Distribution of EP4 receptor in different Atlantic salmon(Salmo salar L) tissuesAAA Gamil a T-C Guo a M Koumlnig b Oslash Evensen aa Faculty of Veterinary Medicine and Biosciences Norwegian University of Life Sciences PO Box 8146 Dep 0033 Oslo Norwayb Synaptic Vesicle Dynamics European Neuroscience Institute 37077 Goumlttingen Germany

A R T I C L E I N F O

Article historyReceived 11 July 2014Revised 30 September 2014Accepted 30 September 2014Available online 13 October 2014

KeywordsAtlantic salmon EP4Tissue distributionmRNAImmunohistochemistryImmune organs

A B S T R A C T

Prostaglandin E2 (PGE2) is an important lipid mediator that plays diverse functions in mammals Fourreceptor subtypes of PGE2 designated EP1-4 have been identified to mediate its signaling pathwaysExtensive studies of PGE2 and its receptors have been carried out in mammals but little is known infish including Atlantic salmon In the current study the distribution of Atlantic salmon EP4 receptor indifferent tissues was investigated using RT- and real-time PCR A custom made antibody was used to in-vestigate the distribution of this receptor in different tissues Quantitative analysis by real-time PCR revealedthat the expression was more abundant in the spleen followed by head kidney skin and fin while it wasleast expressed in heart muscles and brain The staining intensity obtained by immunohistochemistrycorrelated with the RT-PCR results EP4 expression was strongly associated with the immune cells in dif-ferent tissues To our knowledge this is the first study to describe the distribution of EP4 receptor inAtlantic salmon tissues Our findings suggest that EP4 may play a role in mediating immune responsesas observed in mammals

copy 2014 The Authors Published by Elsevier Ltd This is an open access article under the CC BY-NC-NDlicense (httpcreativecommonsorglicensesby-nc-nd30)

1 Introduction

Prostaglandins (PGs) are lipid mediators that are produced bynearly all cells in the body They are synthesized from arachidonicacid by the cyclooxygenase (COX) enzymes (Smith 1992) Amongdifferent types of PGs PGE2 is the most abundant with diverse func-tions such as maintaining homeostasis pro- and anti-inflammatoryfunctions (Frolov et al 2013 Nakanishi and Rosenberg 2013 Yaoet al 2009)

PGE2 exerts its functions by binding to different receptors Fourdifferent subtypes of PGE2 receptors are found in mammals and aredesignated as EP1-4 These are G-protein coupled receptors thatbelong to a family of seven rhodopsin-like transmembrane span-ning receptors They are structurally different and share less than35 sequence identity within one species (Sugimoto et al 1993)EP1 and EP4 have relatively long third intracellular loops com-pared to EP2 and EP3 EP4 is characterized by its long intracellulardomain while EP3 is distinguished by the presence of multipleisoforms (Sugimoto et al 1993) The expression and distributionof these receptors vary between different tissues and cell types

(Fennekohl et al 1999 Sugimoto and Narumiya 2007) Function-al differences in the signaling cascade mediated by these receptorshave also been reported In general EP2 and EP4 are considered asstimulatory receptors They induce signaling cascade that leads toincreased levels of cyclic adenosine monophosphate (cAMP) (Fujinoet al 2005) In contrast EP3 is considered as inhibitory receptorand leads to decreased cAMP concentration (Fabre et al 2001) Sig-naling through EP1 receptor on the other hand leads to increasedintracellular calcium concentration (Katoh et al 1995)

The heterogeneity in PGE2 induced effects can partially be ex-plained by the presence of multiple receptors For examplestimulation of gastric acid secretion and smooth muscle relax-ation in the murine gastrointestinal tract were shown to be mediatedby EP4 whereas an opposite effect was mediated by EP3 (Ding et al1997 Okada et al 2000) In mixed lymphocyte response EP2 andto a lesser extent EP4 were found to be responsible for the inhib-itory effect induced by PGE2 while the involvement of EP1 and EP3was ruled out (Nataraj et al 2001) Differences in PGE2 induced effecton the development of colorectal cancer can also be attributed tothe receptor diversity (Hull et al 2004) It is noteworthy howeverthat the functions mediated by the different receptors are not alwaysconserved and can vary between different species (Larsen et al 2005Takeuchi et al 1999)

Knowledge about EP receptors in fish is still developing EP re-ceptors of the zebrafish are the best studied among fish speciesand have only been characterized recently All the four different EP

Corresponding author Norwegian University of Life Sciences Faculty of VeterinaryMedicine and Biosciences PO Box 8146 Dep 0033 Oslo Norway Tel +47 22 5971 06 fax +47 22 96 73 10

E-mail address oysteinevensennmbuno (Oslash Evensen)

httpdxdoiorg101016jdci2014090130145-305Xcopy 2014 The Authors Published by Elsevier Ltd This is an open access article under the CC BY-NC-ND license (httpcreativecommonsorglicensesby-nc-nd30)

Developmental and Comparative Immunology 48 (2015) 143ndash150

Contents lists available at ScienceDirect

Developmental and Comparative Immunology

journal homepage wwwelseviercom locate dc i

subtypes are present in zebrafish and two isoforms of EP2 threeof EP1 and EP4 and five of EP3 were characterized (Iwasaki et al2013 Kwok et al 2012 Tsuge et al 2013) Analysis of the differ-ent zebrafish EP amino acid sequences revealed 40ndash70 sequenceidentity to their human counterparts In all subtypes the seven trans-membrane regions are conserved and most of the differences arein the extra and intracellular loops (Iwasaki et al 2013 Kwok et al2012 Tsuge et al 2013) However the distribution of these recep-tors or their functions in different tissues has not yet been studiedin detail For Atlantic salmon EP4 is the only subtype that has beenidentified so far (Leong et al 2010) Although the genomic se-quence of Atlantic salmon EP4 (asEP4) and its corresponding aminoacid are deposited in the GenBank there is no record of any studythat has been conducted to understand its functional aspects Theaim of the present study was to investigate the distribution of asEP4receptor in different tissues by PCR and immunohistochemistry

2 Materials and methods

21 Fish and sampling

Atlantic salmon pre-smolts were obtained from Soslashr-Smolt AS andkept at the wet lab facility of the Norwegian University of Life Sci-ences (Adamstuen campus) at about 10ndash12 degC and fed withcommercial dry pellets At the time of sampling fish were anes-thetized by an overdose of benzocaine and sacrificed in accordancewith the regulation of the Norwegian Directorate of Fisheries anddifferent tissues were sampled and placed in RNA later (SigmaAldrich) for RNA extraction

22 Tissue specimens

Paraffin embedded tissue sections obtained from normal tissueswere retrieved from the archives of the section of Aquatic Medi-cine Department of basic science and Aquatic Medicine of theNorwegian University of Life sciences For each tissue three or moresections were used for immunohistochemical examination

