DIY Primer DesignDIY Primer DesignOligonucleotides for Special Oligonucleotides for Special

Applications in Molecular BiologyApplications in Molecular Biology

Alberto CatalanoAlberto Catalano

Kanematsu Labs, Institute of HaematologyKanematsu Labs, Institute of HaematologyRPAHRPAH

alberto.catalano@email.cs.nsw.gov.aualberto.catalano@email.cs.nsw.gov.au

Ph: 9515 7453Ph: 9515 7453

http://http://users.bigpond.net.au/albert/primers.htmusers.bigpond.net.au/albert/primers.htm

OutlineOutline DNA Refresher: “DNA 101”DNA Refresher: “DNA 101” PCRPCR

IntroductionIntroduction Oligonucleotide Primers for PCROligonucleotide Primers for PCR

PropertiesProperties SpecificitySpecificity Self complementarity & primer-primer interactionsSelf complementarity & primer-primer interactions General rulesGeneral rules

Primer DesignPrimer Design Computer programmes: on internet & on PCComputer programmes: on internet & on PC

Special PCR ApplicationsSpecial PCR Applications

DNA 101DNA 101The “Basics”The “Basics”

• Common form of DNA

• Formed under high humidity conditions

• Right-handed double helix

• Major groove & minor groove

• Sugar-phosphate backbones

B-DNA

Ramaswamy H. Sarma 1996

2nm

3.4nm

10 nucleotides per turn

Sugar + Phosphate + BaseSugar + Phosphate + Base

Sugar + Phosphate form the backbone

Base-pairing & DNA StabilityBase-pairing & DNA Stability 4 nucleotide bases in DNA4 nucleotide bases in DNA Cytosine (C) pairs with Guanine (G)Cytosine (C) pairs with Guanine (G)

3 hydrogen bonds3 hydrogen bonds Strong-pairingStrong-pairing

Adenine (A) pairs with Thymine (Adenine (A) pairs with Thymine ( TT )) 2 hydrogen bonds2 hydrogen bonds Weak-pairingWeak-pairing

Stacking forcesStacking forces Van der Waals forcesVan der Waals forces Influenced by nearest neighbour sequenceInfluenced by nearest neighbour sequence

Base-pairing

PyrimidinesPurines

OligonucleotidesOligonucleotidesShort single-stranded DNAShort single-stranded DNA

Uses for oligonucleotidesUses for oligonucleotides PCR, PCR, etc.etc.

Primer pairs Primer pairs Primer sets in multiplex assaysPrimer sets in multiplex assays

ProbesProbes Sequence identificationSequence identification Gel shift assaysGel shift assays

Gene technologyGene technology Synthetic genesSynthetic genes Site-directed mutagenesisSite-directed mutagenesis

Oligonucleotide ChoiceOligonucleotide Choice SequenceSequence

SpecificitySpecificity GC contentGC content Target sequence locationTarget sequence location

Avoiding repeat sequencesAvoiding repeat sequences

Melting temperatureMelting temperature Avoid Secondary structuresAvoid Secondary structures

SpecificitySpecificity

Approximation of complexity (for a random Approximation of complexity (for a random sequence)sequence) 1 base = 41 base = 411 ; 2 bases = 4 ; 2 bases = 422 ; 3 bases = 4 ; 3 bases = 43 3 ; ...; ...

n bases = 4n bases = 4nn

Biological sequences are not random!Biological sequences are not random! Check the oligos with BLASTCheck the oligos with BLAST

Need to avoid complementarity with Need to avoid complementarity with repetitive sequences in specific organismrepetitive sequences in specific organism e.g. human Alu sequences, simple repeatse.g. human Alu sequences, simple repeats

Unwanted Self & Primer-Primer Unwanted Self & Primer-Primer InteractionsInteractions

Primer self-complementarityPrimer self-complementarity At 3’-end can result in primer-dimer formationAt 3’-end can result in primer-dimer formation

Internal homology : stem & loop structuresInternal homology : stem & loop structures

Forward & reverse primer complementarityForward & reverse primer complementarity Primer-dimer formation between different primersPrimer-dimer formation between different primers

|||||||||||||||||||||||||||

|||||||||||||||||||||||||||

|||||||||||||||||||||||

|||||||||||||||||||||||

|||||||||||||||||||||||||||

|||||||||||||||||||||||||||

|||||||||||||||||||||||

|||||||||||||||||||||||

Primer Length vs PurityPrimer Length vs Purity Most oligonucleotide synthesis reactions are Most oligonucleotide synthesis reactions are

only 98% efficient.  only 98% efficient.  Each time a base is added, only 98% of the Each time a base is added, only 98% of the

oligos will receive the base.oligos will receive the base. As length increases, so does the probability As length increases, so does the probability

that a primer will be missing a basethat a primer will be missing a base Critical in mutagenesis or cloning reactions.  Critical in mutagenesis or cloning reactions.  Purification by HPLC or PAGE is Purification by HPLC or PAGE is

recommended in some cases.  recommended in some cases. 

