22nd sunday in ordinary time august 30, 2020 · 8/30/2020 · second collection next weekend, the...
TRANSCRIPT
22nd Sunday in Ordinary Time August 30, 2020
St. Cecilia Church
#179 2
OFFICES Rectory 215.725.1240 Eleanor Kerwick Business 215.725.1240 Susan Wagner PREP 215.725.2821 Eileen Litka School 215.725.8588 Bobbie Mitchell Tuition 215.725.2201 Lisa Hnat Fax 215.725.2130 Website: www.stceciliafc.org School: scsfoxchase.org CYO Facebook: Saint Cecilia Catholic Youth Organization
Rectory Office Hours Currently closed ~ call 215-725-1240 for emergency.
Saint Cecilia Church 535 Rhawn Street
Philadelphia, Pennsylvania 19111
PASTOR Reverend Charles E. Bonner
PASTOR EMERITUS Reverend Msgr. Francis X. Dreger
PAROCHIAL VICAR Reverend Robert Lucas PERMANENT DEACON Deacon Patrick Diamond
PRINCIPAL Sister Catherine Irene Masino , IHM
VICE PRINCIPAL Sister Carolyn Elizabeth Braun, IHM
SACRAMENTS Baptism First three Sundays of the month at 12:15pm. Arrangements must be made at least two weeks prior to the Baptism. At-tendance at a Pre-Jordan class is required for first time par-ents. Please pre-register for class by contacting the Rectory at 215-725-1240. Marriage Couples must contact a priest six months prior to the wedding. Reconciliation Saturdays from 4:00 to 5:00pm Homebound Visitation Please contact the Rectory.
Mass Schedule for Weekend ~ Sept. 5 & 6 Saturday (Vigil) 5:00pm Celebrant: Fr. Bonner Lector: Anne Corcoran6:30am Celebrant: Fr. Lucas Lector: Eileen Litka 8:00am Celebrant: Fr. Lucas Lector: Colleen Demusz 9:30am Celebrant: Fr. Bonner Lector: Fran Diamond 11:00am Celebrant: Fr. Bonner Lector: Patrick Gleason
Mass is live-streamed 9:30am on Sundays
https://www.facebook.com/St-Cecilia-Church-Fox-Chase
Sunday Vigil 5:00pm (Saturday)
6:30am, 8:00am, 9:30am, 11:00am
Monday through Friday 6:30 and 8:30 am
Saturday 8:30 am
Pre-Jordan First time parents must attend a Pre-Jordan class and Godparents are also welcome. The next Pre-Jordan class at Saint Cecilia Church will be September 2nd at 7:00pm. Pre-registration is required by contacting the rectory at 215-725-1240.
The following Pre-Jordan class will be held at Saint Albert the Great on October 4th at 1:15pm in their rectory. Please call 215-947-3500 to register for that class.
Second Collection Next weekend, the second collection will be taken up for the Black and Indian Missions. The Black and Indian Mission Collection ex-ists to help local African American and Native American Diocesan Communities throughout the United States spread the Good News of Jesus Christ and re-spond to real and pressing needs on the ground. Thank you for your support and prayers.