23 Cell culture

Epithelioma papulosum cyprini (EPC) cells (Fijan et al 1983) weremaintained at 20 degC in L-15 glutamax media (Invitrogen CarlsbadCA USA) supplemented with 10 FBS

24 RNA isolation and cDNA synthesis

RNA was isolated from different Atlantic salmon tissues namelyheart spleen gills head kidney brain intestine kidney muscle liverfin and skin Approximately 30 mg of tissues were placed toEppendorf tubes containing 1 ml ISol-RNA Lysis Reagent (5PrimeGaithersburg MD USA) Tissues were then homogenized inMixer Mill MM301 homogenizer (Retsch Haan Germany) usingstainless steel beads at 20 Hz until well homogenized After ho-

mogenization samples were subjected to phase separation by adding02 ml chloroform The aqueous phase was passed through gDNAcolumn removing genomic DNA followed by RNA isolation usingRNeasy Plus mini kit (Qiagen Hilden Germany) following the ma-nufacturerrsquos instructions The obtained RNA concentration wasdetermined by spectrophotometry using a Nanodrop ND1000(Thermo Scientific Pittsburgh PA USA)

Following RNA isolation 1 μg RNA obtained from each tissue wasused for cDNA synthesis by Transcriptor First Strand cDNA Synthe-sis Kit (Roche Mannheim Germany) using both oligo (dT) andrandom hexamer primers following the manufacturerrsquos protocol

25 Amplification of the full length EP4 receptor

The cDNA obtained from different tissues was diluted 15 and4 μl of each was used for PCR amplification (40 cycles) usingAccustart Taq DNA Polymerase HiFi (Quanta Bioscience GaithersburgMD USA) and 5 pmol forward and reverse primers (Table 1) Thecycling conditions were as follow 94 degC for 30 s 60 degC for 1 min68 degC for 25 min

26 Real time PCR

In order to quantify the expression of EP4 in different tissuescDNA was synthesized from 500 ng total RNA obtained from dif-ferent tissues of seven different fish as described earlier Real-time PCR was performed in 96-well plates using the LightCycler 480system (Roche) Each reaction containing 2μl cDNA was mixed with10 pmol gene specific primers (Table 1) and 10 μl LightCycler 480SYBR green I master mix (Roche) The final volume was adjustedto 20 μl using RNase free water The primers were validated by (1)melting curve analysis (2) presence of a single band when the PCRproducts were electrophoresed in agarose gel and (3) representa-tive PCR products from tissues with high and low EP4 expressionswere sequenced by GATC biotech The cycling (40 cycles) condi-tions for the PCR reactions were as follows 94 degC for 10 s 60 degC for20 s 72 degC for 10 s The relative expression in each tissue was cal-culated by dividing the 2Cp value obtained for β-actin over thoseobtained for EP4 followed by normalization to a calibrator as pre-viously described (Pfaffi 2004)

27 Generation and validation of asEP4 antibodies

To examine the distribution of EP4 proteins in different Atlan-tic salmon tissues a custom made polyclonal antiserumwas used The antibodies were produced commercially byProteogenix (Oberhausbergen France) in a rabbit using the cys-QDQQTQAGKGMQKDPKKGPR peptide To validate the antibodies thefull length EP4 amplified from skin were cloned into pCR21 vectorusing the TOPO TA cloning Kit (Invitrogen) following manufactu-rerrsquos instructions The coding sequence was then amplified usingthe primers with XhoI and SalI restriction sites (Table 1) and sub-sequently cloned into pMAX-FP-GreenC vector (Lonza Basel

Table 1Primers used in the study

Name Sequence Used for Accession no

FL-EP4-ForFL-EP4-Rev

5prime-ACAAAAACACTTCGGATAGTCAAAAACC-3prime5prime-GGGACAAAGTTCACATTGTAGCC-3prime

PCRTA cloning NM_0011739551

As-EP4-ForAs-EP4-Rev

5prime-GGTTGAACTGAAATACACG -3prime5prime-CTGCTAGACTGACATTCC-3prime

Real-time PCR NM_0011739551

Β-actin-ForΒ-actin-Rev

5prime- CCAGTCCTGCTCACTGAGGC-3prime5prime- GGTCTCAAACATGATCTGGGTCA -3prime

Real-time PCR AF012125

XhoI-EP4-ForSalI-EP4-Rev

5prime- ACGCCTCGAGCTTCGGGTATGAATAAC-3prime5prime- ACGCGTCGACTTAGATGCATTTCTCCTG-3prime

Cloning

144 AAA Gamil et alDevelopmental and Comparative Immunology 48 (2015) 143ndash150

Switzerland) in order to be expressed fused to GFP (GFP-EP4)After cloning plasmids were verified by sequencing using GATCbiotech

A total of 1 times 106 EPC cells were transfected with 5 μg of eitherpMAX-FP-GreenC vector or with GFP-EP4 plasmids Transfection wasperformed by electroporation using Neon transfection system(Invitrogen Carlsbad CA USA) with one pulse of 1200 V for 40 msAfter transfection cells were seeded into 24-well plates and keptfor 48 h before being stained by the custom made anti EP4 anti-bodies using indirect fluorescence antibody test (IFAT) Cells werefixed using 4 paraformaldehyde for 10 min and then permeabilizedusing 01 Triton-x100 for 5 min on ice The custom made anti EP4(11000) was added for 1 h at room temperature Alexa Fluor 594goat anti rabbit IgG (Invitrogen Carlsbad CA USA) was added at1400 dilution and incubated at room temperature for 45 min Cellswere counterstained with Hoechst (5 μgml) before being exam-ined under a fluorescence microscope

28 Immunohistochemstry

After deparafinization and dehydration sections of 4 μm thick-ness mounted onto poly-l-lysine-coated slides were blocked for 2h with 5 bovine serum albumin (BSA) in 005 M Tris buffer saline(TBS) pH 76 Slides were then incubated with anti EP4 antibodiesdiluted 11000 in 25 BSA overnight at 4 degC After washing in TBSplus 0025 Triton-x100 (TBST) slides were incubated in biotinylatedsecondary anti rabbit antibody (Dako Glostrup Denmark) diluted1300 in 25 BSA for about 1 h at room temperature The slideswere then washed again and streptavidinndashalkaline phosphatase con-jugate (GE healthcare Piscataway NJ USA) diluted 1100 in 25BSA was added for 30 min The signal was developed by addingfast red substrate (Sigma Aldrich St Louis USA) according tothe protocol described by the manufacturer The reaction wasstopped after 2ndash3 min by washing in tap water and the slides werecounterstained with Mayerrsquos hematoxylin for 3 min and finallymounted in Aquatex (Merck Darmstadt Germany) before visual-ization under the microscope For some of the tissues where signalsaturation was observed the primary antibody dilution was ad-justed to 13000

