Transcript
Page 1: 22nd Sunday in Ordinary Time August 30, 2020 · 8/30/2020  · Second Collection Next weekend, the second collection will be taken up for the Black and Indian Missions. The Black

22nd Sunday in Ordinary Time August 30, 2020

St. Cecilia Church

Page 2: 22nd Sunday in Ordinary Time August 30, 2020 · 8/30/2020  · Second Collection Next weekend, the second collection will be taken up for the Black and Indian Missions. The Black

#179 2

OFFICES Rectory 215.725.1240 Eleanor Kerwick Business 215.725.1240 Susan Wagner PREP 215.725.2821 Eileen Litka School 215.725.8588 Bobbie Mitchell Tuition 215.725.2201 Lisa Hnat Fax 215.725.2130 Website: www.stceciliafc.org School: scsfoxchase.org CYO Facebook: Saint Cecilia Catholic Youth Organization

Rectory Office Hours Currently closed ~ call 215-725-1240 for emergency.

Saint Cecilia Church 535 Rhawn Street

Philadelphia, Pennsylvania 19111

PASTOR Reverend Charles E. Bonner

PASTOR EMERITUS Reverend Msgr. Francis X. Dreger

PAROCHIAL VICAR Reverend Robert Lucas PERMANENT DEACON Deacon Patrick Diamond

PRINCIPAL Sister Catherine Irene Masino , IHM

VICE PRINCIPAL Sister Carolyn Elizabeth Braun, IHM

SACRAMENTS Baptism First three Sundays of the month at 12:15pm. Arrangements must be made at least two weeks prior to the Baptism. At-tendance at a Pre-Jordan class is required for first time par-ents. Please pre-register for class by contacting the Rectory at 215-725-1240. Marriage Couples must contact a priest six months prior to the wedding. Reconciliation Saturdays from 4:00 to 5:00pm Homebound Visitation Please contact the Rectory.

Mass Schedule for Weekend ~ Sept. 5 & 6 Saturday (Vigil) 5:00pm Celebrant: Fr. Bonner Lector: Anne Corcoran6:30am Celebrant: Fr. Lucas Lector: Eileen Litka 8:00am Celebrant: Fr. Lucas Lector: Colleen Demusz 9:30am Celebrant: Fr. Bonner Lector: Fran Diamond 11:00am Celebrant: Fr. Bonner Lector: Patrick Gleason

Mass is live-streamed 9:30am on Sundays

https://www.facebook.com/St-Cecilia-Church-Fox-Chase

Sunday Vigil 5:00pm (Saturday)

6:30am, 8:00am, 9:30am, 11:00am

Monday through Friday 6:30 and 8:30 am

Saturday 8:30 am

Pre-Jordan First time parents must attend a Pre-Jordan class and Godparents are also welcome. The next Pre-Jordan class at Saint Cecilia Church will be September 2nd at 7:00pm. Pre-registration is required by contacting the rectory at 215-725-1240.

The following Pre-Jordan class will be held at Saint Albert the Great on October 4th at 1:15pm in their rectory. Please call 215-947-3500 to register for that class.

Second Collection Next weekend, the second collection will be taken up for the Black and Indian Missions. The Black and Indian Mission Collection ex-ists to help local African American and Native American Diocesan Communities throughout the United States spread the Good News of Jesus Christ and re-spond to real and pressing needs on the ground. Thank you for your support and prayers.

Page 3: 22nd Sunday in Ordinary Time August 30, 2020 · 8/30/2020  · Second Collection Next weekend, the second collection will be taken up for the Black and Indian Missions. The Black

#179 3

22nd Sunday in Ordinary Time The Liturgy of the Word First Reading Book of Prophet Jeremiah 20:7-9 You duped me, O LORD, and I let myself be duped; you were too strong for me, and you triumphed. All the day I am an object of laughter; everyone mocks me. Whenever I speak, I must cry out, violence and outrage is my mes-sage; the word of the LORD has brought me derision and reproach all the day. I say to myself, I will not mention him, I will speak in his name no more. But then it becomes like fire burning in my heart, impris-oned in my bones; I grow weary holding it in, I cannot endure it. The word of the Lord. Thanks be to God. Responsorial Psalm My soul is thirsting for you, O Lord my God. Second Reading Letter of St. Paul to the Romans 12:1-2