#179 3
22nd Sunday in Ordinary Time The Liturgy of the Word First Reading Book of Prophet Jeremiah 20:7-9 You duped me, O LORD, and I let myself be duped; you were too strong for me, and you triumphed. All the day I am an object of laughter; everyone mocks me. Whenever I speak, I must cry out, violence and outrage is my mes-sage; the word of the LORD has brought me derision and reproach all the day. I say to myself, I will not mention him, I will speak in his name no more. But then it becomes like fire burning in my heart, impris-oned in my bones; I grow weary holding it in, I cannot endure it. The word of the Lord. Thanks be to God. Responsorial Psalm My soul is thirsting for you, O Lord my God. Second Reading Letter of St. Paul to the Romans 12:1-2
I urge you, brothers and sisters, by the mercies of God, to offer your bodies as a living sacrifice, holy and pleasing to God, your spiritual worship. Do not conform yourselves to this age but be transformed by the renewal of your mind, that you may discern what is the will of God, what is good and pleasing and perfect. The word of the Lord. Thanks be to God. Gospel The holy Gospel according to Matthew 16: 21-27
Jesus began to show his disciples that he must go to Jerusalem and suffer greatly from the elders, the chief priests, and the scribes, and be killed and on the third day be raised. Then Peter took Jesus aside and began to rebuke him, “God forbid, Lord! No such thing shall ever happen to you.” He turned and said to Peter, “Get be-hind me, Satan! You are an obstacle to me. You are thinking not as God does, but as human beings do." Then Jesus said to his disciples, “Whoever wishes to come after me must deny himself, take up his cross, and follow me. For who-ever wishes to save his life will lose it, but whoever loses his life for my sake will find it. What profit would there be for one to gain the whole world and forfeit his life? Or what can one give in exchange for his life? For the Son of Man will come with his an-gels in his Father’s glory, and then he will repay all according to his conduct.” The Gospel of the Lord. Praise to you, Lord Jesus Christ. Caring For Friends ~ We continue to collect
food for Caring For Friends and we thank you for your dedication to this ministry. If you would like to help out, it is simple. Just add an extra portion to your family meal, freeze it in the trays we provide, and bring it to the freezer located in the alcove between the church and rectory here at Saint Cecilia. Our freezer hours are open every day from 8:30am to 4:00pm.
For more information please call our Coordinator, Bernadette O’Donnell at 215-379-3448 or Caring for Friends at 215-464-2224. Learn more at caringforfriends.org.
FOCUS: Trust in and follow the way of Jesus.
Peter can be excused for think-ing as a human does, for he is human! But what gets him in trouble is his mistaken idea that he knows better than Jesus—that he knows better how Jesus ought to carry out his mission. This is reminiscent of the Fall: Pride in one’s own knowledge over that of God’s. We’re all susceptible to that, and Jesus re-minds Peter—and us—that his way is the way. All we need to do is trust, and follow. LITURGY OF THE WORD: Jeremiah accuses the Lord of duping him, for his prophecies are met with laughter and mocking, derision and reproach. Paul encourages the Romans to offer your bodies as a living sacrifice. In the Gospel, Jesus reveals that he must suffer greatly, and Peter attempts to dis-suade him. Jesus accuses Peter of thinking not as God does, but as human beings do. He then tells his disciples that in order to follow him, they must take up their cross. REFLECTION: It is clear we can’t take the cross out of our religion. We can’t take it our of our daily consciousness either. We may not suffer on the same kind of cross Jesus did, or be martyred the way so many who have followed him have been. But still, Jesus tells us we must each take up our cross and follow him – and the cross costs. The cross is not simply something we wear as an accessory around our necks. The cross will cost us if we follow what Paul tells us today. So we ask ourselves:
Do I wear a cross around my neck or have one on the wall of a room at home?
Why? What does that visible symbol of Christ’s suffering mean to me?
How does it affect my daily life – what I do and the decisions I make?
#179 4
My Jesus, I believe that You are present in the Most Holy Sacrament. I love You above all things, and I desire to receive You into my
soul. Since I cannot at this moment receive You sacra-mentally, come at least spiritually into my heart. I em-brace You as if You were already there and unite my-self wholly to You. Never permit me to be separated from You. Amen.
Pre-Cana at Maternity BVM Parish To register for the Pre-Cana class at Maternity BVM, call 215-673-8127. Class is scheduled for Saturday, Sep-tember 26 at their facility located at 9220 Old Bustleton Avenue. All engaged couples are required to attend a Pre-Cana class.