3 Results

31 Distribution of EP4 receptors in Atlantic salmon tissues by PCR

EP4 receptors were detected by RT-PCR in all investigated tissuesexcept the brain (Fig 1a) However by real-time PCR low expres-sion level (Cp le 35) was detectable in the brain from two fish (datanot shown) The expression levels in different tissues were also quan-tified by real-time PCR (Fig 1b) The most abundant expressions werefound in the spleen followed by the head kidney fin and skin Rel-atively moderate levels of expression were found in the liver andgills and to a lesser extent in the intestine The weakest expres-sion was found in the heart and muscles

32 Validation of anti-asEP4 antibodies

The validity of the anti-asEP4 antibodies was documented bystrong red coloration in EPC cells transfected with EP4-GFP ex-pressing plasmid (Fig 2a red channel) Co-localization with GFPsignal was shown (Fig 2b green channel) The merged picture docu-ments the co-localization in the same cell (Fig 2d) The specificityof the antibodies was further shown by lack of staining EP4 signalin the empty plasmid (expressing only GFP Fig 2e f h) Cell nucleiare visualized by Hoechst counterstain (Fig 2c and g)

33 Distribution of EP4 proteins within different Atlanticsalmon tissues

In general the intensity of staining observed by immunohisto-chemistry correlated with the expression pattern by RT-PCR exceptfor the heart and muscles where no expression was detected Theexpressions in individual tissues were as follows

331 Fin and skinThe expression of EP4 in the skin was only found in the epider-

mis Different patterns of expression were observed between thesections obtained from three different fish In two of them the ex-pression was found to be intense toward the surface and less intensein the intra epidermal cells (Fig 3a and c) In contrast in the thirdfish intense expression was seen in the cytoplasm of intraepidermalcells (Fig 3b and d) A similar pattern of expression was found indorsal fins obtained from the same individuals (Fig 3endashh)

332 GillsThe expression of EP4 was mainly limited to the epithelial lining

of the gill filaments (Fig 4a) In some areas an intense staining wasfound at the base of the filament (Fig 4b)

333 Intestine and pyloric caecaIn the pyloric caeca EP4 expression was found in the lamina

propria and the intraepithelial leukocytes while no expression wasdetected in the epithelial cells (Fig 5a) Positive staining was alsoobserved in the rodlet cells In the individual cells the expressionwas either localized to the cell membrane or diffused in the cyto-plasm of the cells (Fig 5b)

A

B

Fig 1 The expression of asEP4 receptor in different tissues by PCR (a) One micro-gram total RNA isolated from the indicated tissues was used to perform RT-PCR (asdescribed in Section 24) (b) Real-time PCR was performed on cDNA obtained fromseven individuals and the results were calculated by relative expression and nor-malized to calibrator as described in Section 25 Bars show the normalizedvalues plusmn SEM

145AAA Gamil et alDevelopmental and Comparative Immunology 48 (2015) 143ndash150

334 Head kidney and spleenIn the head kidney EP4 was diffusely expressed in the

hematopoeitic tissue (Fig 6a and b) while in the spleen it was foundmainly in the white pulp (Fig 6c and d) Interestingly intense stain-ing was found in the cytoplasm of the splenic melanomacrophages(Fig 6e and f details)

335 LiverThe expression in the liver was mainly associated with the bile

ducts and some monocyte-like cells in the hepatic parenchyma whileno expression was found in the hepatocytes (Fig 7)

4 Discussion

In the present study we have investigated the expression of EP4receptor in different Atlantic salmon tissues by RT-PCR and immu-nohistochemistry To our knowledge this is the first study to reportthe expression of EP4 receptor in Atlantic salmon tissues The se-quence of asEP4 has been published earlier but with no focus onreceptor expression at mRNA or protein level (Leong et al 2010)With an attempt to compare our findings to other species we werenot able to find other studies that have investigated the global EP4expression in different tissues by immunohistochemistry al-though studies that focused on individual tissues are present

The mRNA expression of asEP4 studied by RT-PCR shows thatEP4 is expressed in many different tissues in Atlantic salmon whichis comparable to other species (Sugimoto and Narumiya 2007) al-though some distinct differences are present For example in micethe expression of EP4 receptor was found to be more abundant inthe thymus part of the digestive (ileum) and reproductive (uterus)organs while it was least abundant in spleen and kidney (Sugimotoand Narumiya 2007) However in this study we found that it isstrongly expressed in the immune organs (spleen and head kidney)The difference in tissue expression suggests that differences in func-tionality may also exist Direct comparison between zebrafish andasEP4 is difficult due to the lack of quantitative expression data and

the presence of multiple isoforms in zebrafish compared to only oneidentified so far in Atlantic salmon It is however not unlikely thatAtlantic salmon has other isoforms that are yet to be identifiedAmong the three identified zebrafish EP4 receptors EP4b has asimilar wide tissue distribution as asEP4 while the other two areexclusively expressed in few tissues (Tsuge et al 2013) One of themain differences between the expression patterns of zebrafish EP4band asEP4 is that zebrafish EP4b mRNA was found to be expressedin the brain but could not be detected in the heart by PCR whilethe opposite was found for asEP4 Another observation was that thelevel of expression observed by RT-PCR correlated with the inten-sity of staining observed by immunohistochemistry The onlyexception was heart and muscle where no expression was de-tected by immunohistochemistry This might be due to differencesin detection limit between the two methods or simply due to im-purities in the templates used for RT-PCR

In mammals PGE2 is known to modulate the functions of dif-ferent populations of immune cells (Harizi et al 2003 Ikegami et al2001 Luschnig-Schratl et al 2011 Minakuchi et al 1990) The im-portance of EP4 in mediating these responses has been investigatedUsing RT-PCR and western blot it was shown that EP4 is expressedby B cells T cells eosinophils dendritic cells and macrophages (Hariziet al 2003 Ikegami et al 2001 Mita et al 2002 Nataraj et al2001) It was further shown that EP4 mediates the inhibitory effectinduced by PGE2 on cytokine production by macrophages (Natarajet al 2001) In the present study asEP4 was found to be stronglyexpressed in the spleen and head kidney by RT-PCR Using immu-nohistochemistry asEP4 was found expressed in leukocytic cells inboth organs and interestingly strongly associated with the splenicmelanomacrophages Moreover it was also found in liver monocyte-like cells and in the intra-epithelial leukocytes present in the intestineThese findings suggest that asEP4 might play a role in local immunefunctions as demonstrated in mammals Further studies are re-quired however to demonstrate this

Expression of the EP4 receptor in Atlantic salmon liver was limitedto the bile ducts and intrahepatic monocytes-like cells In rat liver