I urge you, brothers and sisters, by the mercies of God, to offer your bodies as a living sacrifice, holy and pleasing to God, your spiritual worship. Do not conform yourselves to this age but be transformed by the renewal of your mind, that you may discern what is the will of God, what is good and pleasing and perfect. The word of the Lord. Thanks be to God. Gospel The holy Gospel according to Matthew 16: 21-27

Jesus began to show his disciples that he must go to Jerusalem and suffer greatly from the elders, the chief priests, and the scribes, and be killed and on the third day be raised. Then Peter took Jesus aside and began to rebuke him, “God forbid, Lord! No such thing shall ever happen to you.” He turned and said to Peter, “Get be-hind me, Satan! You are an obstacle to me. You are thinking not as God does, but as human beings do." Then Jesus said to his disciples, “Whoever wishes to come after me must deny himself, take up his cross, and follow me. For who-ever wishes to save his life will lose it, but whoever loses his life for my sake will find it. What profit would there be for one to gain the whole world and forfeit his life? Or what can one give in exchange for his life? For the Son of Man will come with his an-gels in his Father’s glory, and then he will repay all according to his conduct.” The Gospel of the Lord. Praise to you, Lord Jesus Christ. Caring For Friends ~ We continue to collect

food for Caring For Friends and we thank you for your dedication to this ministry. If you would like to help out, it is simple. Just add an extra portion to your family meal, freeze it in the trays we provide, and bring it to the freezer located in the alcove between the church and rectory here at Saint Cecilia. Our freezer hours are open every day from 8:30am to 4:00pm.

For more information please call our Coordinator, Bernadette O’Donnell at 215-379-3448 or Caring for Friends at 215-464-2224. Learn more at caringforfriends.org.

FOCUS: Trust in and follow the way of Jesus.

Peter can be excused for think-ing as a human does, for he is human! But what gets him in trouble is his mistaken idea that he knows better than Jesus—that he knows better how Jesus ought to carry out his mission. This is reminiscent of the Fall: Pride in one’s own knowledge over that of God’s. We’re all susceptible to that, and Jesus re-minds Peter—and us—that his way is the way. All we need to do is trust, and follow. LITURGY OF THE WORD: Jeremiah accuses the Lord of duping him, for his prophecies are met with laughter and mocking, derision and reproach. Paul encourages the Romans to offer your bodies as a living sacrifice. In the Gospel, Jesus reveals that he must suffer greatly, and Peter attempts to dis-suade him. Jesus accuses Peter of thinking not as God does, but as human beings do. He then tells his disciples that in order to follow him, they must take up their cross. REFLECTION: It is clear we can’t take the cross out of our religion. We can’t take it our of our daily consciousness either. We may not suffer on the same kind of cross Jesus did, or be martyred the way so many who have followed him have been. But still, Jesus tells us we must each take up our cross and follow him – and the cross costs. The cross is not simply something we wear as an accessory around our necks. The cross will cost us if we follow what Paul tells us today. So we ask ourselves:

Do I wear a cross around my neck or have one on the wall of a room at home?

Why? What does that visible symbol of Christ’s suffering mean to me?

How does it affect my daily life – what I do and the decisions I make?

Page 4: 22nd Sunday in Ordinary Time August 30, 2020 · 8/30/2020  · Second Collection Next weekend, the second collection will be taken up for the Black and Indian Missions. The Black

#179 4

My Jesus, I believe that You are present in the Most Holy Sacrament. I love You above all things, and I desire to receive You into my

soul. Since I cannot at this moment receive You sacra-mentally, come at least spiritually into my heart. I em-brace You as if You were already there and unite my-self wholly to You. Never permit me to be separated from You. Amen.

Pre-Cana at Maternity BVM Parish To register for the Pre-Cana class at Maternity BVM, call 215-673-8127. Class is scheduled for Saturday, Sep-tember 26 at their facility located at 9220 Old Bustleton Avenue. All engaged couples are required to attend a Pre-Cana class.