Help for YOU Food Cupboard Catholic Social Services at 7340 Jackson St. 19136 Monday, Wednesday, Friday 9:00am—12:00pm
Diaper Pantry We offer diapers, formula and baby items for those 32 weeks pregnant and parents with children under age 3. By appointment only—call 215-624-5920 Catholic Social Services at 7340 Jackson St. 19136
Rental Assistance (Rent, mortgage or utility assistance) Call Catholic Social Services at 215-624-5920
The Intentional Rosary (from A Minute in the Church by Gus Lloyd)
There are a number of variations to pray-ing the rosary. Here is one that may have a great impact on your prayer life.
For every Hail Mary associated with one of the five mysteries (fifty Hail Marys in all), you pray for a special intention. One of the fears that people who have never tried this have is that they won’t be able to think of fifty things to pray for. Here is some advice.
Start with your family members—parents, whether they are living or deceased, siblings, children, grandchildren, aunts, uncles, nieces, nephews, cousins, etc. This is a great oppor-tunity to pray for those you haven’t remembered to pray for in some time.
After your family, pray for your friends, co-workers, people from church, organizations you are involved in. Pray for friends from your past that maybe you haven’t brought to mind in a long time. Oh, and pray for your enemies.
Pray for our nation, our elected officials, police and first responders, military families and all those who serve our nation and our communities. If you still have beads left over, pray for your priests, bishop, deacons, sisters and brothers and all religious. Pray for our Holy Father. In doing this, you will probably run out of beads before you run out of prayers. Try it and see what a blessing this can be in your life!
We are sad to have to say ‘Good-bye’ to Patricia Lewis, our Music Director at Saint Cecilia Church. Since 1999, Pat has been playing the organ at Church for our Sunday Masses, directing the Adult Singing Choir and the Bell Choir and helping with the Youth Choir. Pat has developed so many friendships during these years and we will all miss her. Prior to coming to Saint Cecilia Parish, Pat worked at St. Hugh of Cluny, Visitation, St. Joseph in Cheltenham and St. Justin in Penn Valley. So you can see that music has been and will continue to be an important part of her life. We thank her for all that she has done in our parish and wish her well as she takes on the next chapter of her life. Pat isn’t leaving Fox Chase, so you will continue to see her at Mass in St. Cecilia Church. Let us keep Pat in our prayers and whenever you see her, say a ‘Thank You’ for all that she did for us.
Permanent Diaconate Info Night (on Zoom) Lay men of the Archdiocese (above the age of 29) are invited to an online information session to learn about the vocation of the Permanent Deacon in the Church the process of discernment and formation for the Permanent Diaconate. No commitment is required to attend. After the introductory talk there will be time for Q&A. Please register for this webinar at archphila.org/deacon.
Wedding Anniversary Mass The annual Wedding and Anniver-sary Mass to pray for and with mar-ried couples in the Archdiocese of Philadelphia who are married 1-25 years and couples who have been married 25 years or more or 50 years or more will be at the Cathedral Basilica of SS Peter and Paul on Satur-day, October 17. Mass will begin at 5:15pm. For more info visit phillycatholiclife.org.
#179 5
Opening Day for Students in Grades 2 to 8 Wednesday ~ September 9
Tuesday—September 8 Orientation Day for Teachers Wednesday—September 9 First Day of School for Grades 2 through 8 ~ Students will report directly to their Homerooms. Teachers will send emails by September 2; Dismissal 12:30pm Special directions will be sent to Pre-K, Kindergarten and Grade 1 families Thursday—September 10 Grades 1 to 8 will report 8:00am and dismissal at 12:30pm Friday—September 11 Grades 1 to 8 will report 8:00am and dismissal at 12:30pm Back to School nights will be virtual this year. Directions will be sent out to each class for your date and time. Please check your email for details about arrival, dismissal and lunch.
Openings in Pre-K4 We would love to have you join us in Pre-K4 this year.
