-regulated/down regulated when challenged with acid

stress. The information revealed so far from our initial studies reflects the quantity and

amplitude of the genome level changes both at transcription and translation levels and further

analysis is needed to understand which specific genes or networks are modulated. Based on our

results we envision a need to integrate the “Omics” data sets to identify and validate the

prospected gene(s) and proteins involved with acid soil stress resistance by expression profiling

through quantitative real-time PCR followed by functional validation of potential acid-

tolerance genes. Until recently, understanding the regulatory behavior of cells was pursued

through independent analysis of the transcriptome or the proteome. Based on the central dogma,

it was generally assumed that there exists a direct correspondence between mRNA transcripts

and generated protein expressions. However, recent studies have shown that the correlation

between mRNA and protein expressions can be low due to various factors such as different

half-lives and post transcription machinery. A myriad of sensor networks, signaling molecules

and regulatory proteins are involved in pH homeostasis as well as in overlapping homeostatic

responses to sodium, osmotic, cell wall and reactive oxygen stresses. These networks typically

involve multiple transcription regulators, alternative RNA polymerase σ-factors and various



DNA-binding proteins. Thus, a joint analysis of the transcriptomic and proteomic data can

provide useful insights that may not be deciphered from individual analysis of mRNA or protein

expressions.

Aluminium and iron are two major elements that accumulate in toxic levels in acidic soils

and affect crop growth. Under highly acidic soil conditions (pH<5.0), Al is solubilized into the

soil solution as Al3+. This is highly phytotoxic leading to stunted root system that inhibits both

water and nutrients uptake by the plant. Iron toxicity commonly occurs in a wide range of acid

soils, particularly in lowland rice with permanent flooding. Excess concentration of reduced

iron (Fe2+) results in a range of nutrient disorders and results in deficiencies of other major and

micro nutrients. Aluminum and iron toxicity are regarded as major concerns of low rice

productivity in lowland acid sulfate soils.

The ability of bacteria to tolerate different abiotic stress especially Al have received the

attention of scientific community and been used to improve plant growth under stress condition.

In the phase I of the project, we screened over 200 bacterial isolates for their plant growth

promotion properties both qualitative- and quantitatively and observed that the pH of the

medium had influence on the functionality of the isolates. The PGP activities of the isolates at

acidic pH reduced significantly (P≤0.05) compared to that of neutral pH. During that phase we

also identified a bacterial isolate Bacillus subtilis, B9 that could tolerate high concentration of

AlCl2 (10mM) and FeCl3 (6mM). In addition, the isolate also had several plant growth attributes

including phytohormone secretion, phosphate solubilization. We aim to use this isolate to test

its ability to ameliorate acid soil and its associated stress condition for crops.

The study of plant–microbe interactions is an important approach to improve agricultural

productivity under abiotic stress such as the acidic soil condition. Plant growth and ability to

tolerate abiotic stress condition is largely influenced by the interaction of the plant with

microbes as evident by the growing number of publications in this area. Microbial communities

and plants have coevolved to form diverse and complex associations that besides providing

mutual benefits also aid in ameliorating abiotic stress in plants. Deciphering the cross-talk

between the microbe and the response of plant during abiotic stress will serve as an important

resource to design the crop plants for productivity in a sustainable manner in marginal lands

under variable climatic conditions. Keeping the above facts in view, the following objectives

were formulated to continue in the next phase of research:




1. Integrate proteomic and transcriptomic analyses from Phase I to identify genes

involved with acid stress

2. Functional validation of the differentially expressed genes (from Phase I)

3. Study the growth promotion and abiotic stress (acid and associated stress-Al,

Fe) alleviation ability of the acid and Al tolerant native bacterial isolates

(characterized in the phase I of the project) on crop plant under those stress

condition

4. Decipher the cross-talk between the bacterial isolates and the plant

during acidic and its associated stress condition

Achievements: Generation of mutants:

Homologous recombination-based gene disruption mutation in Bacillus species was

created through the integration vector pMUTIN4 (Bacillus Genetic Stock Centre, BGSC). The

pMUTIN4 vector was cleaved with restriction enzymes BamHI and HindIII at their respective

restriction sites present in the multiple cloning site (MCS). Partial sequences of the target genes

were amplified with gene specific primers containing terminal restriction sites for BamHI and

HindIII restriction sites. Amplified PCR products were also restriction digested as described

above, and ligated into the pMUTIN4 vector. The ligated plasmids were cloned into

Escherichia coli JM109. Plasmids from the screened positive clones were extracted and

transformed into B. megaterium or B. amyloliquefaciens cells as per the standard protocol of

BGSC. Mutants of B. megaterium were generated for proA and proC gene related to proline

biosynthesis, metABC transporter of methionine. Mutant of B. amyloliquefaciens also

generated for cupin gene related to cell wall remodeling

Deciphering the role of proline in conferring acid tolerance to B. megaterium G18

Measurement of extracellular and intracellular proline content of B. megaterium was

performed under normal and acid stress conditions. Bacterial cells were grown in minimal

media with pH 7.0 or pH4.5. Extracellular and intracellular proline concentration significantly

increased in pH 4.5 indicating high production of proline during acid stress condition.



Extracellular proline concentration Intracellular proline concentration

Fig. 1 Extracellular and intracellular proline content in B. megaterium during normal and acid stress

conditions.

To confirm the role of proline in acid stress tolerance of B. megaterium, the growth

characteristics of knock-down mutants for the genes proA and proC were studied during acid

stress condition. Bacillus megaterium G18 wild type was used as control. The mutants were

unable to survive in acid stress condition due to the disruption of the proline biosynthetic

pathway, whereas the wild type tolerated acid stress. However, the mutants showed similar

growth pattern as the wild type upon supplementation of 1mM proline to the culture medium

(Fig.1).

Growth characteristics of B. megaterium ΔproC (BM13A) in minimal media under

different osmoticum (proline, glutamate, mannitol and sorbitol) were also tested. The results

indicated that the ΔproC cells were able to grow in presence of proline and glutamate as

compared to the wild type cells; however, the growth rate was slow in presence of glutamate.

No growth was recorded in presence of mannitol and sorbitol (Fig. 2 D).



Fig. 2 Growth characteristics of B. megaterium wild type and mutants for proline biosynthesis in acid

stress condition

Validation of extracellular proline production

Bacillus megaterium ΔproA and ΔproC cells were used for validation of extracellular

proline production. The BM WT cells were grown on minimal media of pH 4.5 for 16 h. The

supernatant was collected through centrifugation and filter sterilized through 0.22 µm syringe

filter. The filtered supernatant was used to study the growth characteristics of B. megaterium

ΔproA and ΔproC cells. The cells grown in supernatant of BM WT cells (under acid stress

condition) showed normal growth characteristics in 5 h (Fig. 3). Bacillus megaterium ΔproA

and ΔproC cells grown in proline supplemented minimal medium (pH 4.5) were used for

comparison. The results suggested that extracellular proline production by BM WT cells

supplemented the culture supernatant which could be utilized by the ΔproA and ΔproC cells

under acid stress condition.

Fig. 3 Growth characteristics of B. megaterium ΔproA and ΔproC when cultured in proline

supplemented minimal medium or proline rich culture supernatant.



Effect of sulfur on the growth of B. megaterium G18 under acid stress

A single colony of each B. megaterium wild type and B. megaterium ΔmetABC (BM5) cells was

inoculated in NB in separate conical flask and grown at 30°C until the OD600 reach 1.0. Cells were

subsequently diluted with fresh NB and minimal media-lacking S-source and adjusted to pH 4.5 and pH

7.0. The media were supplemented with 2 mM filter sterilized methionine, cysteine and MgSO4.7H2O

separately. The growth of the cells was measured per hour up to 4h and on 16h of incubation at 30 °C

and compared with the cells grown without methionine, cysteine and MgSO4.7H2O and in normal NB

& minimal media adjusted to pH 4.5. No significant difference in the growth rate of BM WT cells in

both neutral and acid stress conditions in absence or presence of SO42- or sulphur containing amino

acids: methionine or cysteine. The BM ΔmetABC also showed similar growth rate at pH 7.0 under the

aforesaid conditions. However, these cells were unable to show normal growth rate at pH 4.5 in absence

of SO42- and sulphur containing amino acids: methionine and cysteine, which was complemented in

presence of any of the above sources of sulphur (Fig. 4).

Fig. 4 Effect of sulfur on the growth of B. megaterium WT and ΔmetABC (BM5) under acid stress.

Acid tolerance by B. amyloliquefaciens MBMC

Bacillus amyloliquefaciens MBMC was isolated from acidic soil and identified based on

morphological and biochemical features as well as 16S ribosomal RNA gene sequence. Acid

tolerance response of B. amyloliquefaciens MBNC under various pH conditions was studied.

The pH of the culture medium was adjusted to 7.0, 6.0 and 4.5 using HCl. The bacterial growth

characteristics were studied in pH 4.5 with or without prior exposure to pH 6.0and the growth

rates were compared to that in pH 7.0. The bacterial cells were unable to show logarithmic

growth rate when they directly transferred from pH 7.0 to pH 4.5 after initial cell density of

O.D. 0.3. However, the growth rate increased upon a longer pre-culture of cells up to an initial

cell density of O.D. 1.0. Best results were obtained after a pre-exposure of the cells at pH 6.0

up to an initial cell density of O.D. 1.0 (Fig. 5). The results suggested that, pre-exposure to

moderate acid enable the cells to survive under extreme acidic condition, a process known as

acid tolerance response (ATR).



Fig. 5 Acid tolerance response of B. amyloliquefaciens MBNC under

various conditions

Acid tolerance response by B. amyloliquefaciens MBNC was also studied in pH 4.0 and

4.5 in presence of different acids. The media pH was adjusted to 4.0 and 4.5 using HCl, HNO3,

H2SO4, acetic acid, citric acid, tartaric acid and acetate buffer. The cell density was observed

after 2, 4 and 6 h, which indicated that the cell density (O.D. 600 nm) was higher in pH 4.5

compared to pH 4.0. The cells were able to tolerate the acidic pH adjusted using inorganic acids,

i.e., HCl, HNO3 and H2SO4. The cells were also able to tolerate the acidic pH adjusted using

organic acids: citric acid and tartaric acid, however, no significant growth was observed in

acetic acid and acetate buffer till 6 h of incubation (Fig. 6).