Help for YOU Food Cupboard Catholic Social Services at 7340 Jackson St. 19136 Monday, Wednesday, Friday 9:00am—12:00pm

Diaper Pantry We offer diapers, formula and baby items for those 32 weeks pregnant and parents with children under age 3. By appointment only—call 215-624-5920 Catholic Social Services at 7340 Jackson St. 19136

Rental Assistance (Rent, mortgage or utility assistance) Call Catholic Social Services at 215-624-5920

The Intentional Rosary (from A Minute in the Church by Gus Lloyd)

There are a number of variations to pray-ing the rosary. Here is one that may have a great impact on your prayer life.

For every Hail Mary associated with one of the five mysteries (fifty Hail Marys in all), you pray for a special intention. One of the fears that people who have never tried this have is that they won’t be able to think of fifty things to pray for. Here is some advice.

Start with your family members—parents, whether they are living or deceased, siblings, children, grandchildren, aunts, uncles, nieces, nephews, cousins, etc. This is a great oppor-tunity to pray for those you haven’t remembered to pray for in some time.

After your family, pray for your friends, co-workers, people from church, organizations you are involved in. Pray for friends from your past that maybe you haven’t brought to mind in a long time. Oh, and pray for your enemies.

Pray for our nation, our elected officials, police and first responders, military families and all those who serve our nation and our communities. If you still have beads left over, pray for your priests, bishop, deacons, sisters and brothers and all religious. Pray for our Holy Father. In doing this, you will probably run out of beads before you run out of prayers. Try it and see what a blessing this can be in your life!

We are sad to have to say ‘Good-bye’ to Patricia Lewis, our Music Director at Saint Cecilia Church. Since 1999, Pat has been playing the organ at Church for our Sunday Masses, directing the Adult Singing Choir and the Bell Choir and helping with the Youth Choir. Pat has developed so many friendships during these years and we will all miss her. Prior to coming to Saint Cecilia Parish, Pat worked at St. Hugh of Cluny, Visitation, St. Joseph in Cheltenham and St. Justin in Penn Valley. So you can see that music has been and will continue to be an important part of her life. We thank her for all that she has done in our parish and wish her well as she takes on the next chapter of her life. Pat isn’t leaving Fox Chase, so you will continue to see her at Mass in St. Cecilia Church. Let us keep Pat in our prayers and whenever you see her, say a ‘Thank You’ for all that she did for us.

Permanent Diaconate Info Night (on Zoom) Lay men of the Archdiocese (above the age of 29) are invited to an online information session to learn about the vocation of the Permanent Deacon in the Church the process of discernment and formation for the Permanent Diaconate. No commitment is required to attend. After the introductory talk there will be time for Q&A. Please register for this webinar at archphila.org/deacon.

Wedding Anniversary Mass The annual Wedding and Anniver-sary Mass to pray for and with mar-ried couples in the Archdiocese of Philadelphia who are married 1-25 years and couples who have been married 25 years or more or 50 years or more will be at the Cathedral Basilica of SS Peter and Paul on Satur-day, October 17. Mass will begin at 5:15pm. For more info visit phillycatholiclife.org.

Page 5: 22nd Sunday in Ordinary Time August 30, 2020 · 8/30/2020  · Second Collection Next weekend, the second collection will be taken up for the Black and Indian Missions. The Black

#179 5

Opening Day for Students in Grades 2 to 8 Wednesday ~ September 9

Tuesday—September 8 Orientation Day for Teachers Wednesday—September 9 First Day of School for Grades 2 through 8 ~ Students will report directly to their Homerooms. Teachers will send emails by September 2; Dismissal 12:30pm Special directions will be sent to Pre-K, Kindergarten and Grade 1 families Thursday—September 10 Grades 1 to 8 will report 8:00am and dismissal at 12:30pm Friday—September 11 Grades 1 to 8 will report 8:00am and dismissal at 12:30pm Back to School nights will be virtual this year. Directions will be sent out to each class for your date and time. Please check your email for details about arrival, dismissal and lunch.

Openings in Pre-K4 We would love to have you join us in Pre-K4 this year.

