dna fingerprinting a method of developing a person’s dna “profile,” similar to a fingerprint....
TRANSCRIPT
![Page 1: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec](https://reader036.vdocuments.us/reader036/viewer/2022062407/56649d195503460f949eeb81/html5/thumbnails/1.jpg)
DNA Fingerprinting
• A method of developing a person’s DNA “profile,” similar to a fingerprint.
• Pioneered in England in 1984 by Dr. Alec Jeffreys
Dr. Alec Jeffreys
![Page 2: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec](https://reader036.vdocuments.us/reader036/viewer/2022062407/56649d195503460f949eeb81/html5/thumbnails/2.jpg)
First Forensic Use
• First used by law enforcement in England in the mid-1980’s.
• DNA evidence exonerated one man, and convicted another.
• Described in The Blooding, by Joseph Wambaugh
![Page 3: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec](https://reader036.vdocuments.us/reader036/viewer/2022062407/56649d195503460f949eeb81/html5/thumbnails/3.jpg)
How does it work?
• 99.9% of your DNA is the same as everyone else’s.
• The 0.1% that differs are a combination of:– Gene differences (Differences in the genes
themselves)– Differences in “polymorphic regions” between the
genes on the DNA.
![Page 4: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec](https://reader036.vdocuments.us/reader036/viewer/2022062407/56649d195503460f949eeb81/html5/thumbnails/4.jpg)
How does it work?
• Certain points between the genes on the DNA have repeating base sequences.– For example:
ATTACGCGCGCGCGCGCGCTAGC– These are called short tandem repeats (STRs for
short)
![Page 5: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec](https://reader036.vdocuments.us/reader036/viewer/2022062407/56649d195503460f949eeb81/html5/thumbnails/5.jpg)
How does it work?
• Everyone has STRs at the same place in their DNA, but they are different lengths for different people.– For example:
Person 1: ATTACGCGCGCGCGCGCGTAGC(7 repeats)
Person 2: ATTACGCGCGCGCGTAGC(5 repeats)
![Page 6: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec](https://reader036.vdocuments.us/reader036/viewer/2022062407/56649d195503460f949eeb81/html5/thumbnails/6.jpg)
To Make a DNA Fingerprint…
• First, we use restriction enzymes to chop the DNA up into millions of fragments of various lengths.– Some of the fragments contain STRs; some do
not. The ones that do are different lengths for different people.
![Page 7: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec](https://reader036.vdocuments.us/reader036/viewer/2022062407/56649d195503460f949eeb81/html5/thumbnails/7.jpg)
Restriction Fragment Length Polymorphisms (RFLPs)
• Polymorphisms are slight differences in DNA sequences as seen in individuals of the same species
![Page 8: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec](https://reader036.vdocuments.us/reader036/viewer/2022062407/56649d195503460f949eeb81/html5/thumbnails/8.jpg)
To Make a DNA Fingerprint…
• Next, we use gel electrophoresis to sort the DNA fragments by size.
![Page 9: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec](https://reader036.vdocuments.us/reader036/viewer/2022062407/56649d195503460f949eeb81/html5/thumbnails/9.jpg)
Gel Electrophoresis
• Method for sorting proteins or nucleic acids on the basis of their electric charge and size
![Page 10: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec](https://reader036.vdocuments.us/reader036/viewer/2022062407/56649d195503460f949eeb81/html5/thumbnails/10.jpg)
Gel Electrophoresis• Electrical current carries
negatively-charged DNA through gel towards positive electrode
• Agarose gel sieves DNA fragments according to size– Small fragments move
farther than large fragments
![Page 11: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec](https://reader036.vdocuments.us/reader036/viewer/2022062407/56649d195503460f949eeb81/html5/thumbnails/11.jpg)
Gel Electrophoresis
![Page 12: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec](https://reader036.vdocuments.us/reader036/viewer/2022062407/56649d195503460f949eeb81/html5/thumbnails/12.jpg)
To Make a DNA Fingerprint…
• Finally, a radioactive probe attaches to our STRs. Only the fragments with our STRs will show up on the gel.
Figure 12.11C
Restriction fragmentpreparation
1
Restrictionfragments
Gel electrophoresis2
Blotting3
Probe
Radioactive probe4
Detection of radioactivity(autoradiography)
5
Film
![Page 13: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec](https://reader036.vdocuments.us/reader036/viewer/2022062407/56649d195503460f949eeb81/html5/thumbnails/13.jpg)
To Make a DNA Fingerprint…
• Since STRS are different lengths in different people, this creates a DNA Fingerprint.
