Upload File

Download - Additional File1, Figure S1

Transcript
Page 1: Additional File1, Figure S1

Additional File1, Figure S1

CALM1 CALM2 CALM3 CD9

Top Related

Table S1. Sources used to determine the generation time of ... file1 Supplementary material Generation time references Table S1. Sources used to determine the generation time of each
Table S1. Sources used to determine the generation time of ... file1 Supplementary material Generation time references Table S1. Sources used to determine the generation time of each
Full Content List, Netherlands...Buffy The Vampire Slayer (S1-7) Castle (S1-8) Cleveland Show, The (S1-4) Cougar Town (S1 -6) Desperate Housewives (S1-8) Devious Maids (S1-4) Family
Full Content List, Netherlands...Buffy The Vampire Slayer (S1-7) Castle (S1-8) Cleveland Show, The (S1-4) Cougar Town (S1 -6) Desperate Housewives (S1-8) Devious Maids (S1-4) Family
PV9 SERIES 2-STAGE VARIABLE SPEED UPFLOW …1 51 DOOR KNOB, BLACK (4 Req’d) (Magnet) S1-02924412000 S1-02924412000 S1-02924412000 * 52 HARNESS, MAIN WIRING S1-37319811532 S1-37319811532
PV9 SERIES 2-STAGE VARIABLE SPEED UPFLOW …1 51 DOOR KNOB, BLACK (4 Req’d) (Magnet) S1-02924412000 S1-02924412000 S1-02924412000 * 52 HARNESS, MAIN WIRING S1-37319811532 S1-37319811532
Additional files Additional Tables: Table S1. Bacterial …10.1186... ·  · 2015-09-29Additional files Additional Tables: Table S1. ... glmS_pstR TACCGAGTAGAACCTCCTTAGC under glmS
Additional files Additional Tables: Table S1. Bacterial …10.1186... ·  · 2015-09-29Additional files Additional Tables: Table S1. ... glmS_pstR TACCGAGTAGAACCTCCTTAGC under glmS
Supplemental Figures S1-S8. Supplemental Figure S1
Supplemental Figures S1-S8. Supplemental Figure S1
Implementing the S1 Application Protocol in a Cloud Radio ......eNodeB eNodeB S1-U S6a S6a S11 S5/S8 SGi S11 S1-U UEs UEs S1-MME S1-MME S1-MME Figure1: LTEnetworkarchitecture. The
Implementing the S1 Application Protocol in a Cloud Radio ......eNodeB eNodeB S1-U S6a S6a S11 S5/S8 SGi S11 S1-U UEs UEs S1-MME S1-MME S1-MME Figure1: LTEnetworkarchitecture. The
AXI 04 AXI 05 - Hornbach · PDF file AXI 04 AXI 05 INFO@AXI.COM patented product ... INFO@AXI.COM 34 1 2 4 5 s1 8x s5 3 s5 s1 s1 1 5 4 3 s1 2 s5 s1 s5 3 2x s5 4x s1 s1
AXI 04 AXI 05 - Hornbach · PDF file AXI 04 AXI 05 [email protected] patented product ... [email protected] 34 1 2 4 5 s1 8x s5 3 s5 s1 s1 1 5 4 3 s1 2 s5 s1 s5 3 2x s5 4x s1 s1
THE ORLA DRESS Please see instructions for additional ... · PDF file1 THE ORLA DRESS 2 Please see instructions for additional information GATHER BETWEEN CIRLCES XS S
THE ORLA DRESS Please see instructions for additional ... · PDF file1 THE ORLA DRESS 2 Please see instructions for additional information GATHER BETWEEN CIRLCES XS S