To register, please contact Lisa Hnat at 215-725-2201 or email her at [email protected]

Students must be 4 years of age by September 1, 2020 and you need the following to register: 1. State Birth Certificate (not the hospital certificate)

2. Baptismal Certificate (if baptized at St. Cecilia Church, please bring the original certificate) 3. Immunization Records

FEES FOR PRE-K: Registration $175; Lunch $50; Tuition $4,025

It is with great sadness that Miss Ursula Begley is announcing her retirement from Saint Cecilia School. Miss Begley has been teaching 6th grade since 1989 ~ a total of 32 years! The joy of her life has been teaching students and it is very difficult to walk away from this task of love as you can imagine. She is hoping to continue in this field by tutoring.

It is because of her students, families and faculty that she remained in our school for so many years. We loved her and she loved us!! It has indeed been a labor of love and she formed many friendships along the way.

Many of her students will remember her motto of ‘Read, Read, Read’ along with her constant remind-er of extending Kindness to everyone by taking a walk in someone else’s shoes.

Ursula will surely be missed, but never forgotten. Please keep her in your prayers as she begins the next chapter in her teaching career.

Page 6: 22nd Sunday in Ordinary Time August 30, 2020 · 8/30/2020  · Second Collection Next weekend, the second collection will be taken up for the Black and Indian Missions. The Black

179 Church of St. Cecilia, Philadelphia, PA (3rd) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net

Stone • Brick • Concrete • Pointing • EP Henry • Stucco • Waterproofi ngZucaroZucaroCONTRACTINGCONTRACTING

Masonry ContractorsSince 1922

215.533.1934215.533.1934

20% Discounton Labor for all Mechanical Work

15% Cash Paidfor Accident Referrals

$39.00+tax

Inspection & Emissions

$19.95Oil Change

(Most Cars)

Auto Body & Repair Shop

612 Huntingdon Pike, Rockledge 215-379-3113 www.abbysautocenter.com

Lifetime Warranty on all Paint & Body Work. Satisfaction Guaranteed

In Our 4th Decade of Quality Service

French Drains • Foundation Repair • Mold Remediation

215-639-8500www.morganbasementwaterproofing.com

All Work Guaranteed

Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if we can help Save you money with your monthly

payments on your commercial property. Multi-Family, Retail, Offi ce Building, Apartment and Condos. Can close in as little as 45 days! Four

season customer service is our top priority.

www.duqfunding.com1650 Market Street - Suite 3600, Philadelphia, PA 19103

• Physical, Occupational & Speech Therapy• Short & Long Term Care• Beautiful On-Site Chapel With Daily Mass• Memory Support • Respite Stay• Adult Daycare • Woundcare• IV Therapy • Trach Care

ST. JOHN NEUMANN CENTERFOR REHAB AND HEALTHCARE

10400 Roosevelt Blvd.Philadelphia, PA

215-698-5600www.stnrehab.org

BUILD YOUR COMMUNITYBUILD YOUR COMMUNITY- Shop Local -

P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !

Advertise Your Business Here800-333-3166

ext. 161www.jppc.net

Rafferty Roofi ng215-281-0771

PA062531

For Quality & Honest Work at Reasonable PricesFree Estimates • Licensed & Insured

20 YEAR GUARANTEE ON HOT WHITE RUBBER ROOF

Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications

To all those essential workers keeping us safe,

yourservice is

invaluable & appreciated.

rivate & Public Healthcare - La- - - -- -- - - - nforcement, Public Safety - OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOfficeccecececececececececececece

ponders - Fooooooooooood &d & d &d & d & d & d & d &d & d &d &d &d & d & d & AAAAAAgrAAAAAAAAlture - Energy Sector rrrrrrrr rrrrr - Wa- Wa- Wa- WWW- Wa- Wa- Wa- WaWa- Wa- Wa- WWaste

Waterwaste - Transportattattattattattattatattatattattattattta ion ion ion ononononon on on onon on on on & Lo&&&&&&&& gics - Public Woooooooorks r & - & Infrfffffffffffff astastrastrtstttstaststtsttstst uctur