Primer Length vs PurityPrimer Length vs Purity

Oligonucleotide lengthOligonucleotide length Percent with correct sequencePercent with correct sequence

10 bases (0.98)10 = 81.7%

20 bases (0.98)20 = 66.7%

30 bases (0.98)30 = 54.6%

40 bases (0.98)40 = 44.6%

Melting TemperatureMelting Temperature

Oligonucleotide Factors:Oligonucleotide Factors: Primer lengthPrimer length GC content i.e. Overall Sequence GC content i.e. Overall Sequence Sequence order due to stacking forces: Sequence order due to stacking forces:

nearest neighbour analysisnearest neighbour analysis

Reaction Conditions:Reaction Conditions: Salt concentrationSalt concentration Primer concentrationPrimer concentration Presence of additives in reaction;Presence of additives in reaction;

e.g. formamide, DMSO, betaine, glycerole.g. formamide, DMSO, betaine, glycerol

Hyperchromic shift & THyperchromic shift & Tmm

1

1.1

1.2

1.3

1.4

1.5

40 50 60 70 80 90

Temperature (°C)

Rel

ativ

e ab

sorb

ance

at

260n

m

Melting temperature

ssDNA

dsDNA

50% denatured

Experimental determination of DNA melting temperature

1

1.1

1.2

1.3

1.4

1.5

40 50 60 70 80 90

Temperature (°C)

Rel

ativ

e ab

sorb

ance

at

260n

m

Melting Temperature Melting Temperature vsvs

Annealing TemperatureAnnealing Temperature

Melting temperature

ssDNA

dsDNA

Annealingtemperatures

Mismatched bases

Bonding between neighbouring bases is weakened by the mismatch.Therefore, the melting temperature is lowered

Mismatched Bases

General Rules for PCR PrimersGeneral Rules for PCR Primers

Innis & Gelfand 1990Innis & Gelfand 19901.1. Length : 17-28 basesLength : 17-28 bases

2.2. G+C content : 50-60%G+C content : 50-60%

3.3. GC clamp: terminal G, C, GC or CGGC clamp: terminal G, C, GC or CG

4.4. Primer TPrimer Tmm : 55° - 80°C : 55° - 80°C

5.5. Avoid 3’-complementarityAvoid 3’-complementarity

6.6. Avoid internal self-complementarityAvoid internal self-complementarity

7.7. Avoid runs of 3 or more Gs or Cs near endsAvoid runs of 3 or more Gs or Cs near ends

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Steps of PCRSteps of PCR

DENATURATIONDENATURATION PRIMER ANNEALINGPRIMER ANNEALING PRIMER EXTENSION BY POLYMERASEPRIMER EXTENSION BY POLYMERASE2200 to 2 to 211

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

||||||||||||||||||

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

|||||||||||||||||||||

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

||||||||||||||||||

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

||||||||||||||||||

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

|||||||||||||||||||||

21 to 22

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

|||||||||||||||||||||

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

|||||||||||||||||||||

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

|||||||||||||||||||||

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

|||||||||||||||||||||

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

|||||||||||||||||||||

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

|||||||||||||||||||||

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

|||||||||||||||||||||

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

|||||||||||||||||||||22 to 23

5’ 3’

3’ 5’

DNA Denaturation

ssDNA

Complementary strands

Primer annealing

Primer

Template

Annealing & Primer extension

Polymerase

Primer DesignPrimer DesignUsing computers to get primers Using computers to get primers

that will work wellthat will work well

Why use computers?Why use computers?

Comparison of candidate primer sequence with Comparison of candidate primer sequence with repeat sequences from the species of interestrepeat sequences from the species of interest

Nearest-neighbour TNearest-neighbour Tmm calculations calculations

Primer self-complementarity analysisPrimer self-complementarity analysis Identification of potential primer-dimer formationIdentification of potential primer-dimer formation Analysis of large numbers of forward and reverse Analysis of large numbers of forward and reverse

primer combinations to find a pair that fit the primer combinations to find a pair that fit the desired criteria for target sequence, product size, desired criteria for target sequence, product size, primer Tprimer Tmm, etc., etc.