To register, please contact Lisa Hnat at 215-725-2201 or email her at [email protected]
Students must be 4 years of age by September 1, 2020 and you need the following to register: 1. State Birth Certificate (not the hospital certificate)
2. Baptismal Certificate (if baptized at St. Cecilia Church, please bring the original certificate) 3. Immunization Records
FEES FOR PRE-K: Registration $175; Lunch $50; Tuition $4,025
It is with great sadness that Miss Ursula Begley is announcing her retirement from Saint Cecilia School. Miss Begley has been teaching 6th grade since 1989 ~ a total of 32 years! The joy of her life has been teaching students and it is very difficult to walk away from this task of love as you can imagine. She is hoping to continue in this field by tutoring.
It is because of her students, families and faculty that she remained in our school for so many years. We loved her and she loved us!! It has indeed been a labor of love and she formed many friendships along the way.
Many of her students will remember her motto of ‘Read, Read, Read’ along with her constant remind-er of extending Kindness to everyone by taking a walk in someone else’s shoes.
Ursula will surely be missed, but never forgotten. Please keep her in your prayers as she begins the next chapter in her teaching career.
179 Church of St. Cecilia, Philadelphia, PA (3rd) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
Stone • Brick • Concrete • Pointing • EP Henry • Stucco • Waterproofi ngZucaroZucaroCONTRACTINGCONTRACTING
Masonry ContractorsSince 1922
215.533.1934215.533.1934
20% Discounton Labor for all Mechanical Work
15% Cash Paidfor Accident Referrals
$39.00+tax
Inspection & Emissions
$19.95Oil Change
(Most Cars)
Auto Body & Repair Shop
612 Huntingdon Pike, Rockledge 215-379-3113 www.abbysautocenter.com
Lifetime Warranty on all Paint & Body Work. Satisfaction Guaranteed
In Our 4th Decade of Quality Service
French Drains • Foundation Repair • Mold Remediation
215-639-8500www.morganbasementwaterproofing.com
All Work Guaranteed
Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if we can help Save you money with your monthly
payments on your commercial property. Multi-Family, Retail, Offi ce Building, Apartment and Condos. Can close in as little as 45 days! Four
season customer service is our top priority.
www.duqfunding.com1650 Market Street - Suite 3600, Philadelphia, PA 19103
• Physical, Occupational & Speech Therapy• Short & Long Term Care• Beautiful On-Site Chapel With Daily Mass• Memory Support • Respite Stay• Adult Daycare • Woundcare• IV Therapy • Trach Care
ST. JOHN NEUMANN CENTERFOR REHAB AND HEALTHCARE
10400 Roosevelt Blvd.Philadelphia, PA
215-698-5600www.stnrehab.org
BUILD YOUR COMMUNITYBUILD YOUR COMMUNITY- Shop Local -
P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !
Advertise Your Business Here800-333-3166
ext. 161www.jppc.net
Rafferty Roofi ng215-281-0771
PA062531
For Quality & Honest Work at Reasonable PricesFree Estimates • Licensed & Insured
20 YEAR GUARANTEE ON HOT WHITE RUBBER ROOF
Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications
To all those essential workers keeping us safe,
yourservice is
invaluable & appreciated.