Communicatatatttttttatattatttioionononsionsionionionionsionionsiooniono & I&&&&&&&&& nforf matioy Workeorkekkekekekekekekekekekkekers -rs -rs -rs -rs -rs -rs -rs rs -rs -rs -rs -rs -s -s - Community

overnment WWWWWWWWWWWWWWWorkeorkeorkeorkeorkorkorkeorkeorkeorkeorkeorkorkorkeorkerrs - Critical Maacturing -g ---g --g -g ---g --g --- CheCheCheCheCheCheCheCheCheCheCheCheCheCheChemical & Hazardouateteeeeeeeeeeeeeerialrrrrrrrrrrrrrr s FiFiFiFiFiFiFiFiFiFiFiFiFiFiFinancnancnannannananaannanannancnancnancan ial Services - Defensdustristristristristristrstrtristristristritristritritrial Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Baasasasasasasase - Commercial Faciesssssessessssssss WorWorWorWorWorWorWorWorWorWorWorWorWorWorWorkkkkkkekekekerskekekkkk - Resid ti l & Sh ltervicesicesicesicescescecescesicesicesicescescescesces & Facilities - Hygiene Prod

To all thoserivate & Publicrivate & nforcement Pubnforcement Pub

ssentialFirst RespFirst Resp

workersWaterwaste Waterwaste

keepingcs - PublicuCommunCommun

s safe,chnologychnology

yzardouzardouD fD

service isvices DefensDefenmercial Facimercial Faci

invaluable &idential & Shelteidential & ShelteH i P dH i Ptha

nk yo

u

afeeeefeeeeeeeefefefefetyty --ttty --ttttty t -tt -- OffiOOOOOOOOOOOOO cers & First RespondeFFFoFFFFFF od &d &d &d &&&d &&d &&od d &&d &d &d &d &d &d &d &d &d AgrAAgrAAAAAgrAAAAAgrgrrgrrAggrrrAgrA rrgAAA rAAAgrAAgg iculicucuiculuiculiculiculcuiculiiicuicultureturetureurertureurturertureurrrurerrrurrtur - E- E- EE- E- E- E-- EEE- EEEnergy Se

ooroorror rrr - WaWa- WaWa- Wa- WW- WaWWWWWW- W- WWaa- WWaWaWaaWaasteststtstee stesssteetsteetts ess ees e & Wa& Wa& W& Wa& WaWaWW& Wa& Wa& WaW& Wa& Wa& WaWWWaa&& W& WaWa& Waterwterwterwterwteterwterwterwterwerwtterwe wteteerwerwerwrwwterwtterwwwasteastasteaasteasteaastesteteasteaassteasteaststststeeeeeee - TTT- T- TT- TT- T--- T- TT- T-- ranrarrarararrararraararaaaraarortrtrtrtrtrrrttttttatioatitiatiotitatiattiiatataatatataaaa n &&n & n &&n &nn Logistics - Public Wor

After

MASSES FOR THE WEEK OF August 31

MONDAY, August 31 6:30am – 8:30am – Rev. Laurence Schmitt, SSJ

TUESDAY, September 1 6:30am – Norman Lucas 8:30am – Billy Rainey

WEDNESDAY, September 2 6:30am – 8:30am – Larry Augustin

THURSDAY, September 3 6:30am – Phillip Howley 8:30am – Ferrara & Serfilippo Families

FRIDAY, September 4 6:30am – Kimberly Vivona Markowski 8:30am – Ethel Raffay (24th anniversary)

SATURDAY, September 5 8:30am – Michael DeVincent & Howard Gilton 5:00pm – Raymond W. Mahan (3rd anniversary)

Remember Our Sick and Suffering Walter Hnat Ed Lieber Christopher Rodgers Patricia Moore James J. Tobin Mary Schultz Ann Marie Tobin Masgai Charles Friel Meghan Kovacs Joan Marie Reiley John Lawrysk Maki Turner Kirsten Hosack-Edling Stephanie Morgan James Potts Owen Doyle Mary Benson Esther Sharp Mary Jane Brough Leo Wuestkamp Stephen Ruczynski Helen Tobin Mike McKee Andrew Slivjak Melissa Fischer George Burbage Patricia Greenleaf Rita Giordano Daniel Mitchell Lisa Kovacs-Breuer Gregory Farrell Ed MacNew Timothy Martin John Smykal Julia McCauley Alice Davis Mary Matthews Josephine O’Donnell Marguerite Zeltman Alice Zmijewski Jack Vogler Eileen Gaynor Alberta DeMasi Eleanor DeNoble Eugenia DiSilva Marian Diel Kathi Silcox Catherine Needham Connie Merkel Ellen Jones Roberta Mitchell