Fig 2 Validation of anti-EP4 antibodies The coding sequence was cloned into pMAX-FP-GreenC vector (Lonza Basel Switzerland) and overexpressed in EPC cells (a) Stain-ing (red) with anti-asEP4 antibodies (b) GFP-expression (c) Hoechst nuclear staining (d) merge of (a)ndash(c) (e) pMAX-FP-GreenC vector plasmid (no-EP4 sequence) (f) GFP-expression empty vector (g) Hoechst staining (h) merge of (e)ndash(g)

146 AAA Gamil et alDevelopmental and Comparative Immunology 48 (2015) 143ndash150

the expression of EP4 mRNA was detected strongly in the endo-thelial cells while weak or no expression was detected in Kupfferand liver stellate cells (Fennekohl et al 1999) However we did notfind any study that describes the expression of EP4 receptor in

hepatic tissues by immunohistochemistry in other species Whilethe expression of EP4 in the immune cells is well documented theexpression in the bile ducts has not been previously reported al-though EP4 mRNA expression was detected in gall bladder carcinoma

Fig 3 Expression of EP4 receptor in Atlantic salmon skin and fin Skin (AndashD) and fin (EndashH) tissue sections were stained with anti-asEP4 polyclonal antibodies dilutes 11000(b d f h) or 13000 (a c e g) The expression is detected only in the epidermis and is either localized to the surface (a c e g) or to individual intra epidermal cells (b df h) Original magnifications are 200times (a and b endashf) and 400times (cndashd gndashh)

Fig 4 Expression of EP4 receptor in Atlantic salmon gill Gill tissue sections were stained with anti-asEP4 polyclonal antibodies dilutes 11000 (a) or 13000 (b) The ex-pression is exclusively detected only in the epithelial lining of the gill filaments Original magnifications are 100times (a) and 200times (b)

147AAA Gamil et alDevelopmental and Comparative Immunology 48 (2015) 143ndash150

(Asano et al 2002) It is known that PGE2 plays an importantrole in protecting the epithelial lining of the gallbladderfrom the bile salts by stimulating the secretion of mucin ina cAMP dependent manner (Behar 2013 Kuver et al 1994)

The expression of asEP4 in the epithelium of the bile ductssuggests that it may play a role in maintaining the integrityof the bile duct epithelium Other roles cannot be excludedgiven that EP2 has been suggested to play a novel role in PGE2

Fig 5 Expression of EP4 receptor in Atlantic salmon pyloric caeca Sections were stained with anti-asEP4 polyclonal antibodies dilutes 11000 The expression is detectedin the lamina propria and the intra epithelial leukocytes as well as the rodlet cells Original magnifications are 200times (a) and 400times (b)

Fig 6 Expression of EP4 receptor in Atlantic salmon head kidney and spleen Head kidney (a and b) and spleen (cndashf) tissue sections were stained with anti-asEP4 polyclonalantibodies dilutes 11000 The receptor is diffusely expressed in the head kidney hematopoietic tissue while in the spleen it is mainly expressed in the white bulb Note thestrong association between the receptor and the melanomacrophage in the spleen (e and f) Original magnifications are 200times (a and c) 400times (b d e) and 630times (f)

148 AAA Gamil et alDevelopmental and Comparative Immunology 48 (2015) 143ndash150

mediated regulation of glucose metabolism in other fish species(Busby et al 2002)

EP4 receptor is known to mediate the protective effect of PGE2on the respiratory gastrointestinal and glomerular epithelial lining(Aoudjit et al 2006 Kabashima et al 2002 Schmidt et al 2011)In this study the expression of asEP4 in the gills was limited to theepithelial lining suggesting that the EP4 receptor may mediate asimilar protective role In contrast the expression in the pyloric caecawas limited to the intraepithelial leukocytes and no expression wasdetected in the epithelium Our results are in agreement with thefinding of Hult et al who found that the expression of EP4 proteinin human intestine is limited to the lamina propria and the intes-tinal crypts (Hult et al 2011) In humans and mice different patternsof expression are seen across the gastrointestinal tract (Lejeune et al2010 Morimoto et al 1997) Hence the presence of EP4 in otherparts of the gastrointestinal tract in Atlantic salmon should be furtherinvestigated

The expression of EP4 receptor in the skin has previously beeninvestigated in mice (Lee et al 2005 Tober et al 2007) While itis well established that the EP4 receptor can be detected by RT-PCR (Lee et al 2005 Rundhaug et al 2011) contradictory findingshave been reported regarding the expression of EP4 proteins by im-munohistochemistry One study reported that EP4 is undetectable(Lee et al 2005) while another one showed that it can be de-tected in skin epidermal keratinocytes and dermal leukocytes (Toberet al 2007) In the current study asEP4 expression was detectedin Atlantic salmon skin both by RT-PCR and immunohistochemis-try The expression of asEP4 proteins was found to be exclusive tothe epidermis in the examined fish but with different levels and pat-terns The reason behind different levels and patterns of expressionobserved remains unclear It was reported previously that the ex-pression of EP4 receptor in the colon and other EP receptors in theskin become more intense and diffused when it is inflamed or uponexposure to chronic radiation respectively (Lee et al 2005 Lejeuneet al 2010) Since intense and diffuse staining of some mitotic figuresand lymphocytes in some areas in skins were present one possi-ble explanation is that the different patterns of expression observedare due to some ongoing inflammatory process although normalphysiological differences cannot be excluded

Acknowledgement

This research was funded by the Research Council of NorwaySFI-Sea Lice Research Centre grant number 203513

References

Aoudjit L Potapov A Takano T 2006 Prostaglandin E2 promotes cell survival ofglomerular epithelial cells via the EP4 receptor Am J Physiol Renal Physiol 290F1534ndashF1542

Asano T Shoda J Ueda T Kawamoto T Todoroki T Shimonishi M et al 2002Expressions of cyclooxygenase-2 and prostaglandin E-receptors in carcinoma ofthe gallbladder crucial role of arachidonate metabolism in tumor growth andprogression Clin Cancer Res 8 1157ndash1167

Behar J 2013 Physiology and pathophysiology of the biliary tract the gallbladderand sphincter of oddi a review ISRN Physiol 2013 15

Busby ER Cooper GA Mommsen TP 2002 Novel role for prostaglandinE2 in fish hepatocytes regulation of glucose metabolism J Endocrinol 174137ndash146

Ding M Kinoshita Y Kishi K Nakata H Hassan S Kawanami C et al 1997Distribution of prostaglandin E receptors in the rat gastrointestinal tractProstaglandins 53 199ndash216

Fabre JE Nguyen M Athirakul K Coggins K McNeish JD Austin S et al 2001Activation of the murine EP3 receptor for PGE2 inhibits cAMP production andpromotes platelet aggregation J Clin Invest 107 603ndash610

Fennekohl A Schieferdecker HL Jungermann K Puschel GP 1999 Differentialexpression of prostanoid receptors in hepatocytes Kupffer cells sinusoidalendothelial cells and stellate cells of rat liver J Hepatol 30 38ndash47

Fijan N Sulimanovic D Bearzotti M Muzinic D Zwillenberg LO ChilmonczykS et al 1983 Some properties of the epithelioma-papulosum-cyprini (Epc)cell-line from carp cyprinus-carpio Ann Inst Pasteur Vir 134 207ndash220

Frolov A Yang L Dong H Hammock BD Crofford LJ 2013 Anti-inflammatoryproperties of prostaglandin E2 deletion of microsomal prostaglandin Esynthase-1 exacerbates non-immune inflammatory arthritis in miceProstaglandins Leukot Essent Fatty Acids 89 351ndash358

Fujino H Salvi S Regan JW 2005 Differential regulation of phosphorylation ofthe cAMP response element-binding protein after activation of EP2 and EP4prostanoid receptors by prostaglandin E2 Mol Pharmacol 68 251ndash259

Harizi H Grosset C Gualde N 2003 Prostaglandin E2 modulates dendritic cellfunction via EP2 and EP4 receptor subtypes J Leukoc Biol 73 756ndash763

Hull MA Ko SC Hawcroft G 2004 Prostaglandin EP receptors targetsfor treatment and prevention of colorectal cancer Mol Cancer Ther 3 1031ndash1039

Hult LTO Kleiveland CR Fosnes K Jacobsen M Lea T 2011 EP receptorexpression in human intestinal epithelium and localization relative to the stemcell zone of the crypts PLoS ONE 6

Ikegami R Sugimoto Y Segi E Katsuyama M Karahashi H Amano F et al 2001The expression of prostaglandin E receptors EP2 and EP4 and their differentregulation by lipopolysaccharide in C3HHeN peritoneal macrophages J Immunol166 4689ndash4696

Iwasaki R Tsuge K Morimoto K Inazumi T Kawahara O Kawahara A et al2013 Molecular and pharmacological characterization of zebrafish lsquocontractilersquoand lsquoinhibitoryrsquo prostanoid receptors Biochem Biophys Res Commun 438353ndash358

Kabashima K Saji T Murata T Nagamachi M Matsuoka T Segi E et al 2002The prostaglandin receptor EP4 suppresses colitis mucosal damage and CD4 cellactivation in the gut J Clin Invest 109 883ndash893

Katoh H Watabe A Sugimoto Y Ichikawa A Negishi M 1995 Characterizationof the signal transduction of prostaglandin E receptor EP1 subtype in cDNA-transfected Chinese hamster ovary cells Biochim Biophys Acta 1244 41ndash48

Kuver R Savard C Oda D Lee SP 1994 PGE generates intracellular cAMP andaccelerates mucin secretion by cultured dog gallbladder epithelial cells Am JPhysiol 267 G998ndashG1003

Kwok AH Wang Y Leung FC 2012 Molecular characterization of prostaglandinF receptor (FP) and E receptor subtype 3 (EP3) in chickens Gen Comp Endocrinol179 88ndash98

Larsen R Hansen MB Bindslev N 2005 Duodenal secretion in humans mediatedby the EP4 receptor subtype Acta Physiol Scand 185 133ndash140

Lee JL Kim A Kopelovich L Bickers DR Athar M 2005 Differential expressionof E prostanoid receptors in murine and human non-melanoma skin cancer JInvest Dermatol 125 818ndash825

Lejeune M Leung P Beck PL Chadee K 2010 Role of EP4 receptor andprostaglandin transporter in prostaglandin E2-induced alteration in colonicepithelial barrier integrity Am J Physiol Gastrointest Liver Physiol 299G1097ndashG1105

Fig 7 Expression of EP4 receptor in Atlantic salmon liver Liver tissue sections were stained with anti-asEP4 polyclonal antibodies dilutes 11000 The expression is mainlydetected in the epithelial lining of the bile ducts and in the intrahepatic monocyte-like cells Original magnifications are 200times (a) and 400times (b)

149AAA Gamil et alDevelopmental and Comparative Immunology 48 (2015) 143ndash150

Switzerland) in order to be expressed fused to GFP (GFP-EP4)After cloning plasmids were verified by sequencing using GATCbiotech

A total of 1 times 106 EPC cells were transfected with 5 μg of eitherpMAX-FP-GreenC vector or with GFP-EP4 plasmids Transfection wasperformed by electroporation using Neon transfection system(Invitrogen Carlsbad CA USA) with one pulse of 1200 V for 40 msAfter transfection cells were seeded into 24-well plates and keptfor 48 h before being stained by the custom made anti EP4 anti-bodies using indirect fluorescence antibody test (IFAT) Cells werefixed using 4 paraformaldehyde for 10 min and then permeabilizedusing 01 Triton-x100 for 5 min on ice The custom made anti EP4(11000) was added for 1 h at room temperature Alexa Fluor 594goat anti rabbit IgG (Invitrogen Carlsbad CA USA) was added at1400 dilution and incubated at room temperature for 45 min Cellswere counterstained with Hoechst (5 μgml) before being exam-ined under a fluorescence microscope

28 Immunohistochemstry

After deparafinization and dehydration sections of 4 μm thick-ness mounted onto poly-l-lysine-coated slides were blocked for 2h with 5 bovine serum albumin (BSA) in 005 M Tris buffer saline(TBS) pH 76 Slides were then incubated with anti EP4 antibodiesdiluted 11000 in 25 BSA overnight at 4 degC After washing in TBSplus 0025 Triton-x100 (TBST) slides were incubated in biotinylatedsecondary anti rabbit antibody (Dako Glostrup Denmark) diluted1300 in 25 BSA for about 1 h at room temperature The slideswere then washed again and streptavidinndashalkaline phosphatase con-jugate (GE healthcare Piscataway NJ USA) diluted 1100 in 25BSA was added for 30 min The signal was developed by addingfast red substrate (Sigma Aldrich St Louis USA) according tothe protocol described by the manufacturer The reaction wasstopped after 2ndash3 min by washing in tap water and the slides werecounterstained with Mayerrsquos hematoxylin for 3 min and finallymounted in Aquatex (Merck Darmstadt Germany) before visual-ization under the microscope For some of the tissues where signalsaturation was observed the primary antibody dilution was ad-justed to 13000

3 Results

31 Distribution of EP4 receptors in Atlantic salmon tissues by PCR

EP4 receptors were detected by RT-PCR in all investigated tissuesexcept the brain (Fig 1a) However by real-time PCR low expres-sion level (Cp le 35) was detectable in the brain from two fish (datanot shown) The expression levels in different tissues were also quan-tified by real-time PCR (Fig 1b) The most abundant expressions werefound in the spleen followed by the head kidney fin and skin Rel-atively moderate levels of expression were found in the liver andgills and to a lesser extent in the intestine The weakest expres-sion was found in the heart and muscles

32 Validation of anti-asEP4 antibodies

The validity of the anti-asEP4 antibodies was documented bystrong red coloration in EPC cells transfected with EP4-GFP ex-pressing plasmid (Fig 2a red channel) Co-localization with GFPsignal was shown (Fig 2b green channel) The merged picture docu-ments the co-localization in the same cell (Fig 2d) The specificityof the antibodies was further shown by lack of staining EP4 signalin the empty plasmid (expressing only GFP Fig 2e f h) Cell nucleiare visualized by Hoechst counterstain (Fig 2c and g)

33 Distribution of EP4 proteins within different Atlanticsalmon tissues

In general the intensity of staining observed by immunohisto-chemistry correlated with the expression pattern by RT-PCR exceptfor the heart and muscles where no expression was detected Theexpressions in individual tissues were as follows

331 Fin and skinThe expression of EP4 in the skin was only found in the epider-

mis Different patterns of expression were observed between thesections obtained from three different fish In two of them the ex-pression was found to be intense toward the surface and less intensein the intra epidermal cells (Fig 3a and c) In contrast in the thirdfish intense expression was seen in the cytoplasm of intraepidermalcells (Fig 3b and d) A similar pattern of expression was found indorsal fins obtained from the same individuals (Fig 3endashh)

332 GillsThe expression of EP4 was mainly limited to the epithelial lining

of the gill filaments (Fig 4a) In some areas an intense staining wasfound at the base of the filament (Fig 4b)

333 Intestine and pyloric caecaIn the pyloric caeca EP4 expression was found in the lamina

propria and the intraepithelial leukocytes while no expression wasdetected in the epithelial cells (Fig 5a) Positive staining was alsoobserved in the rodlet cells In the individual cells the expressionwas either localized to the cell membrane or diffused in the cyto-plasm of the cells (Fig 5b)

A

B

Fig 1 The expression of asEP4 receptor in different tissues by PCR (a) One micro-gram total RNA isolated from the indicated tissues was used to perform RT-PCR (asdescribed in Section 24) (b) Real-time PCR was performed on cDNA obtained fromseven individuals and the results were calculated by relative expression and nor-malized to calibrator as described in Section 25 Bars show the normalizedvalues plusmn SEM

145AAA Gamil et alDevelopmental and Comparative Immunology 48 (2015) 143ndash150

334 Head kidney and spleenIn the head kidney EP4 was diffusely expressed in the

hematopoeitic tissue (Fig 6a and b) while in the spleen it was foundmainly in the white pulp (Fig 6c and d) Interestingly intense stain-ing was found in the cytoplasm of the splenic melanomacrophages(Fig 6e and f details)

335 LiverThe expression in the liver was mainly associated with the bile

ducts and some monocyte-like cells in the hepatic parenchyma whileno expression was found in the hepatocytes (Fig 7)

4 Discussion

In the present study we have investigated the expression of EP4receptor in different Atlantic salmon tissues by RT-PCR and immu-nohistochemistry To our knowledge this is the first study to reportthe expression of EP4 receptor in Atlantic salmon tissues The se-quence of asEP4 has been published earlier but with no focus onreceptor expression at mRNA or protein level (Leong et al 2010)With an attempt to compare our findings to other species we werenot able to find other studies that have investigated the global EP4expression in different tissues by immunohistochemistry al-though studies that focused on individual tissues are present

The mRNA expression of asEP4 studied by RT-PCR shows thatEP4 is expressed in many different tissues in Atlantic salmon whichis comparable to other species (Sugimoto and Narumiya 2007) al-though some distinct differences are present For example in micethe expression of EP4 receptor was found to be more abundant inthe thymus part of the digestive (ileum) and reproductive (uterus)organs while it was least abundant in spleen and kidney (Sugimotoand Narumiya 2007) However in this study we found that it isstrongly expressed in the immune organs (spleen and head kidney)The difference in tissue expression suggests that differences in func-tionality may also exist Direct comparison between zebrafish andasEP4 is difficult due to the lack of quantitative expression data and

the presence of multiple isoforms in zebrafish compared to only oneidentified so far in Atlantic salmon It is however not unlikely thatAtlantic salmon has other isoforms that are yet to be identifiedAmong the three identified zebrafish EP4 receptors EP4b has asimilar wide tissue distribution as asEP4 while the other two areexclusively expressed in few tissues (Tsuge et al 2013) One of themain differences between the expression patterns of zebrafish EP4band asEP4 is that zebrafish EP4b mRNA was found to be expressedin the brain but could not be detected in the heart by PCR whilethe opposite was found for asEP4 Another observation was that thelevel of expression observed by RT-PCR correlated with the inten-sity of staining observed by immunohistochemistry The onlyexception was heart and muscle where no expression was de-tected by immunohistochemistry This might be due to differencesin detection limit between the two methods or simply due to im-purities in the templates used for RT-PCR

In mammals PGE2 is known to modulate the functions of dif-ferent populations of immune cells (Harizi et al 2003 Ikegami et al2001 Luschnig-Schratl et al 2011 Minakuchi et al 1990) The im-portance of EP4 in mediating these responses has been investigatedUsing RT-PCR and western blot it was shown that EP4 is expressedby B cells T cells eosinophils dendritic cells and macrophages (Hariziet al 2003 Ikegami et al 2001 Mita et al 2002 Nataraj et al2001) It was further shown that EP4 mediates the inhibitory effectinduced by PGE2 on cytokine production by macrophages (Natarajet al 2001) In the present study asEP4 was found to be stronglyexpressed in the spleen and head kidney by RT-PCR Using immu-nohistochemistry asEP4 was found expressed in leukocytic cells inboth organs and interestingly strongly associated with the splenicmelanomacrophages Moreover it was also found in liver monocyte-like cells and in the intra-epithelial leukocytes present in the intestineThese findings suggest that asEP4 might play a role in local immunefunctions as demonstrated in mammals Further studies are re-quired however to demonstrate this

Expression of the EP4 receptor in Atlantic salmon liver was limitedto the bile ducts and intrahepatic monocytes-like cells In rat liver

Fig 2 Validation of anti-EP4 antibodies The coding sequence was cloned into pMAX-FP-GreenC vector (Lonza Basel Switzerland) and overexpressed in EPC cells (a) Stain-ing (red) with anti-asEP4 antibodies (b) GFP-expression (c) Hoechst nuclear staining (d) merge of (a)ndash(c) (e) pMAX-FP-GreenC vector plasmid (no-EP4 sequence) (f) GFP-expression empty vector (g) Hoechst staining (h) merge of (e)ndash(g)