Fig. 6 Acid tolerance response of B. amyloliquefaciens MBNC in different media in presence of

inorganic and organic acids



Quantitative gene expression analysis in B. amyloliquefaciens MBNC

Quantitative real-time PCR was performed to study the expression of selected genes under

different acid stress conditions. Primers were designed for those genes with expected product

size <200 bp. Genes were selected based on their putative roles in acid stress response. As per

the literatures, the cell wall plays a major role in the maintenance of acid stress tolerance. This

was also supported by our earlier results on B. megaterium and B. amyloliquefaciens, as the

osmoticum production and exopolysaccharide production bythe bacterium is directly related to

acid stress tolerance. Hence, few genes of B. amyloliquefaciens related to cell wall re-modeling

viz., cupin, flotilin, pdp (penicillin binding protein), mbp (murein binding protein), pdaA

(polysaccharide deacetylase) and spoA (sporulation factor) were tested. The constitutively

expressed 16S ribosomal RNA gene was used for normalization of the amplification process. It

was observed that there was upregulation in cupin and pbp expression during all acid stress

conditions compared to pH 7.0, where cells in pH 4.5 adjusted with acetic acid showed highest

expression of both the genes. Similarly, mbp gene also showed about 1.8 fold up-regulations in

all the acidic conditions. There was no significant difference in the expression of pda gene

among all the tested conditions, while flotilin and spoA gene showed down-regulation in pH

4.5, compared to pH 7.0 (Fig. 7).

Fig. 7 Differential expression of different genes of B. amyloliquefaciens MBNC in different

acid stress conditions



Deciphering the role of cupin gene in conferring acid tolerance to B. amyloliquefaciens MBNC

As the cupin gene showed very high level of expression in acidic conditions, B.

amyloliquefaciens Δcupin was generated and growth characteristics were studied in pH 7.0 and

pH 4.5 to validate the function of cupin in acid stress response. Wild type was used for the

comparison of growth characteristics. It was observed that B. amyloliquefaciens Δcupin cells

showed almost similar growth with the wild type at pH 7.0. However, the growth rate of the

cupin mutant was slower at pH 4.5 compared to pH 7.0. There was no significant difference in

the growth rate of the wild type cells at both pH conditions (Fig. 8). These results suggested

that the cupin gene has a potent role in acid stress tolerance. This was further confirmed by the

evidence from the colony morphology. When the colony characteristics of the mutant were

compared to the wild type, it was observed that the colonies lack the rough surface properties,

which is an important feature of B. amyloliquefaciens wild type (Fig. 9).

Fig. 8 Growth characteristics of B. amyloliquefaciens WT and Δcupin calls at neutral and acidic pH

Fig. 9 Colony characteristics of B. amyloliquefaciens wild type and Δcupin cells grown on nutrient

agar plates.

Detection of exopolysaccharides production by B. amyloliquefaciens MBNC

The rough, scaly appearance of the colonies in B. amyloliquefaciens is due to the

production of exopolysaccharides. In case of the Δcupin cells, the colony morphology did not

show this feature. Therefore, it was hypothesized that there may be interruption in the



exopolysaccharide production in the B. amyloliquefaciens Δcupin cells. To confirm this,

scanning electron microscopy was performed to study the cell surface morphology of the wild

type and mutant cells. Scanning electron microscopy clearly revealed the production of

exopolyscaccharides by wild type cells, characterized by very rough cell surface morphology

and extracellular layers of exopolysaccharides that increased with time. In contrast, the cell

surface morphology of the mutant was smooth and lacked the extracellular polysaccharides.

Moreover, the cells became irregular in shape with increased time, which may be due to the

loss of integrity in the cell was polysaccharides (Fig. 10).

Fig. 10 Scanning electron micrographs of the (a) and (b): Bacillus amyloliquefaciens wild

type showing active exopolysaccharides production; (c): Δcupin cell with no

exopolysaccharides production

The results indicate that B. amyloliquefaciens MBNC shows acid tolerance with the help

of a cell wall remodelling factor belonging to the cupin super-family. This protein helps in the

maintenance of cell wall integrity; loss of function mutation in cupin gene inhibits the

exopolysaccharide production in the mutants and thereby making the cells susceptible towards

acidic environment.

Plant-growing promoting activities of few promising bacterial isolates under Al-stress:

Gnotobiotic inoculation experiments were performed in rice cultivars Luit. It is a semi-

dwarf variety with low tillering (6-7 EBT/plant) and can be grown in both Ahu and Sali seasons.

In the controlled experiment, strains of Bacillus megaterium G18, Bacillus subtilis B3B9, B.

amyloliquefaciens RHS11 and Microbacterium testaceum MK_LS01 were used, and compared

with controls. These PGPR can enhance plant growth through nutrient recycling (soil health),

IAA production and solubilisation of nutrients such as P and Zn. Pot-experiments were

performed in sterile soil (acidic and neutral) amended with 100 mM AlCl3. For these assays,

220 mL from a 108 CFU/mL inoculum were mixed with 5.5 kg of sterile soil, to reach a



concentration of 105 CFU/g and sterile water used as negative control. Each treatment included

three biological replicates, and three plants were grown in each plot. Subsequently, germinated

seedlings were planted inside the pot and plants were kept in the greenhouse at 25°C for 90

days post-inoculation. Biometric properties (tiller number, number of panicles, yield per plant,

root and shoot fresh weight, plant dry weight, and length) were recorded 90 days post-

transplantation.

(c)

Fig. 11 Seedlings growth (before transferring to pots) in (a) acidic soil (pH<4.5) with100 mM AlCl3;

(b) normal soil with 100 mM AlCl3; (c) Root growth under acidic soil with 100 mM AlCl3.

As shown in Fig. 11, it was evident that Bacillus subtilis B3B9 effectively promoted lateral

and adventitious root growth in rice plant as compared to other the isolate. Bacillus megaterium

G18 showed only lateral root growth under Al-stress. Root-pruning which, leads to decreased

productivity was observed in the control set (no bioinoculum)

Screening of Indica rice varieties for Al tolerance

The effect of Al on root growth in rice (Oryza sativa L.) seedlings to detect the relative Al

toxicity tolerance of rice genotypes was studied. Rice genotypes (68 varieties) were collected

from the Regional Agriculture Research Station (RARS), Titabar, Assam. Properly surface

sterilized rice seeds were germinated for three days in petri plates with moisten filter paper. The

healthy germinated seeds were then transferred into plastic containers (400 ml) containing

Hoagland nutritive medium. Plants were grown for a period of 5 days in a growth chamber

under white light after which these were pretreated with 500 μM CaCl2 (pH 4.5) for a day. Pre-

treatment solution was then removed and treated with aluminum chloride (AlCl3) at different

concentration (0, 25, 50 and 100 μM) containing 500 μM CaCl2 (pH 4.5) for 12, 24, 48 h. The

accumulation of aluminum in plant tissue was observed by staining with hematoxylin.



Fig. 12 Histochemical detection of aluminum uptake in root tips of rice seedlings.

Microscopic views of hematoxylin stained root tips. Intense stained colour represents

hematoxylin-Al complexes by the root cells at 48h.

Aluminum chloride (AlCl3) at 100μM concentration was used in the germination assay

(Fig 13). Rice verities with more sensitive root growth to Al at germination stage were screened

out. At this condition, root growth in germinating seeds of tolerant genotypes was not

significantly affected, while for some genotypes root growth was drastically inhibited.

Tolerant rice varieties:

Rice varieties 10: Bami-sokuwa; 20: Boss Joha; 27: Gomi 2; 32: Jalbi-Sali; 45: Miyatang; 47:

Na-gaya; 48: Nalbani; 55: Rangi bau 1; 56: Ronga-dherepa; 57: Rongdoi; 60: Siyal-Sali

Moderately sensitive rice varieties:

Rice varieties 2: AC Sali; 3: Adoliya-bau; 5: Akuwa-Bora; 11: Barma-black;16: Bogi-Sali; 17:

Bora; 24: Dhameswar Bau; 35: Kabra Bang; 53: Piroi-Sali; 54: Pura Benu; 65: Sunajuli-Bau

Susceptible rice varieties:

Rice varieties 1: Aath-bau; 4: Akhum-Sali; 6: Badal-bau 2; 7: Baji 8: Baji-lahi; 9: Bak-kapahi; 12:

Beji 13: Bhakat khali; 14: Boga khamtilai; 15: Boga-bet; 18: Bor-juli Bau; 19: Borseni lai; 26:

Buruli-bau; 28: Gondho-biyoi; 29: Hawai1; 30: Hawai2; 31: Holseni-lahi; 33: Jarkho-mosolu; 34:

Joha-sorukola; 36: Kalamdani; 37: Kar-kholi; 38: Kham-tila; 39: Kola-Bora; 40: Kola-Sali; 41:

Lalbihari; 42: Maigutiya; 43: Mathunga; 44: Misiri; 46: Mosuri-bau; 49: Naukheliya; 50:

Negheribai 2; 51: Nekheli-bau; 52: Phool-bakhori; 58: Satuki; 59: Seni-lahi; 61: Soklong; 63:

Sukapha Bau; 64: Suna-bau; 66: Tripura red; 67: Ranjit; 68: Luit



Fig. Screening of rice verities based on germination ability under 100μM AlCl3

Plant-growing promoting activities of few promising bacterial isolates:

Two experiments, one in controlled condition (pot-experiment) and one in field plot

(Instructional cum Research Farm, AAU) were conducted. In the controlled experiment, the

above-mentioned bioinoculum were used, and compared with controls. Initially, rice seeds

(Oryza satuva var. Luit) were thoroughly surface-sterilized. Microbiolization of rice seeds was

performed by shaking the seeds with saline suspension of freshly grown (A540=0.5)

Tolerant rice varieties:

Rice varieties 10: Bami-sokuwa; 20: Boss Joha; 27: Gomi 2; 32: Jalbi-Sali; 45: Miyatang; 47:

Na-gaya; 48: Nalbani; 55: Rangi bau 1; 56: Ronga-dherepa; 57: Rongdoi; 60: Siyal-Sali

Moderately sensitive rice varieties:

Rice varieties 2: AC Sali; 3: Adoliya-bau; 5: Akuwa-Bora; 11: Barma-black;16: Bogi-Sali; 17:

Bora; 24: Dhameswar Bau; 35: Kabra Bang; 53: Piroi-Sali; 54: Pura Benu; 65: Sunajuli-Bau

Susceptible rice varieties:

Rice varieties 1: Aath-bau; 4: Akhum-Sali; 6: Badal-bau 2; 7: Baji 8: Baji-lahi; 9: Bak-kapahi; 12:

Beji 13: Bhakat khali; 14: Boga khamtilai; 15: Boga-bet; 18: Bor-juli Bau; 19: Borseni lai; 26:

Buruli-bau; 28: Gondho-biyoi; 29: Hawai1; 30: Hawai2; 31: Holseni-lahi; 33: Jarkho-mosolu; 34:

Joha-sorukola; 36: Kalamdani; 37: Kar-kholi; 38: Kham-tila; 39: Kola-Bora; 40: Kola-Sali; 41:

Lalbihari; 42: Maigutiya; 43: Mathunga; 44: Misiri; 46: Mosuri-bau; 49: Naukheliya; 50:

Negheribai 2; 51: Nekheli-bau; 52: Phool-bakhori; 58: Satuki; 59: Seni-lahi; 61: Soklong; 63:

Sukapha Bau; 64: Suna-bau; 66: Tripura red; 67: Ranjit; 68: Luit



rhizobacteria of each of the four strains for 2 hours at 10ºC. These seeds were then transferred

into glass flasks (15 cm × 4 cm) minimally moistened with sterile water and kept for 11 days

in laboratory conditions before hardening and transferring to pot soils.

Fig. 12 Biopriming of rice seeds with different bacteria induced visibly appreciable growth on 7 days post

inoculation

Sterile neutral soil without any amendment was used to grow the bioprimed Oryza sativa

var. Luit seedlings. Biometric parameters were recorded as mentioned above.

(a) (b) (c)

(d) (e) (f)

Fig. 13 Pot-experiment of rice grown in the net-house; rice inoculated with (a) Bacillus megaterium (b)

Microbacterium testaceum (c) B. amyloliquefaciens (d) Bacillus subtilis, (e) control (no bacterial

treatment). (f) Roots of rice grown under these conditions

Bacillus megaterium Microbacterium

testaceum

Bacillus amyloliquefaciens

Bacillus subtilis

No bacterial treatment



Table: Few biometric data of rice-plants grown in pots Bioinoculum Leaf numbers Plant height No. of tillers

Bacillus megaterium 30.25±5.3 58.4 ± 5.2 8.4 ± 1.0

Microbacterium testaceum 27.15±4.9 57.3 ± 4.8 7.95 ± 1.3

Bacillus amyloliquefaciens 23.75 ±5.6 58.1 ± 56.3 7.1 ±1.3

Bacillus subtilis 23.0±6.15 55.6 ± 6.6 7.7 ± 0.98

Control 17.8 ± 2.5 49.9 ± 2.9 5.6 ± 0.99

To evaluate the effects of PGPR in field experiment, we considered two varieties of rice,

Luit and Aghuni (a glutinous rice of long duration; ~180 days). Seeds were primed with the

bioinoculum as described above with non-primed seeds kept as control groups.

(a) (b)

(c) (d)

Fig. 14 (a) Number of rice leaves (b) Plant height- inoculated with the four PGPRs

Lorenz curve of inequality for: (c) no. of rice leaves from non-primed seeds (d) no. of rice leaves from

bioprimed seeds rice leaves

Although the overall plant growth and yield was more in bioinoculated rice samples, non-

bioprimed seeds showed a significant increase in the inequality of total biomass, as compared

to the bioprimed seeds (CV: 16.5% in bioprimed seeds vs. 36% in non-bioprimed seeds. Similar

significant results were observed with both plant height and tiller number and were reflected in

the Gini coefficient (index) and the Gini Mean of Differences. A notable feature of the Lorenz

asymmetry coefficients was that those for control plants were always less than one (0.9907143),

while those for treated plants were all greater than one (>1.100769). The former indicated that

the majority of control plants were uniform, while the latter indicated that some large

individuals occurred when bacteria were applied.



Academic accomplishment:

• Gunajit Goswami (former Research Associate) received his PhD on the topic ‘A

study on the transcriptome profile of Bacillus megaterium during acid stress’ from the

Department of Life Sciences, Dibrugarh University in the year 2019.

• Naimisha Chowdhury, a PhD student under the Department of Agricultural

Biotechnology, Assam Agricultural University, Jorhat is submitting her PhD thesis

entitled ‘Validating the role of genes upregulated during acid stress in Bacillus

megaterium’.

Paper publication:

• Deka P, G Goswami, P Das, T Gautom, N Chowdhury, RC Boro, M Barooah

(2019) Bacterial exopolysaccharide promotes acid tolerance in Bacillus

amyloliquefaciens and improves soil aggregation. Molecular biology reports 46 (1),

1079-1091

• DJ Hazarika, G Goswami, T Gautom, A Parveen, P Das, M Barooah (2019)

Lipopeptide mediated biocontrol activity of endophytic Bacillus subtilis against fungal

phytopathogens. BMC microbiology 19 (1), 71

• Keot J., Bora S. S., Kangabam R., Barooah M., (2020) Assessment of microbial

quality and health risks associated with traditional rice wine starter Xaj-pitha of Assam,

India: a step towards defined and controlled fermentation (under production)

Book Chapters:

• Barooah M., Bora S. S., G. Goswami (2020) Ethnic Fermented Foods and

Beverages of Assam; In: Jyoti Prakash Tamang (Eds): Ethnic Fermented Foods and

Beverages of India: Science History and Culture, Springer Nature (under production)

Milestones to be achieved:

• Functional validation of the remaining differentially expressed genes (from Phase I)

• Study the growth promotion and Al-Fe stress alleviation ability of the bacterial

isolates in rice and lentil

• Gene expression study of Al-tolerance genes in these plants treated with

bioinoculum

•



Programme Objective IV

Objective: Development of efficient biofertilizers and biopesticides using novel microbial

strains from NE soils.

a. Biofertilizer:

Rationale:

The North Eastern Region is endowed with natural resources including diverse

communities of untapped microorganisms and due to continuous use of chemical fertilizers not

only the soil quality is affected but also the agricultural productivity is depleting day by day.

Soil acidity is a serious constraint for crop production in the NE Region accompanied by the

high rainfall in NE Region and undulating topography. However, the major growth-limiting

factors associated with acid soil infertility include toxicity of aluminium (Al), Iron (Fe) and

manganese (Mn), thereby decreasing availability of certain essential elements. It is generally

accepted that Al toxicity is a primary factor limiting plant growth in acid soils (Kochian, 1995).

So, the scope of increasing crop productivity is invariably linked with addressing the low soil

pH levels. Therefore, environmental-friendly strategies to increase agricultural production

should be appreciated. In this context, microbial technology has emerged as an inevitable

component in the present-day agriculture in the context of world-wide importance of organic

farming. Hence, development of bioformulations using novel strains can be implemented as an

alternative way for extensification of the agricultural programme on low pH land. On the other

hand, the Biofertilizer Production Unit has already explored different cultures of biofertilizer

agents for commercialization during Phase I. Different biofertilizer agents produced in this unit

include Rhizobium, Azotobacter, Azospirillum, PGPRs and PSB cultures through screening

and evaluating efficient microbes. Although, during the first phase of the project, the acid

tolerance of the biofertilizer microbes, its plant microbe interactions and its bioefficacy in

relation to commercial strains was not determined. Therefore, in this context during the second

phase a comparative study will be conducted with the already present biofertilizer organisms

of this unit and the microbes having acid tolerant genes under Programme III along with the

new acid tolerant strains to be isolated during Phase II. In this way, potential acid tolerant strains

will be finally evaluated with the commercial stains for its efficacy and selected strains will be

used in development of bioformulation.




1. a. Comparative analysis of organic inputs developed during Phase I under

Programme IV over recommended dose of fertilizer through field trials.

b. Harnessing of novel strains having acid tolerance with plant growth promoting

traits as biofertilizer agents.

2. Development of superior bio-formulation with acidity tolerance suitable for acidic

soil.

3. Comparison of efficacy of the commercially available bio-formulations with the

formulations developed from novel strains of NE Region.

4. Phylogenetic and Cluster analysis of selected isolates.

5. Plant-microbial interaction studies for enhanced abiotic stress tolerance with respect

to Aluminium and Iron in lowland rice.

6. Commercialization of efficient microbial bioformulation.

Technical programme for the year

1. Comparative analysis of organic inputs developed during Phase I under Programme IV

over recommended dose of fertilizer through field trials.

a. Validation of biofertilizer and enriched compost through field trials in farmer’s

field with Rice - Toria cropping sequence.

b. Evaluation of existing biofertilizers and acid tolerant bacteria collected from

Programme III in ICR Farm with rice as test crop (under progress).

2. Harnessing novel strains having acid tolerance with plant growth promoting traits as

biofertilizer agents.

3. Production of biofertilizer, enriched compost and Azolla.

Milestone for the year and progress made

1. Comparative analysis of organic inputs developed during Phase I under Programme

IV over recommended dose of fertilizer through field trials.

a. Validation of biofertilizer and enriched compost through field trials in farmer’s field under

Rice - Toria cropping sequence.

The present investigation was carried out during 2018-19 in rice and toria under rice-



toria sequence at Ramgaon village of Patharighat SDAO circle, Darrang district of Assam to

assess the changes in soil biological and chemical parameters due to application of organic

inputs in soil. Yield and yield parameters were also assessed. The experimental details adopted

during the present experimentation are mentioned below:

Experimental details

a. Number of treatments: 6 (six)

b. Number of replications: 4 (four)

c. Experimental design: Randomized Block Design (RBD)

d. Total number of plots: 24 (twenty-four)

e. Individual plot size: 10 m X 5 m

Crops:

Rice variety (Medium duration): TTB 404 (Shravani)

Toria Variety (Late sown toria variety): TS 67

Date of sowing and harvesting

Rice was sown on 20-6-18 and transplanted on 20-07-18 and harvested on 10-11-2018. Toria

was sown on 25-11-18 and harvested on 26-02-19.

Cropping sequence: Rice-Toria cropping sequence

Treatment details

Treatments for HYV rice crop variety TTB 404 (Shraboni) as kharif (winter) crop:

T1: Control

T2: 50% RDF + 50% Biofertilizer

T3: 50% RDF + 50% Enriched composts

T4: 100 % Recommended dose of fertilize (RDF) (60: 20: 40 :: N: P2O5:K2O kg/ha)

T5: 100% Biofertilizers (5 kg/ha) (PSB + Azospiriluum)

T6: 100 % Enriched compost (3 t/ha)

Treatments for HYV of toria variety TS 67 as rabi crop:

T1: Control

T2: 50% RDF (Recommended dose of fertilizer) + 50% Biofertilizer

T3: 50% RDF + 50% Enriched composts

T4: 100 % RDF (87kg urea, 220 kg SSP and 25 kg MOP per ha)

T5: 100% Biofertilizers (5 kg/ha) (PSB + Azotobacter)

T6: 100 % Enriched compost (3 t/ha)



Results

The data were recorded at various stages of crop growth and soil samples were analysed

for biochemical characters at different stages of rice and toria crops. The results showed that

the INM treatment (T3) consisting of 50% EC and 50% RDF recorded the highest

accumulation of N (262.60 and 252.08 kg/ha), P (23.14 and 22.84 kg/ha), and K (151.33 and

147.58 kg/ha) at maximum tillering stage of rice and flowering stage of toria respectively but

remained at par with 100% RDF treatment in both the crops during the period of investigation.