Let us pray for the souls of all the faithful departed

Page 7: 22nd Sunday in Ordinary Time August 30, 2020 · 8/30/2020  · Second Collection Next weekend, the second collection will be taken up for the Black and Indian Missions. The Black

179 Church of St. Cecilia, Philadelphia, PA (i) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net

FOX CHASE WINDOWS & DOORSSALES - INSTALLATION

Please Call ... 215-725-4211

FREE ESTIMATES

Parish Member

ALL TYPES WIRING & REPAIRS215–329–9456 Parish Member

G.J. ROSSI & SONELECTRICIANS

Now In Our 3rd Generation

PATRICK J. FOY(215) 281-9656

Interior & Exterior PaintingWallpapering & Scraping

FREE Estimates • Reliable • Honest

309 Central Ave., Cheltenham379-0881

JOSEPH P. FARLEYPLUMBING & HEATING

Alterations-Jobbing

Reg. No. 3121P.A. 043294

Classic OpticalDR. AMY C. TAN, O.D. 215-722-2242

*Eye Exams * Contact Lenses * Eyeglasses6516 R S A . (G R S )

Sweeney’sVerree Tavern

KITCHEN OPEN FROM 11 AM TO MIDNIGHT

The all new Kim’s Crab CakesPhilly’s Largest Wings

All Soups & Chili HomemadeTAKE OUT AVAILABLE

All Major Sporting Events With 6 Colored TV’s

Finest Tavern Food Now Available in our

New Private Dining Room

7968 VERREE RD.215–725-3366

Mariann OwensOffi ce: (215) 698-2000Direct: (215) 698-2027Cell: (215) 280-7222Email: [email protected] Buyers and Sellersin Philadelphia, Bucks, and Montgomery CountiesEach Offi ce Independently Owned and Operated

2000

SENIOR CITIZEN DISCOUNTS

ReliableFull Service Plumber

PLUMBING, HEATING & DRAIN CLEANING EMERGENCY SERVICE

INSURED • FREE ESTIMATES215-722-6783215-379-8300

SERVING ENTIRE CITY & SUBURBS

CITY VIOLATIONS CORRECTED

SEWER LINES REPLACED • HOT WATER HEATERSFROZEN PIPES • WATER PRESSURE INCREASED

DIGGING & EXCAVATION SPECIALISTS

Reg. Master Plumber #4287Michael Zalewski

Experience Peace of Mind:Pre-Arrange Your Burial at an

Archdiocese of Philadelphia Cemetery.

• Save today through pre-planning• Convenient terms for all of your burial needs• Traditional in ground, mausoleum & cremation options available at most cemeteries

CALL 215-352-4001 TODAY

Leslie AitaVocalist

[email protected]

Parishioner

Visit Us At Our New Location

Rockledge Plaza Huntingdon Pike

408 Huntingdon PikeRockledge, PA 19046215-379-2100

Family Ownedand Operated

Since 1948

$350Off Any New Stairlift With This Ad

• FREE in home evaluations• Family owned & operated for more than 20 years

1.888.900.8883

www.Tri-StateStairlifts.com

Traditional Funerals, Church Funerals & Memorial Services, Cremations“ONE FAMILY HELPING ANOTHER”

7450 Oxford Ave Phila, PA 19111 215-728-1050

David G RichardsonSupervisor/Owner

Cher l A Webb-RichardsonManager & LCBA Insurance Rep

Parishioner

richardsonsfuneralhome.com Councilman Brian O’Neill

Northeast offi ces near St. Cecilia ParishionersFox Chase - 432 Rhawn Street • 215-685-6431 • Rhawnhurst - 7522 Castor Ave • 215-685-0438