146 AAA Gamil et alDevelopmental and Comparative Immunology 48 (2015) 143ndash150

the expression of EP4 mRNA was detected strongly in the endo-thelial cells while weak or no expression was detected in Kupfferand liver stellate cells (Fennekohl et al 1999) However we did notfind any study that describes the expression of EP4 receptor in

hepatic tissues by immunohistochemistry in other species Whilethe expression of EP4 in the immune cells is well documented theexpression in the bile ducts has not been previously reported al-though EP4 mRNA expression was detected in gall bladder carcinoma

Fig 3 Expression of EP4 receptor in Atlantic salmon skin and fin Skin (AndashD) and fin (EndashH) tissue sections were stained with anti-asEP4 polyclonal antibodies dilutes 11000(b d f h) or 13000 (a c e g) The expression is detected only in the epidermis and is either localized to the surface (a c e g) or to individual intra epidermal cells (b df h) Original magnifications are 200times (a and b endashf) and 400times (cndashd gndashh)

Fig 4 Expression of EP4 receptor in Atlantic salmon gill Gill tissue sections were stained with anti-asEP4 polyclonal antibodies dilutes 11000 (a) or 13000 (b) The ex-pression is exclusively detected only in the epithelial lining of the gill filaments Original magnifications are 100times (a) and 200times (b)

147AAA Gamil et alDevelopmental and Comparative Immunology 48 (2015) 143ndash150

(Asano et al 2002) It is known that PGE2 plays an importantrole in protecting the epithelial lining of the gallbladderfrom the bile salts by stimulating the secretion of mucin ina cAMP dependent manner (Behar 2013 Kuver et al 1994)

The expression of asEP4 in the epithelium of the bile ductssuggests that it may play a role in maintaining the integrityof the bile duct epithelium Other roles cannot be excludedgiven that EP2 has been suggested to play a novel role in PGE2

Fig 5 Expression of EP4 receptor in Atlantic salmon pyloric caeca Sections were stained with anti-asEP4 polyclonal antibodies dilutes 11000 The expression is detectedin the lamina propria and the intra epithelial leukocytes as well as the rodlet cells Original magnifications are 200times (a) and 400times (b)

Fig 6 Expression of EP4 receptor in Atlantic salmon head kidney and spleen Head kidney (a and b) and spleen (cndashf) tissue sections were stained with anti-asEP4 polyclonalantibodies dilutes 11000 The receptor is diffusely expressed in the head kidney hematopoietic tissue while in the spleen it is mainly expressed in the white bulb Note thestrong association between the receptor and the melanomacrophage in the spleen (e and f) Original magnifications are 200times (a and c) 400times (b d e) and 630times (f)

148 AAA Gamil et alDevelopmental and Comparative Immunology 48 (2015) 143ndash150

mediated regulation of glucose metabolism in other fish species(Busby et al 2002)

EP4 receptor is known to mediate the protective effect of PGE2on the respiratory gastrointestinal and glomerular epithelial lining(Aoudjit et al 2006 Kabashima et al 2002 Schmidt et al 2011)In this study the expression of asEP4 in the gills was limited to theepithelial lining suggesting that the EP4 receptor may mediate asimilar protective role In contrast the expression in the pyloric caecawas limited to the intraepithelial leukocytes and no expression wasdetected in the epithelium Our results are in agreement with thefinding of Hult et al who found that the expression of EP4 proteinin human intestine is limited to the lamina propria and the intes-tinal crypts (Hult et al 2011) In humans and mice different patternsof expression are seen across the gastrointestinal tract (Lejeune et al2010 Morimoto et al 1997) Hence the presence of EP4 in otherparts of the gastrointestinal tract in Atlantic salmon should be furtherinvestigated

The expression of EP4 receptor in the skin has previously beeninvestigated in mice (Lee et al 2005 Tober et al 2007) While itis well established that the EP4 receptor can be detected by RT-PCR (Lee et al 2005 Rundhaug et al 2011) contradictory findingshave been reported regarding the expression of EP4 proteins by im-munohistochemistry One study reported that EP4 is undetectable(Lee et al 2005) while another one showed that it can be de-tected in skin epidermal keratinocytes and dermal leukocytes (Toberet al 2007) In the current study asEP4 expression was detectedin Atlantic salmon skin both by RT-PCR and immunohistochemis-try The expression of asEP4 proteins was found to be exclusive tothe epidermis in the examined fish but with different levels and pat-terns The reason behind different levels and patterns of expressionobserved remains unclear It was reported previously that the ex-pression of EP4 receptor in the colon and other EP receptors in theskin become more intense and diffused when it is inflamed or uponexposure to chronic radiation respectively (Lee et al 2005 Lejeuneet al 2010) Since intense and diffuse staining of some mitotic figuresand lymphocytes in some areas in skins were present one possi-ble explanation is that the different patterns of expression observedare due to some ongoing inflammatory process although normalphysiological differences cannot be excluded

Acknowledgement

This research was funded by the Research Council of NorwaySFI-Sea Lice Research Centre grant number 203513

References

Aoudjit L Potapov A Takano T 2006 Prostaglandin E2 promotes cell survival ofglomerular epithelial cells via the EP4 receptor Am J Physiol Renal Physiol 290F1534ndashF1542

Asano T Shoda J Ueda T Kawamoto T Todoroki T Shimonishi M et al 2002Expressions of cyclooxygenase-2 and prostaglandin E-receptors in carcinoma ofthe gallbladder crucial role of arachidonate metabolism in tumor growth andprogression Clin Cancer Res 8 1157ndash1167

Behar J 2013 Physiology and pathophysiology of the biliary tract the gallbladderand sphincter of oddi a review ISRN Physiol 2013 15

Busby ER Cooper GA Mommsen TP 2002 Novel role for prostaglandinE2 in fish hepatocytes regulation of glucose metabolism J Endocrinol 174137ndash146

Ding M Kinoshita Y Kishi K Nakata H Hassan S Kawanami C et al 1997Distribution of prostaglandin E receptors in the rat gastrointestinal tractProstaglandins 53 199ndash216

Fabre JE Nguyen M Athirakul K Coggins K McNeish JD Austin S et al 2001Activation of the murine EP3 receptor for PGE2 inhibits cAMP production andpromotes platelet aggregation J Clin Invest 107 603ndash610

Fennekohl A Schieferdecker HL Jungermann K Puschel GP 1999 Differentialexpression of prostanoid receptors in hepatocytes Kupffer cells sinusoidalendothelial cells and stellate cells of rat liver J Hepatol 30 38ndash47

Fijan N Sulimanovic D Bearzotti M Muzinic D Zwillenberg LO ChilmonczykS et al 1983 Some properties of the epithelioma-papulosum-cyprini (Epc)cell-line from carp cyprinus-carpio Ann Inst Pasteur Vir 134 207ndash220

Frolov A Yang L Dong H Hammock BD Crofford LJ 2013 Anti-inflammatoryproperties of prostaglandin E2 deletion of microsomal prostaglandin Esynthase-1 exacerbates non-immune inflammatory arthritis in miceProstaglandins Leukot Essent Fatty Acids 89 351ndash358

