Possible Scientists

Frederick GriffithOswald AveryErwin ChargaffRosalind Franklin & Maurice WilkinsAlfred Hershey & Martha ChaseLinus PaulingJames Watson & Francis CrickFriedrich Miescher

DNA & Protein SynthesisFrom Gene to Protein

Nucleic Acids and Protein SynthesisAll functions of a cell are directed from some central form of information (DNA).This "biological program" is called the Genetic Code.This is the way cells store information regarding their structure and function.

History of DNAComposition and Structure

HistoryFor years the source of heredity was unknown. This was resolved after numerous studies and experimental research by the following researchers:Fredrick GriffithHe was studying effects of 2 strains of an infectious bacteria, the "smooth" strain was found to cause pneumonia & death in mice. The "rough" strain did not. He conducted the following experiment

Griffith ExperimentThe last condition was unusual, as he predicted that the mouse should liveConcluded that some unknown substance was Transforming the rough strain into the smooth one

Bacteria Strain injected into mouseResultSmooth StrainMouse diesRough strainMouse LivesHeat-Killed Smooth strainMouse livesRough Strain & Heat killed smooth strain*MOUSE DIES*

Avery, McCarty & MacLeodWas it protein or DNA?They Degraded chromosomes with enzymes that destroyed proteins or DNAThe Samples with Proteins destroyed would still cause transformation in bacteria indicating genetic material was DNATried to determine the nature of this transforming agent.

Hershey-Chase ONE virus was radioactively "tagged" with 32P on it's DNAThe OTHER was "tagged" 35S on it's protein coat.Researchers found the radioactive P in the bacteria, indicating it is DNA, not protein being injected into bacteria.

Watson & CrickThe constituents of DNA had long been known. Structure of DNA, however was not.In 1953, Watson & Crick published findings based on X-ray analysis (Rosalind Franklin) and other data that DNA was in the form of a "Double Helix". Their findings show us the basic structure of DNA which is as follows.

DNA StructureThe Double Helix

DNA StructureDNA is Formed of in a "Double Helix" - like a spiral staircase

NucleotidesDNA is formed by NucleotidesThese are made from three components:5-Carbon or pentose SugarNitrogenous base Phosphate group

Types of NucleotidesFor DNA There are 4 different Nucleotides categorized as either Purines (Double rings) or Pyrimidines (Single ring). These are usually represented by a letter. They Are:Adenine (A)Cytosine (C)Guanine (G)Thymine (T)Guanine

Base PairingEach "Rung" of the DNA "staircase" is formed by the linking of 2 Nucleotides through Hydrogen Bonds.These Hydrogen bonds form only between specific Nucleotides. This is known as Base Pairing. The rules are as follows:Adenine (A) will ONLY bond to Thymine (T) (by 2 hydrogen bonds)Cytosine (C) will ONLY bond to Guanine (G) (by 3 hydrogen bonds)

Central Dogma of GeneticsDNA to Protein Synthesis

Central Dogma of GeneticsCentral Dogma holds that genetic information is expressed in a specific order. This order is as follows There are some apparent exceptions to this.Retroviruses (eg. HIV) are able to synthesize DNA from RNA

DNA ReplicationDNA has unique ability to make copies of itselfThe process is called DNA Replication.First, the enzyme Helicase unwinds the parental DNADNA "Unzips itself" by breaking the weak hydrogen bonds between base pairs forming two TEMPLATE strands with exposed Nucleotides

DNA ReplicationThe place where helicase attaches and opens DNA is called the Replication ForkREPLICATION FORK

DNA ReplicationHelicase enzymes may attach to multiple sites on the DNA strand forming Replication Bubbles which makes replication faster

DNA ReplicationSingle-strand binding proteins attach & STABILIZE the 2 parental strandsDNA polymerase attaches to the 3 end of the 5 to 3 parental strandDNA polymerase attaches FREE nucleotides to the complementary nucleotide on the parental DNA This new strand is synthesized continuously 5 to 3 (LEADING)

Replication BubbleOrigin of ReplicationOrigin of ReplicationDNA is synthesized from the Origin of Replication within a replication bubbleTowards fork continuous replicationAway from fork discontinuous replication (fragments)

DNA ReplicationSince DNA polymerase can only add nucleotides to the 3 end of the parental strand, the parental 5 to 3 strand must be replicated in fragments that must later be joined together (LAGGING)

DNA ReplicationTranscription proceeds continuously along the 5'3' direction (This is called the leading strand)Proceeds in fragments in the other direction (called the lagging strand) in the following wayRNA primer is attached to a segment of the strand by the enzyme primase.

