DNA Fingerprinting of Bacterial Communities

OverviewTargets gene for ribosomal RNA (16S rDNA)Make many DNA copies of the gene for the entire community DNA using modified PCRCut amplified DNA with restriction enzymeSlight variations in 16S rDNA sequence among the different organisms results in different fragment lengthsWhen analyzed, only the first fragment (length varies for each type of organism) of the 16S rDNA is detectedGives a fingerprint of the number of different organisms in a sample (each a different peak) and relative abundance (height of peak)Identity of organism represented by each peak not known

T-RFLPTagged (or Terminal) Restriction Fragment Length PolymorphismPCR 16s w/ 1 fluorescent primerMixed community DNADigest PCR product with restriction enzymeLabeled fragments of different taxa are different lengthsSeparate fragments on sequencerFluorescence detector produces graph of fragments present(Each peak a different type of organism)

Example FingerprintT-RFLP from control site County Brigde

Why 16S rDNA?Not all (actually a small percentage) microorganisms can be easily culturedCulture-based studies are skewedAll organisms have ribosomesFunction of small subunit RNA (16S in bacteria and archaea) identical in all organismsRegions of varying conservationSome so conserved they are universalSome so variable they can be used to distinguish between very closely related organisms (different strains of same species)

PCRCool website tutorialUsed to amplify a specified region of DNARegion of DNA specified by primers which bind to short sequences of DNA on either endPrimers are short (~18 nucleotide) DNA oligomers

Restriction EnzymesEnzymes from bacteria which cut DNA at specific sequencesNaturally used by bacteria to protect themselves from foreign DNA (i.e. viruses)Used by biologists like DNA scissorsUseful because you know the sequence where they cutcan differentiate sequences of DNA by different fragment lengths

Separating DNAAgarose gel electrophoresis separates DNA fragments by sizeT-RFLP uses capillary electrophoresisSame principle but 1 nucleotide resolution12CATGGTGGTACCACTTAAAATTCGAATTCTTGTGCTTAAGAACACATGGTGGTACCACTTAAAATTCTTGTGAACAAATTCGGCTTAA

Example Fingerprint(s)What do these tell us about the bacterial community?What cant they tell us?Control (County Bridge)AMD-impacted (DFB099)

Dendrogram of Community SimilaritiesMore similar T-RFLP patterns on closer branchesControl: CBAMD:DFB099CCFB

****Bacterial 16s rDNA from each sample was amplified using 63f and 1387r primers.The 63f primer was then 5-tagged with FAM.A 50 uL reaction volume PCR was run.A 200 ng digest was then performed on the PCR products using the enzyme CfoI.The lengths of the fluorescently tagged digest products were then determined using a 3730xl DNA Analyzer at the Core Life Sciences Center at Cornell University. The traces were then analyzed using Genemapper Software v. 3.0.******