dna fingerprinting class 832. lego model of dna dna is a molecule in your body. it is a code, which...

10
DNA Fingerprinting Class 832

Upload: martin-charles

Post on 02-Jan-2016

213 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: DNA Fingerprinting Class 832. LEGO Model of DNA DNA is a molecule in your body. It is a code, which stores instructions for building the “machines” in

DNA Fingerprinting

Class 832

Page 2: DNA Fingerprinting Class 832. LEGO Model of DNA DNA is a molecule in your body. It is a code, which stores instructions for building the “machines” in

LEGO Model of DNA•DNA is a molecule in your body.

•It is a code, which stores instructions for building the “machines” in your body.

•It is a double helix.

•It is a millionth of a millimeter wide.

•In humans, a molecule of DNA is 200,000,000 bases long.

Page 3: DNA Fingerprinting Class 832. LEGO Model of DNA DNA is a molecule in your body. It is a code, which stores instructions for building the “machines” in

DNA is a Code

GGAAAACTAACCCTTTTGATTG

•The genetic code is written in A’s, T’s, C’s and G’s.

•The sequence of A’s, T’s, C’s and G’s uniquely identifies a person, unless they are a twin.

•That’s why it’s called DNA fingerprinting.

Page 4: DNA Fingerprinting Class 832. LEGO Model of DNA DNA is a molecule in your body. It is a code, which stores instructions for building the “machines” in

Restriction Enzymes are Molecules that Cut DNA at

Particular “Words”

Page 5: DNA Fingerprinting Class 832. LEGO Model of DNA DNA is a molecule in your body. It is a code, which stores instructions for building the “machines” in

Restriction Enzyme Cuts Yield Different Sized DNA Fragments

GGATGGCCTAA/TTCCGGTTAA/TTGGTACCGGATT/AAGGCCAATT/AA

11 10 2

Page 6: DNA Fingerprinting Class 832. LEGO Model of DNA DNA is a molecule in your body. It is a code, which stores instructions for building the “machines” in

Gel Electrophoresis is Used to Separate the Fragments Based on Size

Page 7: DNA Fingerprinting Class 832. LEGO Model of DNA DNA is a molecule in your body. It is a code, which stores instructions for building the “machines” in

Example DNA Fingerprint

•Column in Gel corresponds to a person’s DNA.

•It is called a person’s DNA fingerprint.

•Row corresponds to DNA fragment size.

Page 8: DNA Fingerprinting Class 832. LEGO Model of DNA DNA is a molecule in your body. It is a code, which stores instructions for building the “machines” in

Different People Have Different Restriction Enzyme Cut Sites

Resulting in different band patterns on a gel.

1 2

Resulting in different sized DNA fragments.

Page 9: DNA Fingerprinting Class 832. LEGO Model of DNA DNA is a molecule in your body. It is a code, which stores instructions for building the “machines” in

Who did it?

Solving a Murder Mystery Using

DNA Fingerprinting

Page 10: DNA Fingerprinting Class 832. LEGO Model of DNA DNA is a molecule in your body. It is a code, which stores instructions for building the “machines” in

Given crime scene DNA and suspect DNA you will construct a gel.

You will then analyze the gel to find a match between the crime scene DNA and a suspect’s DNA.

You will use this information to make inferences about the murders.

Solving Our Murder Mystery Using DNA

Fingerprinting