PC based softwarePC based software

Commercial packages:Commercial packages: iOligo iOligo DNA StarDNA Star PCR Help! (free demo)PCR Help! (free demo) Oligo (free demo)Oligo (free demo) Primer Premier (free demo)Primer Premier (free demo)

Free software:Free software: PerlPrimerPerlPrimer OligosOligos GeneTool Lite (no longer supported)GeneTool Lite (no longer supported)

TerminologyTerminology

Template: (genomic DNA or cDNA)

Target: sequence to be included between primers

Forward primer

Reverse primer

Amplicon: resulting PCR product

ANGIS BiomanagerANGIS Biomanager GCG PrimeGCG Prime

Basic selection of oligonucleotide primers for PCR and Basic selection of oligonucleotide primers for PCR and sequencingsequencing

CodeHopCodeHop designs a pool of primers containing all possible 11- or designs a pool of primers containing all possible 11- or

12-mers for the 3' degenerate core region and having 12-mers for the 3' degenerate core region and having the most probable nucleotide predicted for each the most probable nucleotide predicted for each position in the 5' non-degenerate clamp regionposition in the 5' non-degenerate clamp region

Primer3Primer3

““Primer3”Primer3” http://frodo.wi.mit.edu/http://frodo.wi.mit.edu/ Primer3 picks primers for PCR reactions, according Primer3 picks primers for PCR reactions, according

to the conditions specified by the user. to the conditions specified by the user. Primer3 considers things like Primer3 considers things like

melting temperature melting temperature concentrations of various solutions in PCR reactions concentrations of various solutions in PCR reactions primer bending and foldingprimer bending and folding

Can also pick probes according to specified Can also pick probes according to specified parametersparameters

Variants: e.g. PrimerQuest, with graphic outputVariants: e.g. PrimerQuest, with graphic output http://scitools.idtdna.com/Primerquest/http://scitools.idtdna.com/Primerquest/

““Exon Primer”Exon Primer” http://ihg.gsf.de/ihg/ExonPrimer.htmlhttp://ihg.gsf.de/ihg/ExonPrimer.html helps to design intronic primers for the PCR helps to design intronic primers for the PCR

amplification of exons amplification of exons needs a cDNA and the corresponding needs a cDNA and the corresponding

genomic sequence as input genomic sequence as input can avoid primers to be positioned across can avoid primers to be positioned across

SNPs, using genomic sequence where SNPs SNPs, using genomic sequence where SNPs are masked by N’s in input genomic are masked by N’s in input genomic sequencesequence

““Exon Primer”Exon Primer”

Template: genomic DNA

Multiple Targets: gene exons

Multiple Amplicons Overlapping amplicons for large exons

Single amplicon for small exons/introns

SNPs

““CODEHOP”CODEHOP”

http://blocks.fhcrc.org/blocks/codehop.htmlhttp://blocks.fhcrc.org/blocks/codehop.html COCOnsensus-nsensus-DEDEgenerate generate HHybrid ybrid

OOligonucleotide ligonucleotide PPrimers rimers PCR primers designed from protein multiple PCR primers designed from protein multiple

sequence alignments sequence alignments Amino acid alignments must be in Blocks Amino acid alignments must be in Blocks

Database format Database format Intended for cases where the protein Intended for cases where the protein

sequences are distant from each other and sequences are distant from each other and degenerate primers are neededdegenerate primers are needed

““POLAND”POLAND” http://www.biophys.uni-duesseldorf.de/local/POLAND/poland.htmlhttp://www.biophys.uni-duesseldorf.de/local/POLAND/poland.html

Calculates the thermal denaturation profile of Calculates the thermal denaturation profile of double-stranded RNA, DNA or RNA/DNA-double-stranded RNA, DNA or RNA/DNA-hybrids based on sequence input and hybrids based on sequence input and parameter settingsparameter settings

e.g. Sequence: 70 44r CGCCAGCTTGGTCCGAGCTCGGATCCACTAGCTAACGGCCGCCAGTGTGCTGGAATTCGCCCTTACCTGG

PerlPrimerPerlPrimer http://perlprimer.sourceforge.net/http://perlprimer.sourceforge.net/ for downloading for downloading Free open source standaloneFree open source standalone

Runs in Windows, Linux, MacOS Runs in Windows, Linux, MacOS

Features:Features: Calculation of possible primer-dimers Calculation of possible primer-dimers Retrieval of genomic or cDNA sequences from Retrieval of genomic or cDNA sequences from EnsemblEnsembl (including (including

both sequences automatically for Q-PCR) both sequences automatically for Q-PCR) Ability to BLAST search primers using the Ability to BLAST search primers using the NCBINCBI server server Results can be saved or optionally exported in a tab-delimited format Results can be saved or optionally exported in a tab-delimited format

that is compatible with most spreadsheet applications. that is compatible with most spreadsheet applications. ORF and CpG island detection algorithms ORF and CpG island detection algorithms Ability to add cloning sequences to primers, automatically adjusted Ability to add cloning sequences to primers, automatically adjusted

to be in-frame to be in-frame Q-PCR primer design without manual intron-exon boundary entry Q-PCR primer design without manual intron-exon boundary entry