The accumulation of organic carbon (12.35 g/kg soil in rice and 12.03 g/kg soil in toria) was

found significantly at par with 100% RDF treatment at both the stages of crops. Soil

accumulation of OC, N and K was found higher in 100% EC treatment over 100% biofertilizer

treatment. However, soil accumulation of Organic carbon (OC), nitrogen (N), phosphorus (P)

and potash (K) gradually declined from maximum tillering stages of rice and flowering stage

of toria to harvesting stage of both the crops. Although no significant changes in soil pH was

observed, but the lowest pH was recorded in RDF treatment in both the crops ranging from

pH 5.20 to pH 5.22, even lower than the initial soil pH 5.24. The results showed that the

bacterial, fungal and actinomycetes population varied with the treatments and with the age of

the crops. The treatments, T3 recorded the highest bacterial population of 19.50 cfu x105/g

and 18.50 cfu x105/g soil at flowering stages of rice and toria respectively and declined

thereafter. The fungal population recorded highest in T3 (8.50 cfu x105/g soil in rice and 8.25

cfu x105/g soil in toria). Actinomycetes population recorded in treatment T3 remained

significantly with T6 in both the crops. The microbial diversity in INM and organically

treatments found significantly higher than 100% RDF and control treatment. Soil respiration,

microbial biomass carbon, and tested soil enzymes (fluorescein di-acetate activity,

dehydrogenase activity, acid phosphatase activity and urease activity) behaved differently

with different treatment where T3 (50% EC + 50% RDF) exhibited the best performance over

other treatments at all the stages of rice and toria crop. All the biological parameters were

found at their peak at flowering stages and declined thereafter at harvesting stages of both the

crops. All the bio-chemical properties in treated plots in rice-toria sequence were found

significantly higher than the untreated control and even over the initial values of each

parameters. Unlike soil bio-chemical properties, agronomic parameters of rice (no. of

tillers/hill, plant height, panicle length, grain and straw yield) and toria (plant height, no. of

siliqua/plant, grain and stover yield) crops recorded higher values in 100% RDF treatment



which remained at par with, 50% EC + 50% RDF treatment (T3). The grain yield of rice

(44.15 q/ha) and toria (889.25 q/ha) in the 100% fertilized plots were found at par with INM

(T3) treatments (42.60 q/ha in rice 875.50 q/ha in toria) receiving 50% EC and 50% RDF, but

both recorded significantly higher yield over sole application of biofertilizer, enriched

compost and control treatment. The beneficial effect of INM treatment (T3) that facilitated

favourable soil conditions were reflected in grain yield of both rice and toria crops which was

equivalent even with 100% RDF treatments.

Photographs of (a) bacterial and (b) fungal colonies from experimental filed

Microphotographs of actinomycetes colonies with their mycelial and spore view isolated

from experimental field

a b



Rice crop at maximum tillering stage

Rice crop at maturity stage



Toria crop at flowering stage

Toria crop at maturity stage



b. Evaluation of existing biofertilizers and acid tolerant bacteria collected from

Programme III in ICR Farm with rice as test crop (under progress).

A field experiment with rice as the test crop variety Ranjit has been carried out in the ICR

Farm, AAU, Jorhat to evaluate the efficiency of the existing biofertilizers of the unit and

three acid tolerant bacterial cultures collected from Prog III (PI- Dr. M. Barooah). The

evaluation of the soil chemical and biological properties is under process. Rice seed was

sown on 15th July, 2019 and line transplanting was done on 19th August, 2019 and harvested

on 21st December, 2019. The treatment combinations adopted during the present

experimentation are mentioned below:

Design: Randomized Block Design

Treatment: 9

Replication: 4

Plot size: 20 cm2

Treatment details

T1 = Control (Absolute)

T2 = B1 + 20 kg Optimal compost



T5 = Azosp + 20 kg Optimal compost

T6 = Azoto + 20 kg Optimal compost

T7 = PSB + 20 kg Optimal compost

T8 = Enriched Compost

T9 = Standard + 20 kg Optimal compost

Acid Tolerant Bacterial strains

B1 = G18

B2 = G20

B3 = MBNC

Biofertilizer organisms

Azosp: Azospirillum 71

Azoto = Azotobacter 5

PSB = Phosphate solubilising bacteria (PSB 25)

Fertilizer and organic input rate

NPK: 40:20:20 kg/ha of N, P2O5, K2O Enriched compost: 5t/ha

Biofertilizer: 5kg/h



2. Harnessing of novel strains having acid tolerance with plant growth promoting traits

as biofertilizer agents.

Rhizosphere soils in bulk along with roots were collected from different rice fields located

under Jorhat and Golaghat district of Assam. Altogether, thirty (30) samples at random were

collected. The root samples along with their adhering soil particles were separated from the

bulk soil for the isolation of acid tolerant bacteria. Isolation of acid tolerant bacteria was

conducted using enrichment technique in Luria Bertani media. Samples at 10 gram each

collected from different rice ecosystem was weighed and dispensed into 90 ml Luria Bertani

broth in 250 ml Erlenmeyer flasks. To screen bacteria which could resist acidic condition and

higher aluminium concentration, the pH value of the media was adjusted to 5.5 before

autoclaving at 1210C for 15 minutes. After this medium was autoclaved, Al sterilized using a

0.2µm filter was added to a final concentration of 100 ppm. Since, Aluminium-toxicity in

acidic soil is a major limiting factor for plant growth therefore, aluminium is also used as a

criterion for screening of bacterial cultures.

The culture flasks were incubated at 30 ± 1ºC until individual pure bacterial colonies with

varying colour and size were observed after 4-5 days. Isolated colonies were picked up,

purified by repeated sub culture technique. For this all the test isolates were streaked in Luria

Bertani agar plates and incubated at 30±1°C for 3 to 4 days until colonies of different age and

size appeared. Out of the 30 collected soil and root samples, altogether, 62 bacterial cultures

were isolated on the basis of color, elevation, margin, shape, staining behaviour, purity,

survivability and growth character in media as described. The results revealed the colony

morphology ranged from flat to convex with entire margin, mostly gram negative. The isolated

cultures were purified and maintained at 4°C for further studies.

A screening was attempted to select microorganisms that tolerate high concentrations of

H + ions and aluminium concentration. Therefore, an incubation study was performed using

Luria bertani as the growth medium and the pH was adjusted to 5.0 in the presence of 100

ppm of Al as Al2(SO4)3.16H2O. The bacterial cultures which could grow in the presence of

high concentration of H + ions and 100 ppm of Al concentration were selected for further

evaluation. The effect of bacterial inoculation on pH of the growth medium was also

determined. It was observed most of the cultures survived at pH 5.0 in the presence of 100

ppm Al concentration. On the other hand, media pH was increased up to 6.5. It means that the

increase in pH by the action of the bacterial inoculation in growing medium may be due to the

masking of Al by the bacterial cells. The masked Al appeared to form Al complexes, because



the culture medium became turbid and very viscous during the growth of the isolates.

To ascertain the plant growth promoting traits by individual cultures indole acetic acid

production was determined spectrophotometrically (Wohler 1997). It was observed most of

the isolated bacterial cultures were efficient producer of IAA and it ranged between 0.09 to

54.50 ppm.

Enrichment, isolation and purification of acid tolerant bacteria

IAA production by acid tolerant bacterial cultures



Publications:

Book Chapters:

• Fourteen lecture notes published in the “Compendium of lectures on ICAR

sponsored training on “Techniques in Bio-fertilizers and Biopesticides Production for

Organic Agriculture” CAFT 2018

• Four lecture notes published in the “Compendium of lectures on ICAR sponsored

training on “Developments in Organic Agriculture” CAFT 2019.

Poster presentation:

• Phukan A, Baruah R, Paul A; Methanotrophic bacteria: potential as future microbial

inoculants; presented at the International symposium on biotechnology for food-

nutritional security and organic agriculture organized by DBT-NECAB, AAU, Jorhat,

25 - 26th March, 2019.

Milestone set for the following year:

1. Evaluation of organic trial conducted in ICR Farm and farmers field

3. Characterization & screening of acid tolerant bacteria

4. Molecular characterization of efficient strains

5. Production of Biofertilizers and its quality control

6. Homestead Azolla cultivation

7. Compost production and enrichment



Programme Objective IV

b. Biopesticides

Vision:

Help to Convert Assam and other North Eastern Region of India to Organic Region


• To explore advance technologies for enhancing Production and Productivity of

Biopesticides

• Develop and Screen aggressive strains of Bio inoculants for refinement of Biopesticides

for wider adoptability.

• Develop consortium of beneficial microbes and widen network of Organic Agriculture

Technologies.

• Capacity building of Satellite production units in the KVKs of AAU and Initiating AAU-

Private sector partnership module for Entrepreneurship development.

Progress Made

(A) PRODUCTS PRODUCED IN BIOPESTICIDE LAB

Altogether, twenty-two (22) numbers of different bioformulations were prepared.

Following microbial bioagent and insect parasitoids were used for production of these

products in the bioformulation production facility of “Programme on Biopesticides”-

Fungal agents: Trichoderma harzanium, T. viride, T. parareesei, Metarhizium anisopliae,

Beauveria bassiana, Verticellium lecanii, Paecilomyces fumosoroseus, Actinomycetes

Bacterial agents: Pseudomonas fluorescens, Bacillus thuringiensis, B. subtilis

Liquid Formulations: Six liquid formulations of Trichoderma viride, Metarhizium

anisopliae, Beauveria bassiana, Verticellium lecanii, Pseudomonas fluorescens, Bacillus

thuringiensis were new addition

Capsule based Formulations: Six new Capsule based formulations of T. viride

(Biocap_TV), Metarhizium anisopliae (Biocap_MA), Beauveria bassiana (Biocap_BB),

Verticellium lecanii, (Biocap_VL), Pseudomonas fluorescens (Biocap_PF), Bacillus

thuringiensis (Biocap_TT) has been prepared and their evaluation protocols were made.