rivate & Public Healthcare - La- - - -- -- - - - nforcement, Public Safety - OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOfficeccecececececececececececece
ponders - Fooooooooooood &d & d &d & d & d & d & d &d & d &d &d &d & d & d & AAAAAAgrAAAAAAAAlture - Energy Sector rrrrrrrr rrrrr - Wa- Wa- Wa- WWW- Wa- Wa- Wa- WaWa- Wa- Wa- WWaste
Waterwaste - Transportattattattattattattatattatattattattattta ion ion ion ononononon on on onon on on on & Lo&&&&&&&& gics - Public Woooooooorks r & - & Infrfffffffffffff astastrastrtstttstaststtsttstst uctur
Communicatatatttttttatattatttioionononsionsionionionionsionionsiooniono & I&&&&&&&&& nforf matioy Workeorkekkekekekekekekekekekkekers -rs -rs -rs -rs -rs -rs -rs rs -rs -rs -rs -rs -s -s - Community
overnment WWWWWWWWWWWWWWWorkeorkeorkeorkeorkorkorkeorkeorkeorkeorkeorkorkorkeorkerrs - Critical Maacturing -g ---g --g -g ---g --g --- CheCheCheCheCheCheCheCheCheCheCheCheCheCheChemical & Hazardouateteeeeeeeeeeeeeerialrrrrrrrrrrrrrr s FiFiFiFiFiFiFiFiFiFiFiFiFiFiFinancnancnannannananaannanannancnancnancan ial Services - Defensdustristristristristristrstrtristristristritristritritrial Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Baasasasasasasase - Commercial Faciesssssessessssssss WorWorWorWorWorWorWorWorWorWorWorWorWorWorWorkkkkkkekekekerskekekkkk - Resid ti l & Sh ltervicesicesicesicescescecescesicesicesicescescescesces & Facilities - Hygiene Prod
To all thoserivate & Publicrivate & nforcement Pubnforcement Pub
ssentialFirst RespFirst Resp
workersWaterwaste Waterwaste
keepingcs - PublicuCommunCommun
s safe,chnologychnology
yzardouzardouD fD
service isvices DefensDefenmercial Facimercial Faci
invaluable &idential & Shelteidential & ShelteH i P dH i Ptha
nk yo
u
afeeeefeeeeeeeefefefefetyty --ttty --ttttty t -tt -- OffiOOOOOOOOOOOOO cers & First RespondeFFFoFFFFFF od &d &d &d &&&d &&d &&od d &&d &d &d &d &d &d &d &d &d AgrAAgrAAAAAgrAAAAAgrgrrgrrAggrrrAgrA rrgAAA rAAAgrAAgg iculicucuiculuiculiculiculcuiculiiicuicultureturetureurertureurturertureurrrurerrrurrtur - E- E- EE- E- E- E-- EEE- EEEnergy Se
ooroorror rrr - WaWa- WaWa- Wa- WW- WaWWWWWW- W- WWaa- WWaWaWaaWaasteststtstee stesssteetsteetts ess ees e & Wa& Wa& W& Wa& WaWaWW& Wa& Wa& WaW& Wa& Wa& WaWWWaa&& W& WaWa& Waterwterwterwterwteterwterwterwterwerwtterwe wteteerwerwerwrwwterwtterwwwasteastasteaasteasteaastesteteasteaassteasteaststststeeeeeee - TTT- T- TT- TT- T--- T- TT- T-- ranrarrarararrararraararaaaraarortrtrtrtrtrrrttttttatioatitiatiotitatiattiiatataatatataaaa n &&n & n &&n &nn Logistics - Public Wor
After
MASSES FOR THE WEEK OF August 31
MONDAY, August 31 6:30am – 8:30am – Rev. Laurence Schmitt, SSJ
TUESDAY, September 1 6:30am – Norman Lucas 8:30am – Billy Rainey
WEDNESDAY, September 2 6:30am – 8:30am – Larry Augustin
THURSDAY, September 3 6:30am – Phillip Howley 8:30am – Ferrara & Serfilippo Families
FRIDAY, September 4 6:30am – Kimberly Vivona Markowski 8:30am – Ethel Raffay (24th anniversary)
SATURDAY, September 5 8:30am – Michael DeVincent & Howard Gilton 5:00pm – Raymond W. Mahan (3rd anniversary)
Remember Our Sick and Suffering Walter Hnat Ed Lieber Christopher Rodgers Patricia Moore James J. Tobin Mary Schultz Ann Marie Tobin Masgai Charles Friel Meghan Kovacs Joan Marie Reiley John Lawrysk Maki Turner Kirsten Hosack-Edling Stephanie Morgan James Potts Owen Doyle Mary Benson Esther Sharp Mary Jane Brough Leo Wuestkamp Stephen Ruczynski Helen Tobin Mike McKee Andrew Slivjak Melissa Fischer George Burbage Patricia Greenleaf Rita Giordano Daniel Mitchell Lisa Kovacs-Breuer Gregory Farrell Ed MacNew Timothy Martin John Smykal Julia McCauley Alice Davis Mary Matthews Josephine O’Donnell Marguerite Zeltman Alice Zmijewski Jack Vogler Eileen Gaynor Alberta DeMasi Eleanor DeNoble Eugenia DiSilva Marian Diel Kathi Silcox Catherine Needham Connie Merkel Ellen Jones Roberta Mitchell