PerlPrimerPerlPrimer

Other ResourcesOther Resources NCBI: NCBI: http://www.ncbi.nlm.nih.govhttp://www.ncbi.nlm.nih.gov

BLASTBLAST EntrezEntrez

Genome Browser @ UCSCGenome Browser @ UCSC http://genome.ucsc.edu/http://genome.ucsc.edu/ Genome BrowserGenome Browser

HumanHuman DogDogDrosophilaDrosophila

MouseMouse ChickenChicken S. S. cerevisiae cerevisiae

RatRat FuguFuguChimpChimp C. elegansC. elegans

In-Silico PCRIn-Silico PCR Blat searchBlat search SNPsSNPs

Special ApplicationsSpecial ApplicationsModified OligonucleotidesModified Oligonucleotides

&&

Special PrimersSpecial Primers

Degenerate PrimersDegenerate Primers

Mixed oligosMixed oligos e.g. actgattc[gc]tgct[atc]e.g. actgattc[gc]tgct[atc] Nucleotides can be in unequal ratiosNucleotides can be in unequal ratios Increased degeneracy means concentration of the Increased degeneracy means concentration of the

individual primers decreasesindividual primers decreases

Deoxyinosine (Deoxyinosine (dIdI)) dIdI at degenerate positions rather than use mixed oligos at degenerate positions rather than use mixed oligos dI dI base-pairs with any other base, effectively giving a base-pairs with any other base, effectively giving a

four-fold degeneracy at any position in the oligo where it four-fold degeneracy at any position in the oligo where it is presentis present

Degeneracies obviously reduce the specificity Degeneracies obviously reduce the specificity

Autosticky PCRAutosticky PCR

““dSpacer” protected tetrahydrofuran dSpacer” protected tetrahydrofuran phosphoramiditephosphoramidite For inclusion of abasic sites in an oligoFor inclusion of abasic sites in an oligo Abasic sites cause stalling of DNA polymerasesAbasic sites cause stalling of DNA polymerases Can therefore be used to create 5’-overhangs in Can therefore be used to create 5’-overhangs in

PCR products; “autosticky-PCR”PCR products; “autosticky-PCR” Overhangs capable of annealing with restriction Overhangs capable of annealing with restriction

enzyme generated 5’-overhangsenzyme generated 5’-overhangs

Chemical 5’-phosphorylation recommendedChemical 5’-phosphorylation recommended

Real Time PCRReal Time PCR

Considerations for primer designConsiderations for primer design Smaller amplicon = higher efficiencySmaller amplicon = higher efficiency

amplicon ideally < 150 bp; maximum 400 bpamplicon ideally < 150 bp; maximum 400 bp

Amplifying gDNA or cDNAAmplifying gDNA or cDNA gDNA: primers that are intron-specific gDNA: primers that are intron-specific cDNA: primers spanning exon-exon boundaries of cDNA: primers spanning exon-exon boundaries of

spliced transcriptspliced transcript

Avoid a 3'-end T as this has a greater tolerance Avoid a 3'-end T as this has a greater tolerance of mismatchof mismatch

Primer length: 18–30 nucleotidesPrimer length: 18–30 nucleotides

Taqman ProbesTaqman Probes Select the probe first and design the primers as Select the probe first and design the primers as

close as possible to the probe without overlapping it close as possible to the probe without overlapping it TTmm should be 68°–70°C should be 68°–70°C No G on the 5´ end No G on the 5´ end Select the strand that gives the probe more C than Select the strand that gives the probe more C than

G bases G bases Avoid runs of an identical nucleotide. This is Avoid runs of an identical nucleotide. This is

especially true for guanine, where runs of four or especially true for guanine, where runs of four or more Gs should be avoidedmore Gs should be avoided

Fluorophore to quencher: optimally 6-14 bases Fluorophore to quencher: optimally 6-14 bases apartapart Internally positioned quencher increases probe sensitivityInternally positioned quencher increases probe sensitivity

SummarySummary

Oligo synthesis services that design Q-PCR Oligo synthesis services that design Q-PCR primers and probes and guarantee themprimers and probes and guarantee them

Many useful commercial programmesMany useful commercial programmes Multiple free tools for designing primersMultiple free tools for designing primers

PerlPrimer (Desktop computer) : simplePerlPrimer (Desktop computer) : simple Primer3 (Web) : highly customisablePrimer3 (Web) : highly customisable CODEHOP (Web) : for degenerate primersCODEHOP (Web) : for degenerate primers

Always check your primer sequence!Always check your primer sequence! Many published primers contain serious errors!Many published primers contain serious errors!

The EndThe End That link again:That link again:http://http://users.bigpond.net.au/albert/primers.htmusers.bigpond.net.au/albert/primers.htm