![Page 14: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec](https://reader036.vdocuments.us/reader036/viewer/2022062407/56649d195503460f949eeb81/html5/thumbnails/14.jpg)
Two uses for DNA Fingerprints...
• ForensicsDNA taken from crime scenes (blood, semen, hair, etc.) can be compared to the DNA of suspects.
Real-life CSI!
![Page 15: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec](https://reader036.vdocuments.us/reader036/viewer/2022062407/56649d195503460f949eeb81/html5/thumbnails/15.jpg)
Two uses for DNA Fingerprints...
• ForensicsThis is an example of a gel that might be used to convict a rape suspect. Compare the “Sperm DNA” to the “Suspect DNA.” Which suspect committed the rape?
![Page 16: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec](https://reader036.vdocuments.us/reader036/viewer/2022062407/56649d195503460f949eeb81/html5/thumbnails/16.jpg)
Two uses for DNA Fingerprints...
• Paternity TestingSince all of our DNA markers came from either mommy or daddy, we can use DNA fingerprints to determine whether a child and alleged father are related…just like on Maury Povich!
![Page 17: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec](https://reader036.vdocuments.us/reader036/viewer/2022062407/56649d195503460f949eeb81/html5/thumbnails/17.jpg)
Two uses for DNA Fingerprints...
• Look at the two “Child” markers on this gel. Can they both be matched up to either the mother or the “alleged father?”
• Yes. This is a “positive” test for paternity.
![Page 18: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec](https://reader036.vdocuments.us/reader036/viewer/2022062407/56649d195503460f949eeb81/html5/thumbnails/18.jpg)
Two uses for DNA Fingerprints...
• How about this gel? Do both of the child’s markers match either the mother or the “alleged father.”
• No! The “alleged father” is not this child’s biological parent.
![Page 19: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec](https://reader036.vdocuments.us/reader036/viewer/2022062407/56649d195503460f949eeb81/html5/thumbnails/19.jpg)
Interpreting DNA Fingerprints
• Which child is not related to the mother?
• Son 2
• Which children are not related to the father?
• Daughter 2 and Son 2
![Page 20: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec](https://reader036.vdocuments.us/reader036/viewer/2022062407/56649d195503460f949eeb81/html5/thumbnails/20.jpg)
Interpreting DNA Fingerprints
• A blood stain was found at a murder scene. The blood belongs to which of the seven possible suspects?
Suspect 3
![Page 21: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec](https://reader036.vdocuments.us/reader036/viewer/2022062407/56649d195503460f949eeb81/html5/thumbnails/21.jpg)
Interpreting DNA Fingerprints
• These DNA fingerprints are from a mother, a child, and two possible biological fathers. Which one is the daddy?
2nd alleged father
![Page 22: DNA Fingerprinting A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec](https://reader036.vdocuments.us/reader036/viewer/2022062407/56649d195503460f949eeb81/html5/thumbnails/22.jpg)
The Polymerase Chain Reaction (PCR)
• The polymerase chain reaction, PCR, can produce many copies of a specific target segment of DNA
• A three-step cycle—heating, cooling, and replication—brings about a chain reaction that produces an exponentially growing population of identical DNA molecules
Genomic DNA
Targetsequence
5
3
3
5
5
3
3
5
Primers
Denaturation:Heat brieflyto separate DNAstrands
Annealing:Cool to allowprimers to formhydrogen bondswith ends oftarget sequence
Extension:DNA polymeraseadds nucleotides tothe 3 end of eachprimer
Cycle 1yields
2molecules
Newnucleo-
tides
Cycle 2yields
4molecules
Cycle 3yields 8
molecules;2 molecules
(in white boxes)match target
sequence
Genomic DNA
Targetsequence
5
3
3
5
5
3
3
5
Primers
Denaturation:Heat brieflyto separate DNAstrands
Annealing:Cool to allowprimers to formhydrogen bondswith ends oftarget sequence
Extension:DNA polymeraseadds nucleotides tothe 3 end of eachprimer
Cycle 1yields
2molecules
Newnucleo-
tides
Cycle 2yields
4molecules
Cycle 3yields 8
molecules;2 molecules
(in white boxes)match target
sequence