Let us pray for the souls of all the faithful departed
179 Church of St. Cecilia, Philadelphia, PA (i) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
FOX CHASE WINDOWS & DOORSSALES - INSTALLATION
Please Call ... 215-725-4211
FREE ESTIMATES
Parish Member
ALL TYPES WIRING & REPAIRS215–329–9456 Parish Member
G.J. ROSSI & SONELECTRICIANS
Now In Our 3rd Generation
PATRICK J. FOY(215) 281-9656
Interior & Exterior PaintingWallpapering & Scraping
FREE Estimates • Reliable • Honest
309 Central Ave., Cheltenham379-0881
JOSEPH P. FARLEYPLUMBING & HEATING
Alterations-Jobbing
Reg. No. 3121P.A. 043294
Classic OpticalDR. AMY C. TAN, O.D. 215-722-2242
*Eye Exams * Contact Lenses * Eyeglasses6516 R S A . (G R S )
Sweeney’sVerree Tavern
KITCHEN OPEN FROM 11 AM TO MIDNIGHT
The all new Kim’s Crab CakesPhilly’s Largest Wings
All Soups & Chili HomemadeTAKE OUT AVAILABLE
All Major Sporting Events With 6 Colored TV’s
Finest Tavern Food Now Available in our
New Private Dining Room
7968 VERREE RD.215–725-3366
Mariann OwensOffi ce: (215) 698-2000Direct: (215) 698-2027Cell: (215) 280-7222Email: [email protected] Buyers and Sellersin Philadelphia, Bucks, and Montgomery CountiesEach Offi ce Independently Owned and Operated
2000
SENIOR CITIZEN DISCOUNTS
ReliableFull Service Plumber
PLUMBING, HEATING & DRAIN CLEANING EMERGENCY SERVICE
INSURED • FREE ESTIMATES215-722-6783215-379-8300
SERVING ENTIRE CITY & SUBURBS
CITY VIOLATIONS CORRECTED
SEWER LINES REPLACED • HOT WATER HEATERSFROZEN PIPES • WATER PRESSURE INCREASED
DIGGING & EXCAVATION SPECIALISTS
Reg. Master Plumber #4287Michael Zalewski
Experience Peace of Mind:Pre-Arrange Your Burial at an
Archdiocese of Philadelphia Cemetery.
• Save today through pre-planning• Convenient terms for all of your burial needs• Traditional in ground, mausoleum & cremation options available at most cemeteries
CALL 215-352-4001 TODAY
Leslie AitaVocalist
Parishioner
Visit Us At Our New Location
Rockledge Plaza Huntingdon Pike
408 Huntingdon PikeRockledge, PA 19046215-379-2100
Family Ownedand Operated
Since 1948
$350Off Any New Stairlift With This Ad
• FREE in home evaluations• Family owned & operated for more than 20 years
1.888.900.8883
www.Tri-StateStairlifts.com
Traditional Funerals, Church Funerals & Memorial Services, Cremations“ONE FAMILY HELPING ANOTHER”
7450 Oxford Ave Phila, PA 19111 215-728-1050
David G RichardsonSupervisor/Owner
Cher l A Webb-RichardsonManager & LCBA Insurance Rep
Parishioner
richardsonsfuneralhome.com Councilman Brian O’Neill
Northeast offi ces near St. Cecilia ParishionersFox Chase - 432 Rhawn Street • 215-685-6431 • Rhawnhurst - 7522 Castor Ave • 215-685-0438
FreeNotaryPublic
Free copies
& Faxes
Karon MassadoReal Estate Salesperson
o 267.435.8015 m [email protected]
1601 Market St.- Fl. 19, Phila, PA
Wackerman Funeral Home, Inc.Wackerman Funeral Home, Inc.8060 Verree Rd. Philadelphia, PA 19111
www.wackermanfuneralhome.com 215-342-5200 Elizabeth Wackerman Bailey, Supervisor 1944 – Austin C. Wackerman - 2017 Emily Wackerman Funeral Director
Free & Confi dential Pregnancy Services24 Hour Hotline: 1-800-550-4900
www.BirthRight.org
“It is the right of every pregnant woman to give birth, and the right of every child to be born.”
~Birthright Charter7986 Oxford Avenue
Philadelphia, PA 19111215-728-0385
A Blessing from God
John DeCristofaroROOFING
Specializing in: Hot Asphalt RoofsShingle Roofs • Gutters • Spouts
215-379-2953 Member of St. Cecilia
A Tompkins Community BankFormerly Madison Bank
8000 Verree Rd., Philadelphia(215) 722-4566
www.risingsunhomecare.org
Providing The Highest Quality Care
Parishioner of St. Cecilia
215-605-9555
catering For your next event, call ahead to order
- Pickup or Delivery -WHITMAN SQUARE 215-969-3455 x1
Eric McHughParishioner
CYO Volunteer OFFERING AUTO, HOME, LIFE,
& BUSINESS INSURANCE Call for a quote
215-328-9990 x7001 or email [email protected]
210 Huntingdon Pike, Rockledge
Patronize the Adve isers who make this bulletin possible!
BUILD YOUR COMMUNITY!
Patt o i e the A
SHOP LOCAL
To advertise your business in this weekly bulletin,contact us at 1.800.333.3166
or visit us at www.jppc.net
Local, trusted, proven, effective, supportive, referrals, relationships, affordable, repetitious, versatile, lasting.
This describes the power of...
Placing an ad in the parish bulletin supports the parish while building your business - THAT’S A WIN WIN!
Call 1.800.333.3166 TODAY!
179 - Church of St. Cecilia, Philadelphia, PA (b) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
Schmidt’s Florist 700 Solly Ave., Phila., PA 19111
www.schmidtsfl orist.com 215-745-6234
LAW OFFICES
PAUL A. COGHLAN437 RHAWN STREET
PHILADELPHIA, PA 19111(215) 725-5998
FAX (215) 725-3904
Robert Wetzel, F.D.419 Huntingdon Pike, Rockledge
Erich Wetzel, Supv.Willow Grove - Bill Herchenroder, Supv. INC.
Funeral Directors Since 1881 215-663-8550 • www.wetzelandson.com
Stewart and McGowanATTORNEYS-AT-LAW
6221 RISING SUN AVE. (Opposite St. William’s Church)338-2800
S W D ’ E
WE DELIVER~ Traditional Pizza~ White Pizza~ Tomato Pies
The Original
Pizza6500 Rising Sun Ave. • 215-745-9992
Nora McCloskeyParishioner
Fine Art ClassesWorkshops & Partiesfor Children & Adults215-301-0103
www.bloomingartiststudio.comwww.bloomingartiststudio.com
PLUMBING, HEATING, DRAIN CLEANING & AIR CONDITIONING
SENIOR CITIZEN DISCOUNTFREE ESTIMATES
Ph: (215) 728-1482Fax: (215) 742-7098
8675 Torresdale Ave.Philadelphia, PA 19136
WWW.BILLFRUSCO.COM
O’Donnell PaintingInterior and Exterior
House Painting & Drywall RepairNeat Clean Work • No Job Too SmallFree Estimates 215-677-5854
JOHN F. GIVNISH(3rd Generation)
JOHN F.X. GIVNISH, III(4th Generation)
Serving the Archdioceseof Philadelphia with
grace and dignity since 1928
1-800-GIVNISH
Each Offi ce Independently Owned and Operated
Larry AitaREALTOR®
Seniors Real Estate SpecialistOutstanding Agents. Outstanding Results.