Actinomycetes based bioformulation: Another two (2) Two Actinomycetes based

bioformulation production protocols were prepared and evaluation processes are in progress.

Insect Parasitoids: Trichogramma sp. were continuously prepared and distributed to the

farmers



A (1): Liquid formulations of different Biopesticides Newly developed:

A (2): Capsule based formulations of different Biopesticides Newly developed:



(B) QUANTITATIVE DATA OF BIOFORMULATION PRODUCTION

Sl.

No. Products Qnt. (In MT/LTR)

Talc based formulations (In MT)

1 Bio-Time 1.70

2 Biozin-PTB 1.80

3 Bio-Sona 0.30

4 Bio-llium 0.15

5 Bio-Meta 0.50

6 Bio-zium 0.50

7 Bio-veer 4.90

8 Biogreen 1.50

Vermicompost based formulations (In MT)

9 Biofor-Pf 2 8.90

Liquid based formulations (In Lts)

10 Biogreen-L 190.00

Total production (in MT)

Talc based 11.20

Organic based 8.90

Total (solid based) 20.10

Liquid 1240.00 lits

Production (Solid/Liquid) unit wise total production Till Dec’ 2018

Head Quarter 260.10

Satellite units 8.20

HQ (Liquid formulations) 1240.00 lits

Revenue Earned till Dec’2018 (In lakh)

Head Quarter 14.10

Satellite units 8.20

Total 22.30

(C) OFT RESEARCH FINDINGS

C.1. PGPM formulation mediated suppression of major diseases and pests of tea (Camellia

sinensis) biochemical changes and enhancement of plant defense responses

Finding: PGPM based consortia formulation improves host defense responses in tea plant and

enhances productivity and quality of tea

OFT was conducted on organic management of tea pest and diseases with four in house

developed biopesticides viz. Biosona, Biotime, Biogreen-5 and Biogreen-L. Among the tested

formulations, Biogreen-5 exhibited significantly high reduction of tea mosquito bug (89.06%),



red spider mite (92.04%), looper caterpillar (91.47%), aphid (92.53%) and grey blight disease

(91.20%) along with increase in the green leaf yield (10.40q/ha) when applied as spray @ 2%

at 15 days interval. These results are at par with the standard chemical check. Besides,

controlling insect pests the cited treatment significantly improves caffeine content (3.9 %) in

produced tea as compared to control (1.2 %).

General view of the Experimental area

Table. Efficacy of different PGPM based formulations in reduction of Tea pests and disease

incidence

Treatment Incidence (%)

Tea

mosquito

bug

red spider

mites

Looper

caterpillar

Grey

Blight

Biosona 53.82

(47.18)b

53.05

(46.72)b

40.27

(39.35)b

60.56

(51.06)b

Biotime 35.33

(36.45)c

34.96

(36.21)c

24.19

(29.47)c

24.55

(29.67)c

Biogreen-5 17.79

(24.88)d

16.23

(23.73)d

12.83

(20.96)d

12.25

(20.53)cd

Biogreen-L 58.84

(50.07)eb

65.69

(54.15)e

55.53

(48.16)e

40.36

(39.47)ce

Chemical

check

10.43

(18.81)df

4.91

(12.79)f

9.32

(17.76)df

9.45

(17.85)df

Control 88.89

(70.54)a

92.07

(73.57)a

89.69

(71.28)a

88.60

(70.27)a

S.Ed(±) 5.01 4.88 3.90 5.52

CD (0.05) 10.47 10.19 8.15 11.53

Data in the parenthesis are angular transformed values



C.2. Efficacy of microbe based bioformulations in management of bacterial leaf blight

(BLB) of rice and enhancement of plant growth attributes

Finding: Microbe based bioformulation suppresses BLB of rice and enhances plant growth

attributes

OFT was made on organic management of major rice disease (BLB) with five in house

developed biopesticides viz. Bioveer, Biotime, Biogreen-5, Biosona, and Biofor-Pf. The

Biogreen-5 @ 2% exhibited significantly highest reduction of BB (59.38%), along with increase

in yield. Antibiotic used as a chemical check however showed better reduction of BLB pathogen

in vitro and disease in field.

C.2. In vitro efficacy of bioformulation against BLB pathogen Xoo



Table. Field efficacy of microbe based bioformulations in reduction (%) of bacterial leaf

blight (BLB) of rice and enhancement of grain yield

Treatments Disease incidence

(%)

Disease reduction

over control (%)

Grain yield (q/ha)

T1:Bioveer @2%+ Xoo 36.09

de(36.87) 54.00 26.52

T2:Biotime @2%+ Xoo 48.36

c(44.03) 41.73 22.08

T3 :Biogreen @2%+ Xoo 30.71

ef(32.82) 59.38 29.86

T4

:Biosona @2%+ Xoo 57.76b(49.43) 32.33 19.72

T5:Biofor-Pf @2%+ Xoo 40.19

cd (39.29) 49.90 25.83

T6:

Copper oxychloride @ 0.2%+

Xoo 43.20

c(41.09) 46.89 17.50

T7 :[email protected]% + Xoo 32.81

e(34.49) 57.28 19.40

T8 : Control Xoo alone 90.09

a(71.57) 10.71

S.Ed. ± 3.09 2.07

CD (P=0.05

) 6.33 4.25

• Data in the parenthesis are angular transformed values.

C (2.I) A rice field showing typical symptoms of BLB in rice in different crop stages

A B

BLB infected (A) rice field leaf (B) rice leaf

A B C

Plates 1(A-C). Three typical stages of BLB of rice in field



C (2.II) OFT Experimental plots of rice showing effect of best bioformulation ‘Biogreen-5’ at

maturity stage (year 2018)

On-Going Research Activities

• Bioprospecting Actinobacteria of Assam for some rice disease management and

growth promotion

• Isolation and characterization of fluorescent Pseudomonads, their biocontrol ability

against bacterial wilt pathogen Ralstonia solanacearum

• Molecular characterization of aroid germplasms of North East India–assessment of

host resistance and biological management of bacterial

• Bioengineering microbial antagonists with Jatropha (Jatropha curcas) oil and

resultant suppression of bacterial wilt (Ralstonia solanacearum) of tomato

• Bioremediation of Arsenic (As) with consortia of arsenic degrading bacteria and

plant growth promoting microbes

• Consortia of Methanotrophic Bacteria and Plant Growth Promoting Microbes for

Management of Rice Diseases and Suppression of Methane Emission

Earmarked Future Thrusts

• Enhance Production and Productivity of Biopesticides

• Develop and Screen aggressive strains of Bioinoculants

• Develop and refine Protocols for New biopesticides

• Develop more consortia of antagonist s along with PGPR

• More FLDs in different crops

• More Training and motivational programme to be organized among farming

community

• Combined efficacy of Parasitoid-Fungal-Bacterial biopesticides to be tested

particularly in tea and rice sector.

• Exploring botanical biodiversity of Assam and North East and development of

botanical based bioformulation



Publications:

Book Chapter

• Bora L. C., Bora P., Gogoi M., Potential of Trichoderma spp. for Pest

management and Plant Growth Promotion in NE India. In: Trichoderma -Host

Pathogen Interactions and applications, Sharma P. & Sharma A. K.; Springer

Publications

Others:

Authorized inspection team of the FairCert Certification Services Pvt. Ltd., an accredited

inspection and certification body under NPOP visited the Biopesticide lab of DBT-AAU

Centre, Jorhat in order to certify the developed bioformulations as per the standards of

NSOP/NPOP.

Acknowledgements:

The scientific staffs acknowledge the DBT, GoI, Centre Director, DBT_AAU Centre, AAU,

Jorhat, for generous funding and Assam Agricultural University, Jorhat for providing

administrative facilities and support.

Inspection team checking standard protocols and Stock Register

Academics

HRD and Capacity Building 77


Human resource development and capacity

building

National/International level scientific Workshop/Meeting attended:

Dr. Bidyut K. Sarmah, ICAR National Professor and Director, DBT-AAU Centre attended the

kick-off meeting of AdaptNET, under Erasmus+ programme of the European Commission, held

at Athens during March 7-8, 2019.

Mr. Manab B Gogoi Assistant professor Attended and Participated in “International

Conference on trends in Plant Sciences and Agrobiotechnology 2019” held at Indian Institute

of Technology Guwahati, during 14-16 February, 2019, organized by Department of

Biosciences & Bioengineering and Centre for Rural Technology, IIT Guwahati, India in

association with Plant Tissue Culture Association- India (PTCA-I)

Mr. Manab B Gogoi Assistant professor Participated in 3-day National workshop on “Potential

Biotechnology Programme Using Bioresources of NE Region” from September 12-14, 2019

organized by DBT- North East Centre for Agricultural Biotechnology (DBT-NECAB), AAU

Jorhat.

Ms. Rubi Gupta PhD Scholar participated in 6th Annual South Asia Biosafety Conference held

in Dhaka on 15th September 2018

Ms. Rubi Gupta PhD Scholar selected and participated in the international biosafety and

biotechnology programme at Michigan state university, USA.

Dr. Moloya Gohain, Dr. Sudipta Sankar Bora and Dr. Rajib Das, Project Scientists under

the DBT-NECAB visited major agricultural biotechnology research organizations and institutes

in New Delhi, under the ‘Scientific-exchange programme’.

Dr. Sushil Kumar Singh, RA, has participated in workshop-cum training on NGS data

analysis held on 14th March to 16th March 2019, organized by Distributed Information Centre

(DIC), Department of Agricultural Biotechnology, AAU, Jorhat.

Mrs. Sandhani Saikia, JRF, has participated in Workshop-cum Training on NGS data

analysis held on 14th March to 16th March 2019, organized by Distributed Information Centre

(DIC), Department of Agricultural Biotechnology, AAU, Jorhat.

Recognitions to our scientists/researchers

Dr Bidyut K. Sarmah, ICAR National Professor and Director, DBT-NECAB appointed as

member of newly constituted STAG (Scientific and Technical Appraisal and Advisory Group),

the highest body to review projects under agriculture animal science and plant science for North

East region.

Dr. Bidyut Kumar Sarmah, ICAR National Professor and Director, DBT-NECAB recognized

as Outstanding Reviewer by the Indian Society of Genetics and Plant Breeding (ISGPB)

HRD and Capacity Building 78


Prof. Madhumita Barooah, selected to hold a joint workshop under UKIERI initiative of

DST, India and UK India Education & Research Initiative (UKIERI) foundation

Dr Prasant Das, Assistant Professor selected by DBT, Govt of India for his post-doctoral

research at IRRI, Philippines

Dr Indrani Baruah student of Professor Bidyut Kumar Sarmah selected for postdoctoral

research at Agricultural Research Service (ARS) Research program under the mentor Dr. Bryan

Bailey at the Sustainable Perennial Crops Laboratory (SPCL) located at Baltimore, Maryland,

USA.

Dr Tankeswar Nath, Assistant Professor and Dr. Moloya Gohain, Project Scientist selected

for 4-weeks AdaptNET Training in three (3) European Institution and ICRISAT, India.

Mrs. Sandhani Saikia is selected for 3-month training program in one of the European

AdaptNET organizations. AdaptNET (Strengthening education, research and innovation for

climate smart crops in India) is an ERASMUS+ CAPACITY BUILDING project, funded by

the European Commission.

Invited talk presented by the Director:

• Talk on “DBT-AAU Centre at a glance” at Anand Agricultural University, Gujarat on

13.11.2018.

• Talk on “Transgenic technology: opportunities and challenges” in ISCB symposium under

Indo-Swiss Collaboration in Biotechnology during Dec. 3-4, 2018. Also chaired the session.

• Talk (invited) entitled “Entrepreneurship: scope in N E India and role of DBT-AAU Centre”

delivered and acted as and panel member in “Innovation cum entrepreneur meet” at CSIR-

NEIST, May 8 – 11, 2019

• Delivered key note address in 4th edition of National Green summit, and acted as a panel

member, on “Biotechnology interventions on sustainable development and utilization of

Bioresources for environmental management and livelihood generations in North east

region” at IIT, Guwahati on 3rd Nov, 2019.

• Delivered key note address in National conference on “Bio exploration for human welfare-

An integrative approach” on 9th Nov, 2019 at Assam down town University

• .

Scholarships and Extension 79


Scholarships for PhD Scholars:

A total of seven Ph.D. scholars have received a scholarship for the FY 2019-20; the academic

year 2017-18 under DBT-NECAB, Assam Agricultural University, Jorhat. Below is the list of

scholars:

Sl No Name of the Candidate Institution in where PhD pursued

2018-19

1. Chandrika Buragohain ABT, AAU, Jorhat

2. Lipika Khataniar ABT, AAU, Jorhat

3. D Shephrou Helena ABT, AAU, Jorhat

4. Reshma Ahmed ABT, AAU, Jorhat

5. Snigdha Bora ABT, AAU, Jorhat

6. Panchashree Das ABT, AAU, Jorhat

7. Jyotsna Dayma ABT, AAU, Jorhat

Fellowship awarded to PhD student for training:

Student(s) On

Year

Institute where training obtained

Ms. Rubi Gupta 2018-19 Michigan state university, USA, and Dhaka University, Bangladesh

Mr. Dharmendra Singh Lagoriya 2019-Present

University of California, Davis

Satellite Labs under DBT-NECAB

DBT-NECAB has sanctioned total amount of 75 lakhs and released 15 lakhs each to the

following five institutes for infrastructure development according to the budget provided by

DBT- GoI to setup satellite laboratories under DBT-NECAB.

1. Nagaland University, School of Agricultural Sciences & Rural Development,

Medziphema Campus

2. Central Agricultural University, Iroisemba, Imphal, Manipur

3. School of Post Graduate Studies, Central Agricultural University, Umiam,

Meghalaya

4. College of Agriculture, Tripura Lembucherra, West Tripura

5. Dept. of Biotechnology, School of Life Sciences, Mizoram University, Aizwal

Report on Progress received from Tripura and Mizoram Centre.

Training and Awareness 80


Meetings, Symposium, Workshops, Scientific Trainings and

Awareness Programmes

INAUGURAL CEREMONY OF DBT-NECAB AND FIRST SCIENTIFIC ADVISORY

MEETING

November 19-20, 2018

The Department of Biotechnology, Ministry of Science and Technology, GOI-funded-the North

East Centre for Agricultural Biotechnology (DBT-NECAB) was formally inaugurated on the 19th

Nov, 2018 at Assam Agricultural University, Jorhat by the Honourable Vice Chancellor, Dr. K.

M. Bujarbaruah in presence of Dr T. J. Higgins, an world expert in the field of Genetic

Engineering from CSIRO, Canberra, Australia and Chairman of the Scientific Advisory

Committee of the Centre; Dr. Mohd. Aslam, Adviser, DBT, GoI, and Dr T. Madhan Mohan,

Consultant Advisor, NERBPMC, DBT. Earlier, Dr. B. K. Sarmah, Director, DBT Centre

welcomed all dignitaries and others present in the ceremony.

INTERNATIONAL SYMPOSIUM: BIOTECHNOLOGY FOR FOOD-NUTRITIONAL

SECURITY & ORGANIC AGRICULTURE March 25-26, 2019

The two-day long scientific meet was carried out

with discussions on various issues of Food

Nutrition and Organic Farming. Inaugurated by

the Honorable Vice Chancellor Prof. K. M.

Bujarbaruah as the Chief Guest and Prof. N. K.

Singh, ICAR- National Professor (B P Pal Chair)

& Director, NRCPB, New Delhi, as the Guest of

Honour, the symposium was graced with the

presence of well-known educationist and scientist Padmashree Prof. S. K. Sopory, Ex. Vice

Chancellor, JNU, New Delhi and eminent scientist Prof. Douglas Cook, Director, Feed and Future

Innovation Lab, U C Davis, USA. Along with technical sessions, a competition of Poster

Presentation was organized where more than eighty participants presented scientific posters.



NATIONAL WORKSHOP: POTENTIAL BIOTECHNOLOGY PROGRAMMES USING

BIORESOURCES OF THE NE REGION

September 12-14, 2019

The National workshop was

organized with the aim of

bioprospecting the available

bioresources as a multidisciplinary

challenge, strengthening public-

private partnerships in scientific

research and value addition of

resulting products. The Keynote

Speakers included Prof. Prabhakar

Ranjekar (Eminent Biotechnologist, Retd. Director, IRSHA & Retd. Head, Biochemistry, NCL,

Pune); Dr. Kuldeep Singh (Director, ICAR-NBPGR, New Delhi); Dr. P. M. Bulakh (Director,

BCUD, Bharati Vidyapeeth University) and Dr. Arvind Kumar (Director, IRRI-SARC,

Varanasi). Dr. T Madhan Mohan, Consultant Adviser, DBT-NERBPMC, GoI, New Delhi,

addressed the gathering as the Guest of Honour. A short documentary film on various activities

of DBT-AAU Centre entitled ‘ABHASHA - A glimpse of the Technology Renaissance in NE

India’ was released.



On Site Awareness and Training Programmes

Trainings were conducted among STGs of Assam to enlighten about utility of developed

biopesticides for production of organic tea. Moreover, trainings were also conducted in

different locations of Assam, Arunachal Pradesh and Meghalaya states on organic cultivation

of vegetables, zinger, black pepper and betel vine.

Training Programme on Organic Agriculture in different locations (East Khasi Hills, Meghalaya)

A (III) Training Programme on organic agriculture in different locations (Namsai, Arunachal)



A(IV) Training programmes: ‘Biofertilizer Group’ (Programme Objective IV)

Sl.

No

Title of Events

Attended

Organized

by

Period Sponsored by Venue

1 Advances in organic

Farming and INM

EEI in

collaboration

with Tripura

Govt

10-13

July, 2018

Directorate of

Agriculture,

Govt of

Tripura

T-Sameti,

Agartala,

Tripura

2 Promotion of organic

farming in Nagaland

EEI in

collaboration

with

Nagaland

Govt

17-20

July, 2018

Directorate of

Agriculture,

Govt of

Nagaland

Sameti,

Medziphema,

Nagaland

3 Promotion of organic

farming in Manipur

EEI in

collaboration

with Manipur

Govt

17-20, Jan

2019

Directorate of

Agriculture,

Govt of

Manipur

Sameti,

Imphal,

Manipur

4 Promotion of

Bioinputs for

enhancing organic

Agriculture in Tripura

EEI in

collaboration

with Tripura

Govt

06-09,

Aug,2019

Directorate of

Agriculture,

Govt of

Tripura

T-Sameti,

Agartala,

Tripura

5 Techniques in Bio-

fertilizers and

Biopesticides

Production for

Organic Agriculture

CAFT, ICAR 21 days ICAR, Govt of

India

Dept. of Soil

Science, AAU,

Jorhat.

6 Developments in

Organic Agriculture


India

Dept. of Soil

Science, AAU,

Jorhat.

7 Beneficial microbes in

organic farming


India

Dept. of Soil

Science, AAU,

Jorhat.

Training and Awareness

84


(B) TECHNOLOGY TRANSFERRED

MoU signed with following enterprises to transfer the biopesticide production technology developed

by Biopesticide lab of DBT-AAU Centre under PPP mode-

1) VRS Agritech, Guwahati

2) School of Livelihood & Rural Development (SLRD), Shillong

3) M/s Orgaman R&D Division, Jorhat

(C) ENTREPRENEUR DEVELOPED

Training has been provided to following Seven (7) entrepreneurs on commercial production of Bio-

inputs-

1. M/S Balaji Chemicals; Poprietor: Mr. Somit Poddar, Lepetkata, Dibrugarh

2. M/S Rupom; Proprietor: Mr. Prantic Bora, Jail Road, Jorhat

3. M/S O-Green; Proprietor: Mr. Annada S. Kalita, Sootea, Sonitpur

4. M/S Eastern Bio-Tech Solution; Proprietor: Mr. Arif Ali, Jorhat

5. M/S Bordoloi Associates; Proprietor: Dr. Bijit Bhattacharyya, Dibrugarh

6. Sanjiv Goswami, Panigoan, Nagoan

7. M/S Madhuram; Prop: Mr Ratul Baruah, Tiliki Aam, Jorhat

8. M/S Bordoloi Associates, Dibrugarh

9. Prop: Dr. Bijit Bhattacharyya

10. Mr. Abhijit Saikia; Biotech Centre, Dibrughar University, Assam

(D) PRODUCT COMMERCIALIZED

One biopesticide product (Bioveer) released for commercialization with CIB registration.


