Upload File

additional file1, figure s1

1
Additional File1, Figure S1 CALM1 CALM2 CALM3 CD9

Upload: maribel-herandez

Post on 31-Dec-2015

30 views

Category:

Documents


1 download

Report

DESCRIPTION

Additional File1, Figure S1. CALM1. CALM2. CALM3. CD9. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: Additional File1, Figure S1

Additional File1, Figure S1

CALM1 CALM2 CALM3 CD9

Implementing the S1 Application Protocol in a Cloud Radio ......eNodeB eNodeB S1-U S6a S6a S11 S5/S8 SGi S11 S1-U UEs UEs S1-MME S1-MME S1-MME Figure1: LTEnetworkarchitecture. The

Malaysia experiences: Better engagement in Aquatic Animal ... · KHV SVC ERD EUS Ikan Marin SVC Danio & Guppy IHHNV, IMNV VNN,RSIV AHPND TiLV NEGERI S1 S1 S1 S1 S1 S1 S1 S1 S1 S1

SuPPLementarY InFormatIon - Nature · WY-14643 0 total serum ketones (mM) controla * * * * Figure S1. Additional characterization of LiTsc1KO, LiRapKO, and rapamycin-treated mice

Document S1. Figs. S1–S8

Table S1. Sources used to determine the generation time of ... file1 Supplementary material Generation time references Table S1. Sources used to determine the generation time of each

Door Collection · GLAZED Victorian S1 SILVER GRILLE Victorian S1 COBALT Victorian S1 OWL TRANSFER Windsor SOLID Victorian S1 TINTED EMERALD Victorian S1 WILD ROSE ETCHED ... doors

Supporting Information Figs S1–S8, Tables S1–S4 2 3 Fig. S1 · 1 1 Supporting Information Figs S1–S8, Tables S1–S4 2 3 Fig. S1 4 5 Fig. S1 Phenotypes of wild type and wp1

Document S1. Supplemental Experimental Procedures, Figures S1

Additional files Additional Tables: Table S1. Bacterial …10.1186... ·  · 2015-09-29Additional files Additional Tables: Table S1. ... glmS_pstR TACCGAGTAGAACCTCCTTAGC under glmS

light and shadow.€¦ · Public Design S1 | R8 S1 | Q8 S1 | Q4 S1 | R8 S1 | Q8 S1 | Q4 STRUCTURELAB | S1 STRUCTURELAB | S1 exclusiveness-lifestyle design types playful precision

cdn-s1.lyreco.com filecdn-s1.lyreco.com

AXI 04 AXI 05 - Hornbach · PDF file AXI 04 AXI 05 [email protected] patented product ... [email protected] 34 1 2 4 5 s1 8x s5 3 s5 s1 s1 1 5 4 3 s1 2 s5 s1 s5 3 2x s5 4x s1 s1

Canon RAYO S1 Mini Projector · The RAYO S1 provides exceptional mono sound with woofer so you won’t have to lug around additional speakers. IMPRESSIVE AUDIO A head-turner with

Molecular and genetic alterations associated with therapy … · 2017. 8. 26. · (Table 1, Additional file 1: Table S1, Additional file 2: Table S2 and Additional file 3: Table S3)

Appendix S1: Additional Figures, Tables, and Analysesjsebastiantello.weebly.com/uploads/1/8/6/0/18603232/2012_tello_ste… · J. S. Tello and R. D. Stevens – Appendix S1 2 ADDITIONAL

Additional File 1: Table S1. List of protein coding genes ...hzi.openrepository.com/hzi/bitstream/10033/305259/2/table-s1.pdf · Rsad2 radical S-adenosyl methionine domain containing

S 1G W2 G1 S4 S1 S4 S1 L4 S2 S1 S2 L4 · 2018. 10. 9. · G1 S1 S2 S4 S4 S4 S1 S2 S1 S1 S1 S3 L4 S1 G1 S3 S1 S3 S3 3 S1 G1 S1 W2 S3 L4 S1 S3 X2S4 S3 S 1G V o r a b z u g AUFTRAGGEBER

S1 HP _ S1 Lang A and A

S 1G W2 G1 S4 S1 S4 S1 L4 S2 S1 S2 L4 · 2018. 9. 18. · G1 S1 S2 S4 S4 S4 S1 S2 S1 S1 S1 S3 L4 S1 G1 S3 S1 S3 S3 3 S1 G1 S1 W2 S3 L4 S1 S3 X2S4 S3 S 1G V o r a b z u g AUFTRAGGEBER

Document S1. Figures S1–S4, Tables S1 and S2, and Supplemental

S1 PhysicsAndMathsTutor.com June 2017 (IAL)€¦ · S1 PhysicsAndMathsTutor.com June 2017 (IAL) S1 PhysicsAndMathsTutor.com June 2017 (IAL) S1 PhysicsAndMathsTutor.com June 2017 (IAL)

2019 Chevrolet Car Camaro STANDARD EQUIPMENT - Coupe...the Owner's Manual for more information. S1 S1 S 1S S1 S1 S1 ... Audio system, Chevrolet Infotainment 3 system, 7" diagonal color

Document S1. Figures S1–S6, Table S1, and Supplemental

CDetection: CRISPR-Cas12b-based DNA detection …...the M13 phage genome (Additional file 1: Figure S1c and Additional file 2: Table S1). The non-canonical collateral ssDNA cleavage

Additional information: Figure S1

Supplement 1 Table S1: Additional guidelines for

static-content.springer.com10.1007... · Web viewSUPPORTING INFORMATION. Additional Supporting Information may be found in the online version of this article: Appendix S1. Examples

AXI 04 AXI 05 - Houten Speelhuisje.nl · [email protected] 34 1 2 4 5 s1 8x s5 3 s5 s1 s1 1 5 4 3 s1 2 s5 s1 s5 3 2x s5 4x s1 s1 s1 s1 180 1,5 170 180 180 3,5 x 50 5 x 90 A030.120.00

Control - Wikimedia · testb S2, S1 testbytes S1 & S2 cmpw S2, S1 comparewords S1 - S2 testw S2, S1 testwords S1 & S2 cmpl S2, S1 comparedoublewords S1 - S2 testl S2, S1 testdoublewords

English as an Additional Language or Dialect Teacher · PDF file1 English as an Additional Language or Dialect Teacher Resource Annotated Content Descriptions Science Foundation to

Q2ASCPU Q2ASCPU-S1 Q2ASHCPU Q2ASHCPU-S1 User’s …Q2ASCPU-S1,Q2ASHCPU… · Q2ASCPU Q2ASCPU-S1 Q2ASHCPU Q2ASHCPU-S1 Remark Control method Repetitive operation of stored program

MODEL S1, S2 Integrated Flame Scanner with Internal Flame ... · PDF file1 TYPE 95IR/95UV/95DS MODEL S1, S2 Integrated Flame Scanner with Internal Flame Relay RoHS Compliant to EU

Supporting Information Figs S1-S3, Table S1 & Notes S1

Translocation of carbon from surface organic horizons to ... file1 Table S1. List of compounds identified in dissolved organic matter samples from red pine and sugar maple stands organized

AS/400 Net Server Configuration Information From · PDF file1 of 21 AS/400 Net Server Configuration Information From IBM For Additional Information: