DNA & Protein DNA & Protein SynthesisSynthesisGene to ProteinGene to Protein

Nucleic Acids and Protein Nucleic Acids and Protein SynthesisSynthesis

• All functions of a cell are directed from All functions of a cell are directed from some central form of information.some central form of information.

• This "biological program" is called the This "biological program" is called the Genetic CodeGenetic Code. - The way cell store . - The way cell store information regarding it's structure and information regarding it's structure and function.function.

HistoryHistory

• For years the source of heredity was For years the source of heredity was unknown. This was resolved after unknown. This was resolved after numerous studies and experimental numerous studies and experimental research by the following researchers:research by the following researchers:

• Fredrick GriffithFredrick Griffith– He was studying effects of 2 strains of an He was studying effects of 2 strains of an

infectious bacteria, the "smooth" strain was infectious bacteria, the "smooth" strain was found to cause pneumonia & death in mice. found to cause pneumonia & death in mice. The "rough" strain did not. He conducted the The "rough" strain did not. He conducted the following experiment following experiment

Griffith ExperimentGriffith ExperimentBacteria Strain injected Bacteria Strain injected into mouseinto mouse

ResultResult

Smooth StrainSmooth Strain Mouse diesMouse dies

Rough strainRough strain Mouse LivesMouse Lives

Heat-Killed Smooth strainHeat-Killed Smooth strain Mouse livesMouse lives

Rough Strain & Heat killed Rough Strain & Heat killed smooth strainsmooth strain

*MOUSE *MOUSE DIES*DIES*

•The last condition was unusual, as The last condition was unusual, as he predicted that the mouse should he predicted that the mouse should livelive•Concluded that some unknown Concluded that some unknown substance was substance was TransformingTransforming the the rough strain into the smooth onerough strain into the smooth one

Avery, McCarty & MacLeodAvery, McCarty & MacLeod•Tried to determine Tried to determine the nature of this the nature of this transforming agent. transforming agent. Eg. Was it protein Eg. Was it protein or DNA?or DNA?•Degraded Degraded chromosomes with chromosomes with enzymes which enzymes which destroyed proteins destroyed proteins or DNAor DNA•Samples with Samples with Proteins destroyed Proteins destroyed would still cause would still cause transformation in transformation in bacteria indicating bacteria indicating genetic material genetic material was DNAwas DNA

Hershey-ChaseHershey-Chase

• 1 virus was "tagged" with 1 virus was "tagged" with 32P on it's DNA32P on it's DNA

• The other was "tagged" The other was "tagged" 35S on it's protein coat.35S on it's protein coat.

• Researchers found the Researchers found the radioactive P in the radioactive P in the bacteriabacteria, , indicating it is indicating it is DNA, not protein being DNA, not protein being injected into bacteriainjected into bacteria..

Watson & CrickWatson & Crick

• The constituents of DNA had The constituents of DNA had long been known. Structure of long been known. Structure of DNA, however was not.DNA, however was not.

• In 1953, Watson & Crick In 1953, Watson & Crick published findings based on X-published findings based on X-ray analysis and other data ray analysis and other data that DNA was in the form of a that DNA was in the form of a "Double Helix". "Double Helix".

• Their findings show us the Their findings show us the basic structure of DNA which basic structure of DNA which is as follows.is as follows.

DNA StructureDNA Structure• DNA is Formed of in a "DNA is Formed of in a "Double HelixDouble Helix" - like a spiral staircase " - like a spiral staircase

NucleotidesNucleotides

• DNA is formed by DNA is formed by NucleotidesNucleotides

• These are made These are made from 3 componentsfrom 3 components1.1. A 5-Carbon SugarA 5-Carbon Sugar

2.2. A Nitrogenous baseA Nitrogenous base

3.3. A Phosphate groupA Phosphate group

Nucleotide types:Nucleotide types:• For DNA There are 4 different Nucleotides categorized as either For DNA There are 4 different Nucleotides categorized as either

PurinesPurines or or PyramidinesPyramidines. These are usually represented by a . These are usually represented by a letter. These Are:letter. These Are:1.1. Adenine (A)Adenine (A)2.2. Cytosine (C)Cytosine (C)3.3. Guanine (G)Guanine (G)4.4. Thymine (T)Thymine (T)

Base PairingBase Pairing• Each "Rung" of the DNA "staircase" is formed by the linking of 2 Each "Rung" of the DNA "staircase" is formed by the linking of 2

Nucleotides through Nucleotides through Hydrogen Bonds.Hydrogen Bonds.• These Hydrogen bonds form only between specific Nucleotides. These Hydrogen bonds form only between specific Nucleotides.

This is known This is known as Base Pairingas Base Pairing. The rules are as follows:. The rules are as follows:– Adenine (A) will ONLY bond to Thymine (T) (by 2 hydrogen bonds)Adenine (A) will ONLY bond to Thymine (T) (by 2 hydrogen bonds)– Cytosine (C) will ONLY bond to Guanine (G) (by 3 hydrogen Cytosine (C) will ONLY bond to Guanine (G) (by 3 hydrogen

bonds)bonds)

Central dogma of geneticsCentral dogma of genetics

• Central DogmaCentral Dogma holds that genetic information is holds that genetic information is expressed in a specific order. This order is as follows expressed in a specific order. This order is as follows

There are some apparent exceptions to this.There are some apparent exceptions to this.Retroviruses (eg. HIV) are able to synthesize DNA from RNARetroviruses (eg. HIV) are able to synthesize DNA from RNA

DNA ReplicationDNA Replication• DNA has unique ability to make copies of itselfDNA has unique ability to make copies of itself• This is a major "driving force" of living things.This is a major "driving force" of living things.• Does so through the process of Does so through the process of DNA ReplicationDNA Replication..• Complex processComplex process• DNA "Unzips itself" forming two strands with an exposed Nucleotide.DNA "Unzips itself" forming two strands with an exposed Nucleotide.• An nucleotide which forms the appropriate Base-pair bonds with the An nucleotide which forms the appropriate Base-pair bonds with the

exposed nucleotide. This is facilitated by the enzyme exposed nucleotide. This is facilitated by the enzyme DNA PolymeraseDNA Polymerase..• The process moves down the DNA molecule, and once complete, results in The process moves down the DNA molecule, and once complete, results in

two identical DNA strands.two identical DNA strands.• Transcription proceeds continuously along the 5'Transcription proceeds continuously along the 5'3' direction (This is called 3' direction (This is called

the leading strand)the leading strand)• Proceeds in fragments in the other direction (called the lagging strand) in Proceeds in fragments in the other direction (called the lagging strand) in

the following waythe following way• RNA primer attached to a segment of the strand by enzyme RNA primer attached to a segment of the strand by enzyme primaseprimase..• Transcription now continues in the 5'Transcription now continues in the 5'3' direction forming an 3' direction forming an okazakiokazaki

fragmentfragment. Until it reaches the next fragment.. Until it reaches the next fragment.• The two fragments are joined by The two fragments are joined by DNA ligaseDNA ligase

DNA ReplicationDNA Replication

RNA TranscriptionRNA Transcription• The cell does not directly use The cell does not directly use

DNA to control the function of the DNA to control the function of the cell.cell.

• DNA is too precious and must be DNA is too precious and must be kept protected within the nucleus.kept protected within the nucleus.

• The Cell makes a working The Cell makes a working "Photocopy" of itself to do the "Photocopy" of itself to do the actual work of making proteins.actual work of making proteins.

• This copy is called This copy is called Ribonucleic Ribonucleic Acid or RNAAcid or RNA..

• RNA differs from DNA in several RNA differs from DNA in several important ways.important ways.1.1. It is much smallerIt is much smaller2.2. It is single-strandedIt is single-stranded3.3. It does NOT contain It does NOT contain ThymineThymine, ,

but rather a new nucleotide called but rather a new nucleotide called UracilUracil which will bind to Adenine. which will bind to Adenine.

RNA TranscriptionRNA Transcription• RNA is produced through a process called RNA is produced through a process called RNA Transcription.RNA Transcription.• Similar to DNA Replication.Similar to DNA Replication.• Small area of DNA "Unzips" exposing NucleotidesSmall area of DNA "Unzips" exposing Nucleotides• This area is acted on by an enzyme called This area is acted on by an enzyme called RNA PolymeraseRNA Polymerase, which , which

binds nucleotides (using uracil) to their complimentary base pair.binds nucleotides (using uracil) to their complimentary base pair.• This releases a long strand of This releases a long strand of Messenger RNA (mRNA)Messenger RNA (mRNA) which is which is

an important component ofan important component of protein synthesis.protein synthesis.

Protein Synthesis & The Genetic Protein Synthesis & The Genetic CodeCode

• The Sequence of nucleotides in an mRNA The Sequence of nucleotides in an mRNA strand determine the sequence of amino strand determine the sequence of amino acids in a proteinacids in a protein

• Process requires mRNA, tRNA & Process requires mRNA, tRNA & ribosomes ribosomes

mRNAmRNA• Each three Each three

Nucleotide Nucleotide sequence in an sequence in an mRNA strand is mRNA strand is called a "called a "CodonCodon" " Each Codon codes Each Codon codes for a particular for a particular amino acid.amino acid.

• The codon The codon sequence codes for sequence codes for an amino acid using an amino acid using specific rules. specific rules. These specific These specific codon/amino acid codon/amino acid pairings is called pairings is called the the Genetic CodeGenetic Code. .

tRNAtRNA•There is a special form of There is a special form of RNA called RNA called Transfer RNA or Transfer RNA or tRNAtRNA..•Each tRNA has a 3 Each tRNA has a 3 Nucleotide sequence on one Nucleotide sequence on one end which is known as the end which is known as the ""AnitcodonAnitcodon""•This Anticodon sequence This Anticodon sequence is is complimentary to the Codon complimentary to the Codon sequence found on the strand sequence found on the strand of mRNAof mRNA•Each tRNA can bind Each tRNA can bind specificallyspecifically with a particular with a particular amino acid.amino acid.

RibosomeRibosome

• Consists of two Consists of two subunitssubunits– Large subunitLarge subunit– Small subunitSmall subunit

• Serves as a template Serves as a template or "work station" or "work station" where protein where protein synthesis can occur.synthesis can occur.

Protein SynthesisProtein Synthesis• Protein synthesis is a complex, many Protein synthesis is a complex, many

step process, it is as follows.step process, it is as follows.– An mRNA strand binds to the large & An mRNA strand binds to the large &

small subunits of a ribosome in the small subunits of a ribosome in the cytoplasm of the cellcytoplasm of the cell

• This occurs at the AUG (initiation) This occurs at the AUG (initiation) codon of the strand.codon of the strand.

– A tRNA molecule with an attached A tRNA molecule with an attached amino acid binds to the mRNA strand.amino acid binds to the mRNA strand.

• Note: This occurs with complimentary Note: This occurs with complimentary codons & anti-codons.codons & anti-codons.

– Another tRNA binds to the adjacent Another tRNA binds to the adjacent codon of the mRNAcodon of the mRNA

– A peptide bond is formed between the A peptide bond is formed between the amino acidsamino acids

– The first tRNA is released, and another The first tRNA is released, and another tRNA binds next to the second, tRNA binds next to the second, another peptide bond is formed.another peptide bond is formed.

– This process continues until a stop This process continues until a stop codon is reached.codon is reached.

– The completed polypeptide is then The completed polypeptide is then released.released.

Replication ProblemReplication Problem

• Given a DNA strand with the following nucleotide Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary sequence, what is the sequence of its complimentary strand?strand?

• 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’

AnswerAnswer

• Given a DNA strand with the following nucleotide Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary sequence, what is the sequence of its complimentary strand?strand?

• 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’• 5’- ATGGTGCACCTGACTCCTGAGGAGAAGTCT -3’5’- ATGGTGCACCTGACTCCTGAGGAGAAGTCT -3’

RNA Transcription ProblemRNA Transcription Problem

• Given a DNA strand with the following nucleotide Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary sequence, what is the sequence of its complimentary mRNA strand?mRNA strand?

• 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’

ANSWERANSWER

• Given a DNA strand with the following nucleotide Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary sequence, what is the sequence of its complimentary mRNA strand?mRNA strand?

• 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’• 3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’

Codon / AnticodonCodon / Anticodon

• Given a mRNa strand with the following Given a mRNa strand with the following nucleotide sequence, what are the sequence nucleotide sequence, what are the sequence (anticodons) of its complimentary tRNA strands?(anticodons) of its complimentary tRNA strands?

• 3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’

AnswerAnswer

Given a mRNA strand with the following nucleotide Given a mRNA strand with the following nucleotide sequence, what are the sequence (anticodons) sequence, what are the sequence (anticodons) of its complimentary tRNA strands?of its complimentary tRNA strands?

3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’

Protein TranslationProtein Translation

• Given the following Given the following sequence of mRNA, sequence of mRNA, what is the amino what is the amino acid sequence of the acid sequence of the resultant resultant polypeptide?polypeptide?

• AUGGUGCACCUGAAUGGUGCACCUGACUCCUGAGGAGAACUCCUGAGGAGAAGUCUGUCU

Protein Translation / AnswerProtein Translation / Answer

• Given the following Given the following sequence of mRNA, sequence of mRNA, what is the amino what is the amino acid sequence of the acid sequence of the resultant resultant polypeptide?polypeptide?

• AUGGUGCACCUGAAUGGUGCACCUGACUCCUGAGGAGAACUCCUGAGGAGAAGUCUGUCU

Met-val-his-leu-thr-pro-glu-glu-lys-serMet-val-his-leu-thr-pro-glu-glu-lys-ser