Projects through Extramural Grants

85

Ongoing projects of Associated Scientists

obtained through Extramural Grants

1. Project Title: Study of mitochondrial electron transport chain (ETC) dysfunction that

modulates aging and development in C. elegans through CEP-1, the worm homolog of

mammalian p53

Principal Investigator:

Dr. Aiswarya Baruah, Asst Prof., DBT-AAU Centre, AAU

Funding Agency: DBT, Govt. of India

Nature of the Project: DBT - U-EXCEL

Duration: 3 years (2016-2019)

Grant total for 3 years: `123.56 lakhs

2. Project Title: Genetic studies to understand mitochondrial electron transport chain

dysfunction using Caenorhabditis elegans

Associated Scientists:

Dr. Aiswarya Baruah (PI and Co-ordinator), Asst Prof., DBT-AAU Centre, AAU

Dr. Arnab Mukhopadhyay (PI), NII, New Delhi

Dr. Bidyut Kumar Sarmah (Co-PI), ICAR National Professor


Nature of the Project: DBT - Twinning


Grant total for 3 years: `121.45 Lakhs

3. Project Title: Studies on role of endophytes in variation of acaricidal properties of two

acaricide producing plant species NBA22/f1 andNBA18/D1

Associated Scientists:

Dr Tankeswar Nath (PI and Coordinator), Asst Prof., DBT-AAU Centre, AAU

Mr Manab Bikash Gogoi (Co- PI), Asst Prof., DBT-AAU Centre, AAU

Dr. K. Swarnalakshmi (PI), ICAR - IARI, New Delhi

Dr. Shoma Paul Nandi (PI), Amity University, NOIDA

Dr. Sarad Sriva stava (PI), CSRI- NBRI, Lucknow

Dr. Srikant Ghosh (PI), ICAR - IVRI, Izatnagar



Grant total for 3 years: `144.46 lakhs

4. Project Title: Functional validation of yield related genes in black rice.


Dr. Prasanta Kr Das (PI), Asst Prof., DBT-AAU Centre, AAU




86


Grant total for 3 years: `40.8 lakhs.

5. Project Title: Understanding the molecular mechanism of anaerobic germination in

hypoxia tolerant rice germplasms of Assam through functional genomics study.






6. Project Title: Screening of indigenous rice germplasms of Assam for tolerance to

anaerobic condition during germination and marker assisted introgression of traits into elite

Rice Variety".






*Progress report has not been included as PI is under training abroad.

7. Project Title: Seedless plant production and mass scale propagation of Musa balbisiana

(Bhimkol banana) of NER using in vitro approach

Principal investigator: Mr Manab Bikash Gogoi, Asst. Prof., DBT-AAU Centre, AAU, Jorhat

Co-Principal investigator:

Dr. Priyadarshini Bhorali, Asst. Prof., DBT-AAU Centre, AAU, Jorhat

Partner Institutes: IIT, Guwahati; JNU, New Delhi

Funding Agency: DBT, Govt. of India (DBT/NE/U-Excel/2014).

Grant: 39.5 lakhs

Duration: 3 years (March, 2018- March, 2021



87

PROGRESS MADE

Efficacy evaluation of encapsulated fungal formulation for improving crop

phosphorus nutrition

Principal investigator: Dr. Tankeswar Nath, Asst. Prof., DBT-AAU Centre, AAU, Jorhat

Co-PI/Co-Investigator: Dr. Robin Chandra Boro, Asst. Prof., DBT-AAU Centre, AAU, Jorhat

Funding Agency: DBT, Govt. of India (Twinning project)

Findings:

Effective fungal formulation for phosphate solubilization in acid soils of Assam has been

identified and applied in the Rape seed crop grown in ICR-Farm, AAU, Jorhat, during the year

2018-19. The incorporation of phosphate solubilising fungal formulation into the crop field

showed significant increase in yield as compared to the control plots. This increased in yield with

application of phosphate solublizing fungal formulation might be due to release of soil-bound

phosphate by the fungus of the formulation. It was also observed that where there was no

formulation applied P-level slightly decreased over the growing season but in other cases available

phosphorus almost remained same which might be due to slowly and continuous release of

phosphorus from the bound form by the applied fungal formulation. Potassium contents were found

higher where there was combination of P- and recommended doses of P-fertilizer. At 30DAS the

potassium content increases then gradually decreases again. This increase potassium might have

some interaction with applied encapsulated fungal formulation, their metabolic activity as well as

interaction with other soil microbial activities

Assessment the persistence and traceability of microbial strains applied with bio-

formulation and its effect on autochthonous soil microorganisms has to be established (under

progress)



88

Studies on role of endophytes in variation of acaricidal properties of two

acaricide producing plant species NBA 22/F1 and NBA18/D1 from North

Eastern States

Principal investigator: Dr. Tankeswar Nath, Asst. Prof., DBT-AAU Centre, AAU, Jorhat

Co-PI/Co-Investigator: Mr. M. B. Gogoi, Asst. Prof., DBT-AAU Centre, AAU, Jorhat

Funding Agency: DBT, Govt. of India (Twinning project)

Grant: 144.46 lakhs

Duration: 3 years (Jan, 2017- Jul,2020)

Findings:

The plant samples of Argemone mexicana and Datura metel showing high and low acaricidal

activity was collected from different locations Assam. Presence of metabolites like Atropine and

Scopolamine in Datura and Berberine and Sanguinarine in case of Argemone were identified using

HPTLC for standardization of extracts. Acaricidal potential of these plant extracts was tested

against the field ticks collected from five different districts of Assam viz. Barpeta, Kamrup

Metropolitian, Morigaon, Nagaon and Sonitpur and Ri-Bhoi district of Meghalaya. The soil

properties as well as rhizopheric and endophytic microorganisms (bacteria and fungi) associated

with these plants were also determined. Among the endophytes identified, the Bacillus subtilis

species was found to be predominant bacteria in both A. mexicana and in D. metel. Among fungal

endophytes, the genus Aspergillus was found predominant in both the plant species. The

unculturable microrganisms in rhizospheric soils and plant tissues of D. metel showing highest and

lowest acaricidal activity was identified by next generation sequencing.



89

Study of mitochondrial electron transport chain (ETC) dysfunction that

modulates aging and development in C. elegans through CEP-1, the worm

homolog of mammalian p53

Principal investigator: Dr. Aiswarya Baruah, Asst. Prof., DBT-AAU Centre, AAU, Jorhat


Grant: ₹ 123.56 lakhs

Duration: 3 years (March 10. 2016 to September 30. 2019)

Findings:

The mitochondrial ETC dysfunction either by genetic mutation (isp-1) or mitotoxicant paraquat

produces mitochondrial superoxide and reduces mitochondrial membrane potential. These

mitochondrial signals lead to the induction of cep-1 and its downstream target egl-1. Moderate

ETC dysfunction also increases C. elegans lifespan but reduce the progeny number. The concurrent

exposure to paraquat over generation effects mtDNA/nDNA ratio differently in cep-1 and isp-1

mutants compared to wt. Upon mitochondrial ETC dysfunction, cep-1 targeted, lipid metabolism

genes fat-2 (fatty acid desaturase), acs-2 (acyl CoA synthetase) and asah-1 (N-acylsphingosine

amidohydrolase) are involved in lifespan determination and fecundity.



90

Genetic studies to understand mitochondrial electron transport chain

dysfunction using Caenorhabditis elegans

Principal investigator: Dr. Aiswarya Baruah, Asst. Prof., DBT-AAU Centre, AAU, Jorhat

Dr. Arnab Mukhopadhyay, National Institute of Immunology, New Delhi

Funding Agency: DBT, Govt. of India (DBT-Twinning: BT/PR16823/NER/95/304/2015)

Grant: ₹121.45 lakhs

Duration: 3 years. (January 9. 2017 to January 9. 2020).

Findings:

The objectives of this study were to determine how CEP-1/p53 modulates lifespan

and development of ETC mutants in collaboration with PLRG1/PLRG-1 and the molecular

role of CEP-1/p53 in Dietary Restriction (DR)-mediated life span extension. The plrg-1 RNAi

knockdown causes embryonic lethality in worms in tested genotypes [N2, cep-1 (gk138), isp-

1 (qm150), gas-1(fc21) and cep-1(gk138); gas-1(fc21)]. The plrg-1 RNAi knockdown during

development of worm significantly reduced lifespan of wild type (N2), cep-1 (gk138), cep-

1(gk138); isp-1(qm150) and cep-1(gk138; gas-1(fc21) mutants. These results indicate that the

nuclear protein PLRG-1 is involved in determining lifespan, development and reproduction

in C. elegans. It was also found that the CEP-1 is specifically required for genetic paradigms

of Dietary Restriction (DR) and germline mediated lifespan extension.



91

Seedless Plant Production and Mass Scale Propagation of Musa Balbisiana

(Bhimkol Banana) of NER Using in vitro Approach

Principal investigator: Mr. Manab Bikash Gogoi, Asst. Prof., DBT-AAU Centre, AAU, Jorhat

Co-Principal investigator: Dr. Priyadarshini Bhorali, Asst. Prof., DBT-AAU Centre, AAU, Jorhat

Partner Institutes: IIT, Guwahati; JNU, New Delhi


Grant: 39.5 lakhs

Duration: 3 years (March, 2018- March, 2021

Findings:

The objective of this work was to identify Musa balbisiana cv Bhimkol and to

establish an optimized protocol for anther culture and endosperm culture to obtain haploids

and triploids.

The banana explants of Bhimkol was collected from different agro-climatic zones of Assam

and these plants are being maintained at AAU, horticulture field and tissue culture laboratory

under Department of Agricultural Biotechnology, Initially we studied different morphological

parameters in Bhimkol accessions, like plant height, pseudostem diameter, no of

pseudostems/suckers, no. of seed per fruit, fruit length, fresh weight of seeds and dry weight

per banana fruit. We found that, bhimkol takes 24 months to flower in comparison to

commercially cultivated triploid species like Jahaji and Malbhog banana plants which flowers

in15 months.

Based on our objectives, the male flowers with five stamens were taken from the 20th

to 30th bract of the inflorescence (koldil) after 30 days of bunch shooting from field grown

plants. Anthers were carefully isolated and transferred into petriplates. Treatment of explants

with 70% ethanol for 2 minutes, 0.2% fungicide for 5 minutes and 1% mercuric chloride for

10 minutes. Anthers with uninucleate microspore stage were inoculated in to media and kept

in the dark, however blackening of anther tissues was observed due to high polyphenol

secretion from cut surface after 7 days. Callus development and shoot regeneration was



92

investigated on Murashige and Skoog (MS) basal medium supplemented with different

concentration of 2,4-D, and 6-Benzlyaminopurine (BAP) either alone or in combination with

Indole acetic acid (IAA). Callus formation was observed on MS medium supplemented with

BAP (1.0 mgL-1) and IAA (2.0mg L-1). However, regeneration is poor. based on our second

objective, seed morphology studies was carried out under bright field microscope where, we

found the presence of crimson color semi liquid endosperm in the immature seed; however,

in the mature bhimkol seeds the endosperm becomes blackish in color and turns very hard,

therefore, endosperm from immature seed is being used in vitro regeneration of triploid plants.