[email protected]

FreeNotaryPublic

Free copies

& Faxes

Karon MassadoReal Estate Salesperson

o 267.435.8015 m [email protected]

1601 Market St.- Fl. 19, Phila, PA

Wackerman Funeral Home, Inc.Wackerman Funeral Home, Inc.8060 Verree Rd. Philadelphia, PA 19111

www.wackermanfuneralhome.com 215-342-5200 Elizabeth Wackerman Bailey, Supervisor 1944 – Austin C. Wackerman - 2017 Emily Wackerman Funeral Director

Free & Confi dential Pregnancy Services24 Hour Hotline: 1-800-550-4900

www.BirthRight.org

“It is the right of every pregnant woman to give birth, and the right of every child to be born.”

~Birthright Charter7986 Oxford Avenue

Philadelphia, PA 19111215-728-0385

A Blessing from God

John DeCristofaroROOFING

Specializing in: Hot Asphalt RoofsShingle Roofs • Gutters • Spouts

215-379-2953 Member of St. Cecilia

A Tompkins Community BankFormerly Madison Bank

8000 Verree Rd., Philadelphia(215) 722-4566

www.risingsunhomecare.org

Providing The Highest Quality Care

Parishioner of St. Cecilia

215-605-9555

catering For your next event, call ahead to order

- Pickup or Delivery -WHITMAN SQUARE 215-969-3455 x1

Eric McHughParishioner

CYO Volunteer OFFERING AUTO, HOME, LIFE,

& BUSINESS INSURANCE Call for a quote

215-328-9990 x7001 or email [email protected]

210 Huntingdon Pike, Rockledge

Patronize the Adve isers who make this bulletin possible!

BUILD YOUR COMMUNITY!

Patt o i e the A

SHOP LOCAL

To advertise your business in this weekly bulletin,contact us at 1.800.333.3166

or visit us at www.jppc.net

Local, trusted, proven, effective, supportive, referrals, relationships, affordable, repetitious, versatile, lasting.

This describes the power of...

Placing an ad in the parish bulletin supports the parish while building your business - THAT’S A WIN WIN!

Call 1.800.333.3166 TODAY!

Page 8: 22nd Sunday in Ordinary Time August 30, 2020 · 8/30/2020  · Second Collection Next weekend, the second collection will be taken up for the Black and Indian Missions. The Black

179 - Church of St. Cecilia, Philadelphia, PA (b) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net

Schmidt’s Florist 700 Solly Ave., Phila., PA 19111

www.schmidtsfl orist.com 215-745-6234

LAW OFFICES

PAUL A. COGHLAN437 RHAWN STREET

PHILADELPHIA, PA 19111(215) 725-5998

FAX (215) 725-3904

Robert Wetzel, F.D.419 Huntingdon Pike, Rockledge

Erich Wetzel, Supv.Willow Grove - Bill Herchenroder, Supv. INC.

Funeral Directors Since 1881 215-663-8550 • www.wetzelandson.com

Stewart and McGowanATTORNEYS-AT-LAW

6221 RISING SUN AVE. (Opposite St. William’s Church)338-2800

S W D ’ E

WE DELIVER~ Traditional Pizza~ White Pizza~ Tomato Pies

The Original

Pizza6500 Rising Sun Ave. • 215-745-9992

Nora McCloskeyParishioner

Fine Art ClassesWorkshops & Partiesfor Children & Adults215-301-0103

www.bloomingartiststudio.comwww.bloomingartiststudio.com

PLUMBING, HEATING, DRAIN CLEANING & AIR CONDITIONING

SENIOR CITIZEN DISCOUNTFREE ESTIMATES

Ph: (215) 728-1482Fax: (215) 742-7098

8675 Torresdale Ave.Philadelphia, PA 19136

WWW.BILLFRUSCO.COM

O’Donnell PaintingInterior and Exterior

House Painting & Drywall RepairNeat Clean Work • No Job Too SmallFree Estimates 215-677-5854

JOHN F. GIVNISH(3rd Generation)

JOHN F.X. GIVNISH, III(4th Generation)

Serving the Archdioceseof Philadelphia with

grace and dignity since 1928

1-800-GIVNISH

Each Offi ce Independently Owned and Operated

Larry AitaREALTOR®

Seniors Real Estate SpecialistOutstanding Agents. Outstanding Results.