DNA ReplicationTranscription now continues in the 5'3' direction forming an okazaki fragment. Until it reaches the next fragment.

The two fragments are joined by the enzyme DNA ligase

Two, new, identical DNA strands are now formed

DNA Replication

Protein SynthesisTranscription and Translation

RNA TranscriptionThe cell does not directly use DNA to control the function of the cell.DNA is too precious and must be kept protected within the nucleus.The Cell makes a working "Photocopy" of itself to do the actual work of making proteins.This copy is called Ribonucleic Acid or RNA.RNA differs from DNA in several important ways.It is much smallerIt is single-strandedIt does NOT contain Thymine, but rather a new nucleotide called Uracil which will bind to AdenineContains ribose, not deoxyribose sugar

RNA TranscriptionRNA is produced through a process called RNA Transcription.Similar to DNA Replication.Small area of DNA "Unzips" exposing NucleotidesThis area is acted on by an enzyme called RNA Polymerase, which binds nucleotides (using uracil) to their complementary base pair.This releases a long strand of Messenger RNA (mRNA) which is an important component of protein synthesis.

RNA Transcription

Protein Synthesis & The Genetic CodeThe Sequence of nucleotides in an mRNA strand determine the sequence of amino acids in a proteinProcess requires mRNA, tRNA & ribosomes Polypeptide chains are synthesized by linking amino acids together with peptide bonds

mRNAEach three Nucleotide sequence in an mRNA strand is called a "CodonEach Codon codes for a particular amino acid.The codon sequence codes for an amino acid using specific rules. These specific codon/amino acid pairings is called the Genetic Code.

tRNAThere is a special form of RNA called Transfer RNA or tRNA.Each tRNA has a 3 Nucleotide sequence on one end which is known as the "Anitcodon"This Anticodon sequence is complimentary to the Codon sequence found on the strand of mRNAEach tRNA can bind specifically with a particular amino acid.

RibosomeConsists of two subunits made of protein & rRNALarge subunitSmall subunitServes as a template or "work station" where protein synthesis can occur.

Protein SynthesisFirst, an mRNA strand binds to the large & small subunits of a ribosome in the cytosol of the cellThis occurs at the AUG (initiation) codon of the strand.The ribosome has 3 binding sites for codons --- E (exit site), P, and A (entry site for new tRNA)The ribosome moves along the mRNA strand

Protein SynthesisAn anticodon on tRNA binds to a complementary codon on mRNA.The tRNA carrying an amino acid enters the A site on the ribosomeThe ribosome moves down the mRNA so the tRNA is now in the P site and another tRNA enters the A siteA peptide bond is formed between the amino acids and the ribosome moves down againThe first tRNA is released, and another tRNA binds next to the second, another peptide bond is formed.This process continues until a stop codon (UAG) is reached.The completed polypeptide is then released.

Protein Synthesis

Replication ProblemGiven a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary strand?

3- TACCACGTGGACTGAGGACTCCTCTTCAGA -5

AnswerGiven a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary strand?

3- TACCACGTGGACTGAGGACTCCTCTTCAGA -55- ATGGTGCACCTGACTCCTGAGGAGAAGTCT -3

RNA Transcription ProblemGiven a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary mRNA strand?

3- TACCACGTGGACTGAGGACTCCTCTTCAGA -5

ANSWERGiven a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary mRNA strand?

3- TACCACGTGGACTGAGGACTCCTCTTCAGA -53- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5

Codon / AnticodonGiven a mRNa strand with the following nucleotide sequence, what are the sequence (anticodons) of its complimentary tRNA strands?

3- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5

AnswerGiven a mRNA strand with the following nucleotide sequence, what are the sequence (anticodons) of its complimentary tRNA strands?

3- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -53 UACCACGUGGAUGAGGACUCCUCUUCAGA -5

Protein TranslationGiven the following sequence of mRNA, what is the amino acid sequence of the resultant polypeptide?

AUGGUGCACCUGACUCCUGAGGAGAAGUCU

Protein Translation / AnswerGiven the following sequence of mRNA, what is the amino acid sequence of the resultant polypeptide?

AUGGUGCACCUGACUCCUGAGGAGAAGUCU

Met-val-his-leu-thr-pro-glu-glu-lys-ser