Regency Realty
Cell: (215) 478-4344Offi ce: (215) [email protected]’s Get Moving!
2018 Outstanding
Agentof the Year
s.
Parishioner
Serving Families Since 1900
Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick, F.D. 1924-2013
Th omas M. McGoldrick, F.D. SupervisorJames T. Meyers, F.D. • Timothy J. Meyers, F.D.
215-884-0800 507 West Avenue, Jenkintown, PA 19046 www.mcgoldrickfh .com
Mallory’s Army FoundationUnited Together In The Fight Against Bullying...
Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com
(973) 440-8657 • [email protected] It’s easy to join our mailing list! Just send your email address by text message:
Text MALLORYSARMY to 22828 to get started.Message and data rates may apply.
Advertise Your Business Here800-333-3166
ext. 161www.jppc.net
What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering their vehicle
to make sure it is the car they are supposed to enter.
In Remembrance of Samantha Josephson
#WHATSMYNAME
JIM CASEYWallcoveringPainting • ScrapingClean Work • Since 1986215-379-0558 Member of Parish
Professionals Serving Professionals
Jay B. ComlyBuilding & Offi ce Maintenance
w/an A+ Rating
Commercial • AutomotiveResidential • Safes
Fully Equipped RadioDispatched Mobile Trucks
7936 Oxford Ave. 215-745-5007
Full Service Locksmith Since 1978Member of Parish
VERREEPHARMACY
7960 VERREE RD.(AT RHAWN)Free Delivery
M-F 9AM - 8PMSat. 9AM - 6PM
Sun. 9AM - 1 PM215-342-0100
Mitchell Spivack, R. PH.
HandymanElectric, PlumbingOdd jobs... Just Ask!
From McCloy’s TV 267-231-8785
Tax & AccountingFrancis J. McConnell CPA
Tax Preparation • Individual & Business(Across from St. Williams)
Call (215) 742-3428 for Appointments
Charles P. Elliott, PC 110 Central Ave
Cheltenham, PA 19012
215-663-2500We Make House Calls
Complimentary InitialConsultation
We are here for all your tax, IRS, fraud investigations,
& inheritance tax.
RENEE ROACHEREALTOR ~ PARISHIONER
FOX CHASE SPECIALISTBuying or Selling a Home?
Call Today!
Office 215-961-6000 Cell [email protected]
EASTERNEEEAEAAEAEEEEEEEEEEEEEEEEAEASTSTTTSTTTSSTTTTTTTTTEEREEEEEEEEEEEEEEAEAEAEEEEEEEEASTSTTTSTTSSTTTEEEREEEE
A Signature Hair Salon llc$10 OFF Color ServiceMen | Women | Children
7950 Bustleton Ave., Philadelphia, PA215-821-3522
Cochrane Construction LLC
ROOFINGSIDING * GUTTERS
Chimney Restorations & RepairsLicensed & Insured PA # 154589
Senior Citizen Discounts • Free Est.215-839-4317
www.cochraneconstruction.org
Friends, Family, Neighbors!
1-844-640-4200 PaulsRun.org/Living
Wedding Invitations Wedding Invitations & Holiday Cards& Holiday CardsLog onto Log onto www.jppc.netwww.jppc.netconveniently from yourconveniently from yourhome or offi ce.home or offi ce.Online CatalogOnline CatalogOnline OrderingOnline OrderingOnline ProofingOnline ProofingAll Major Credit All Major Credit Cards AcceptedCards Accepted
FREE UPS FREE UPS GROUND GROUND SHIPPINGSHIPPING!
WE CARE AND IT SHOWS
Beautiful On-Site Chapel with Daily Mass - Respite Stay Available
We Acknowledge We Appreciate
2990 Holme Ave., Phila.215-335-2100
www.imrehab.org
IMMACULATE MARYCENTER
Rehabilitation & Healthcare
Advertise Your Business Here
800-333-3166 ext. 161www.jppc.net