However, further research is under progress.

Fig1: Anther Culture Fig 2: Development of callus

Fig: Endosperm in the centre of immature seeds

under bright field microscopre. Fig4: Mature seeds

Proceedings of 1st SAC meeting

Proceedings of 1st SAC meeting 95


DBT-NECAB

Assam Agricultural University Jorhat, Assam

Minutes of Meeting: 1st Scientific Advisory Committee (SAC) held on 19th Nov, 2018 Venue: Meeting Room, DBT-AAU Centre

Members present:

- Dr T J V Higgins, Honorary Fellow, CSIRO Agriculture and Food, Canberra and Chairman

SAC

- Dr K M Bujarbaruah, Vice Chancellor, AAU and Co-Chairman, SAC

- Dr Md Aslam, Adviser, DBT, member

- Dr T Madhan Mohan, Consultant Adviser, DBT-NERBPMC and member

- Dr Sunil Mukherjee, Senior Scientist, INSA: DBT nominee and expert member

- Dr M V Deshpande, Emeritus Scientist, NCL, Pune: DBT nominee and expert member

- Dr M K Modi, Head of Department, Agril. Biotechnology and member

- Dr B K Sarmah, Director DBT-AAU Centre, Coordinator, DBT-NECAB and member,

Secretary

The Chairman, Dr T J V Higgins welcomed all members of the Scientific Advisory Committee

(SAC). This was the 1st SAC meeting after the Department of Biotechnology funded North

East Centre for Agricultural Biotechnology (DBT-NECAB) was sanctioned to Assam

Agricultural University, Jorhat on 1st Oct, 2018 to upgrade the DBT-AAU Centre established

in 2011. A ceremony was organized in which the DBT-NECAB was formally inaugurated by

the Honorable Vice Chancellor, Dr K M Bujarbaruah in presence of Dr T J Higgins, dignitaries

from DBT (Dr Md Aslam and Dr T Madhan Mohan); experts of the SAC (Dr S Mukherjee and

Dr M V Deshpande); all Deans and Directors of AAU; all Heads of the departments, AAU;

scientists, faculty, office staffs and students.

Dr Higgins welcomed the promising prospect of biotechnology in the N E region of the country

with the current funding and thanked the officials of DBT, GoI. Complementing the

Chairman’s remarks, Dr K M Bujarbaruah, Vice Chancellor and Co-Chairman of SAC

welcomed the members and acknowledged the valuable inputs made in the Steering Committee

meeting held prior to the SAC meeting on the same day. He offered special thanks to Dr

Higgins for coming from Australia and chairing the meeting.

Dr B.K Sarmah, Director DBT-AAU Centre and coordinator of NECAB briefly summarized

the progress made in Phase I by the five programmes. He highlighted the strategic plans of

NECAB to achieve the targeted goals approved by the DBT.

R&D Objectives of NECAB for the next 3 years

1. Genetic improvement of rice for abiotic and biotic stress tolerance using


2. Genetic improvement of chickpea using gene technology for insect resistance

Proceedings of 1st SAC Meeting 96


3. Bioprospecting of soil microbes from acidic soils of N E region

a. Plant-microbe interaction especially with rice plants

b. Identification and isolation of acid tolerance genes

c. Metabolic engineering of rice to tolerate acidic conditions

4. Development of efficient biofertilizers and biopesticides using novel microbial strains from

NE soils.

In order to fulfil these objectives, following five research groups have been formed, Dr Sarmah

added.

Five major Research groups have been formed to fulfill our goals:

1. Rice molecular breeding (Dr M K Modi (PI) and Associates Dr R Sarma, Dr A Baruah)

2. Chickpea gene technology (Dr S Acharjee (PI), and Associates Dr A Baruah, Dr B K Sarmah,

with Mentor, Dr T J Higgins)

3. Bioprospecting of microbes from acid soil (Dr M Barooah(PI), and Associate Dr R Boro)

4. Biofertilizers (Dr R Baruah (PI), and Associate Dr T Nath)

5. Biopesticides (Dr L C Bora (PI), and Associates Dr P Bora and Dr D Saikia)

The DBT also sanctioned five satellite laboratories under DBT-NECAB in the different States

of N E other than Assam. During Phase-I, seven satellite laboratories were established in the

State of Assam. Dr Sarmah specified the Institutes and contact persons chosen as potential

organizations to set up satellite laboratories.

Potential Institutes wherein such labs may be established:

Tripura : College of Agriculture, (Contact: Dean)

Meghalaya : College of Agriculture, CAU, (Contact: Dean)

Nagaland : Nagaland University (Contact: Prof Akali Sema)

Manipur : CAU (Contact: Vice Chancellor)

Sikkim : Sikkim University (Contact: Prof Jyoti Prakash Tamang)

Arunachal : New DBT Centre at Kimin (Contact: Director)

Dr Sarmah elaborated that the new DBT Centre at Kimin, AP is being mentored by AAU

thereby facilitating the transfer of technology to that Centre. The other new satellite Centres

will be established with funding from DBT-NECAB sanctioned by the DBT. Primarily,

bioinput production technologies and tissue culture technology will be transferred for further

evaluation in the States and, if necessary, training will be provided to their scientists and

students on the application of such technologies. The funds will be transferred in instalments

upon submission of progress report from the respective Centres.

Dr Sarmah also reported on the recruitment of manpower (project scientists, RAs and JRFs) as

per sanction was complete and Technical Assistant positions had already been advertised. He

underlined the issue of insufficient manpower for various activities at the Centre including

research, academics and extension. He requested that positions sanctioned during Phase-I be

continued and additional manpower in Phase-II be sanctioned, considering the commitment



made for the programme. The advisers and experts of DBT recognized the issue and invited

the Director to submit a proposal to the DBT at the earliest for urgent action.

The SAC members proposed that each PI should submit a detailed project plan for the next

three years within two weeks. The plan will be critically reviewed by experts. The suggestions

and specific comments obtained will eventually help achieve goals of each programme. PIs

were asked to follow this strictly.

Dr T J Higgins summarized the recommendations of the SAC and emphasized the streamlining

of the project implementation strategies for the next phase. The major recommendations

included the sanction for additional manpower in Phase II and submission of detailed

project plan for the next three years within two weeks by each PI for expert review. The

Centre should focus on scientific evaluation in the field so that the farmers will benefit in time,

he added. Dr T Madhan Mohan commended the work executed by the Centre even before the

allotted timeframe. Dr Md. Aslam further assured the support of DBT in all capacities and

welcomed possibilities of offshoot partnerships from successful implementation of current

projects. The SAC experts fostered connections with prominent research laboratories to speed

up the implementation of the projects. The SAC also endorsed the suggestions put forward by

the steering committee to the PIs of different projects with regard to technical programme /

methodologies for successful implementation of the projects. The suggestions are stated below:

Project I: Genetic improvement of rice for abiotic and biotic stress tolerance using

molecular breeding, especially drought, submergence and bacterial blight

disease

Research Group: PI: Dr. M. K. Modi

Associates: Dr R. Sarma and Dr. A. Baruah

Suggestions of Steering committee:

1. Alternative approach for validation of QTLs besides qRT-PCR may be used

2. The varietal release process of Phase I should be streamlined and focused

3. Scientific record of the released varieties should be maintained

4. Collaboration with Dr. Ramesh V. Sonti at NIPGR on bacterial blight could speed

up the project as suggested by Dr Mukherjee.

Project II: Genetic improvement of chickpea using gene technology for insect resistance

Research Group: PI: Dr S Acharjee.

Associates: Dr A Baruah and Dr B K Sarmah

Mentor: Dr T J Higgins


1. Dr Mukherjee suggested revisiting the gene construct maps before final construction. He

suggested using different promoters to express different Cry genes when placed within the

same T-DNA in order to avoid any possible gene silencing. Dr Mukherjee also suggested

use of miRNA gene constructs to control Helicoverpa sp.



Project III: Bioprospecting of soil microbes from acidic soils of N E region

Research Group: PI: Dr M Barooah

Associate: Dr R Boro


1. Project should focus on cloning potential acid tolerance genes from already identified soil

microbes and their validation. High success rate must be properly validated.

2. Interaction of such microbes (acid tolerance) and their interactions with plant functions need

to be studied thoroughly.

3. Bioformulation that imparts tolerance to high concentration of Aluminum and acid should

also be developed in collaboration with biofertilizer group as such formulations have

significant demand in the field

Project IV: Development of efficient biofertilizers using novel strains of N E soils.

Research Group: PI: Dr R Baruah

Associates: Dr T Nath


1. The enzyme activity of the soil after the treatment of the biofertilizers may be assessed

2. If focus is oriented to acid tolerant bacteria and tolerance to Al and Fe toxicity, lowland rice

farmers may be benefitted

3. Before mass multiplication, strategies for pilot scale demonstration must be optimized

4. Scientific data from the field scale and validation is mandatory before releasing to the

farmers and firms for commercialization

5. The endophytes in tea and rice may be checked if they have any effect as biofertilizers

6. Comparative analyses of AAU biofertilizers and commercial products will be made

7. Novelty of biofertilizing microbes isolated from N E soils will be studied using molecular

and biochemical tools

8. Interaction of biofertilizing microbes with plant system in acidic soils should be studied in

collaboration with Dr M Barooah

Project V: Development of efficient biopesticides using novel strains of N E soils.

Research Group: PI: Dr L C Bora

Associates: Dr P Bora and Dr D Saikia

Suggestions of Steering Committee:

1. Streamline the strategy for the scientific validation of the bioformulations before releasing

them for public use

2. Focus on a logical conclusion from Phase 1. For that the bioformulations generated during

Phase-I should be scientifically evaluated and validated in field conditions

3. Biodiversity issues and off-target impacts have to be addressed before training the farmers

and entrepreneurs

Following the remarks of the Chairman and the SAC experts, the session concluded with a vote

of thanks from Dr B K Sarmah.

(Bidyut Kumar Sarmah)

Statement of Expenditure 99


Financial Statement of Expenditure

annual report sept. 2018- sept. 2019dbtaau.ac.in/docs/dbt-necab-annual report 2018-19.pdfdbt-north...

Documents