Regency Realty

Cell: (215) 478-4344Offi ce: (215) [email protected]’s Get Moving!

2018 Outstanding

Agentof the Year

s.

Parishioner

Serving Families Since 1900

Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick, F.D. 1924-2013

Th omas M. McGoldrick, F.D. SupervisorJames T. Meyers, F.D. • Timothy J. Meyers, F.D.

215-884-0800 507 West Avenue, Jenkintown, PA 19046 www.mcgoldrickfh .com

Mallory’s Army FoundationUnited Together In The Fight Against Bullying...

Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com

(973) 440-8657 • [email protected] It’s easy to join our mailing list! Just send your email address by text message:

Text MALLORYSARMY to 22828 to get started.Message and data rates may apply.

Advertise Your Business Here800-333-3166

ext. 161www.jppc.net

What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering their vehicle

to make sure it is the car they are supposed to enter.

In Remembrance of Samantha Josephson

#WHATSMYNAME

JIM CASEYWallcoveringPainting • ScrapingClean Work • Since 1986215-379-0558 Member of Parish

Professionals Serving Professionals

Jay B. ComlyBuilding & Offi ce Maintenance

[email protected]

w/an A+ Rating

Commercial • AutomotiveResidential • Safes

Fully Equipped RadioDispatched Mobile Trucks

7936 Oxford Ave. 215-745-5007

Full Service Locksmith Since 1978Member of Parish

VERREEPHARMACY

7960 VERREE RD.(AT RHAWN)Free Delivery

M-F 9AM - 8PMSat. 9AM - 6PM

Sun. 9AM - 1 PM215-342-0100

Mitchell Spivack, R. PH.

HandymanElectric, PlumbingOdd jobs... Just Ask!

From McCloy’s TV 267-231-8785

Tax & AccountingFrancis J. McConnell CPA

Tax Preparation • Individual & Business(Across from St. Williams)

Call (215) 742-3428 for Appointments

Charles P. Elliott, PC 110 Central Ave

Cheltenham, PA 19012

215-663-2500We Make House Calls

Complimentary InitialConsultation

We are here for all your tax, IRS, fraud investigations,

& inheritance tax.

RENEE ROACHEREALTOR ~ PARISHIONER

FOX CHASE SPECIALISTBuying or Selling a Home?

Call Today!

Office 215-961-6000 Cell [email protected]

EASTERNEEEAEAAEAEEEEEEEEEEEEEEEEAEASTSTTTSTTTSSTTTTTTTTTEEREEEEEEEEEEEEEEAEAEAEEEEEEEEASTSTTTSTTSSTTTEEEREEEE

A Signature Hair Salon llc$10 OFF Color ServiceMen | Women | Children

7950 Bustleton Ave., Philadelphia, PA215-821-3522

Cochrane Construction LLC

ROOFINGSIDING * GUTTERS

Chimney Restorations & RepairsLicensed & Insured PA # 154589

Senior Citizen Discounts • Free Est.215-839-4317

www.cochraneconstruction.org

Friends, Family, Neighbors!

1-844-640-4200 PaulsRun.org/Living

Wedding Invitations Wedding Invitations & Holiday Cards& Holiday CardsLog onto Log onto www.jppc.netwww.jppc.netconveniently from yourconveniently from yourhome or offi ce.home or offi ce.Online CatalogOnline CatalogOnline OrderingOnline OrderingOnline ProofingOnline ProofingAll Major Credit All Major Credit Cards AcceptedCards Accepted

FREE UPS FREE UPS GROUND GROUND SHIPPINGSHIPPING!

WE CARE AND IT SHOWS

Beautiful On-Site Chapel with Daily Mass - Respite Stay Available

We Acknowledge We Appreciate

2990 Holme Ave., Phila.215-335-2100

www.imrehab.org

IMMACULATE MARYCENTER

Rehabilitation & Healthcare

Advertise Your Business Here

800-333-3166 ext. 161www.jppc.net


Top Related