Fujino H Salvi S Regan JW 2005 Differential regulation of phosphorylation ofthe cAMP response element-binding protein after activation of EP2 and EP4prostanoid receptors by prostaglandin E2 Mol Pharmacol 68 251ndash259

Harizi H Grosset C Gualde N 2003 Prostaglandin E2 modulates dendritic cellfunction via EP2 and EP4 receptor subtypes J Leukoc Biol 73 756ndash763

Hull MA Ko SC Hawcroft G 2004 Prostaglandin EP receptors targetsfor treatment and prevention of colorectal cancer Mol Cancer Ther 3 1031ndash1039

Hult LTO Kleiveland CR Fosnes K Jacobsen M Lea T 2011 EP receptorexpression in human intestinal epithelium and localization relative to the stemcell zone of the crypts PLoS ONE 6

Ikegami R Sugimoto Y Segi E Katsuyama M Karahashi H Amano F et al 2001The expression of prostaglandin E receptors EP2 and EP4 and their differentregulation by lipopolysaccharide in C3HHeN peritoneal macrophages J Immunol166 4689ndash4696

Iwasaki R Tsuge K Morimoto K Inazumi T Kawahara O Kawahara A et al2013 Molecular and pharmacological characterization of zebrafish lsquocontractilersquoand lsquoinhibitoryrsquo prostanoid receptors Biochem Biophys Res Commun 438353ndash358

Kabashima K Saji T Murata T Nagamachi M Matsuoka T Segi E et al 2002The prostaglandin receptor EP4 suppresses colitis mucosal damage and CD4 cellactivation in the gut J Clin Invest 109 883ndash893

Katoh H Watabe A Sugimoto Y Ichikawa A Negishi M 1995 Characterizationof the signal transduction of prostaglandin E receptor EP1 subtype in cDNA-transfected Chinese hamster ovary cells Biochim Biophys Acta 1244 41ndash48

Kuver R Savard C Oda D Lee SP 1994 PGE generates intracellular cAMP andaccelerates mucin secretion by cultured dog gallbladder epithelial cells Am JPhysiol 267 G998ndashG1003

Kwok AH Wang Y Leung FC 2012 Molecular characterization of prostaglandinF receptor (FP) and E receptor subtype 3 (EP3) in chickens Gen Comp Endocrinol179 88ndash98

Larsen R Hansen MB Bindslev N 2005 Duodenal secretion in humans mediatedby the EP4 receptor subtype Acta Physiol Scand 185 133ndash140

Lee JL Kim A Kopelovich L Bickers DR Athar M 2005 Differential expressionof E prostanoid receptors in murine and human non-melanoma skin cancer JInvest Dermatol 125 818ndash825

Lejeune M Leung P Beck PL Chadee K 2010 Role of EP4 receptor andprostaglandin transporter in prostaglandin E2-induced alteration in colonicepithelial barrier integrity Am J Physiol Gastrointest Liver Physiol 299G1097ndashG1105

Fig 7 Expression of EP4 receptor in Atlantic salmon liver Liver tissue sections were stained with anti-asEP4 polyclonal antibodies dilutes 11000 The expression is mainlydetected in the epithelial lining of the bile ducts and in the intrahepatic monocyte-like cells Original magnifications are 200times (a) and 400times (b)

149AAA Gamil et alDevelopmental and Comparative Immunology 48 (2015) 143ndash150

334 Head kidney and spleenIn the head kidney EP4 was diffusely expressed in the

hematopoeitic tissue (Fig 6a and b) while in the spleen it was foundmainly in the white pulp (Fig 6c and d) Interestingly intense stain-ing was found in the cytoplasm of the splenic melanomacrophages(Fig 6e and f details)

335 LiverThe expression in the liver was mainly associated with the bile

ducts and some monocyte-like cells in the hepatic parenchyma whileno expression was found in the hepatocytes (Fig 7)

4 Discussion

In the present study we have investigated the expression of EP4receptor in different Atlantic salmon tissues by RT-PCR and immu-nohistochemistry To our knowledge this is the first study to reportthe expression of EP4 receptor in Atlantic salmon tissues The se-quence of asEP4 has been published earlier but with no focus onreceptor expression at mRNA or protein level (Leong et al 2010)With an attempt to compare our findings to other species we werenot able to find other studies that have investigated the global EP4expression in different tissues by immunohistochemistry al-though studies that focused on individual tissues are present

The mRNA expression of asEP4 studied by RT-PCR shows thatEP4 is expressed in many different tissues in Atlantic salmon whichis comparable to other species (Sugimoto and Narumiya 2007) al-though some distinct differences are present For example in micethe expression of EP4 receptor was found to be more abundant inthe thymus part of the digestive (ileum) and reproductive (uterus)organs while it was least abundant in spleen and kidney (Sugimotoand Narumiya 2007) However in this study we found that it isstrongly expressed in the immune organs (spleen and head kidney)The difference in tissue expression suggests that differences in func-tionality may also exist Direct comparison between zebrafish andasEP4 is difficult due to the lack of quantitative expression data and

the presence of multiple isoforms in zebrafish compared to only oneidentified so far in Atlantic salmon It is however not unlikely thatAtlantic salmon has other isoforms that are yet to be identifiedAmong the three identified zebrafish EP4 receptors EP4b has asimilar wide tissue distribution as asEP4 while the other two areexclusively expressed in few tissues (Tsuge et al 2013) One of themain differences between the expression patterns of zebrafish EP4band asEP4 is that zebrafish EP4b mRNA was found to be expressedin the brain but could not be detected in the heart by PCR whilethe opposite was found for asEP4 Another observation was that thelevel of expression observed by RT-PCR correlated with the inten-sity of staining observed by immunohistochemistry The onlyexception was heart and muscle where no expression was de-tected by immunohistochemistry This might be due to differencesin detection limit between the two methods or simply due to im-purities in the templates used for RT-PCR

In mammals PGE2 is known to modulate the functions of dif-ferent populations of immune cells (Harizi et al 2003 Ikegami et al2001 Luschnig-Schratl et al 2011 Minakuchi et al 1990) The im-portance of EP4 in mediating these responses has been investigatedUsing RT-PCR and western blot it was shown that EP4 is expressedby B cells T cells eosinophils dendritic cells and macrophages (Hariziet al 2003 Ikegami et al 2001 Mita et al 2002 Nataraj et al2001) It was further shown that EP4 mediates the inhibitory effectinduced by PGE2 on cytokine production by macrophages (Natarajet al 2001) In the present study asEP4 was found to be stronglyexpressed in the spleen and head kidney by RT-PCR Using immu-nohistochemistry asEP4 was found expressed in leukocytic cells inboth organs and interestingly strongly associated with the splenicmelanomacrophages Moreover it was also found in liver monocyte-like cells and in the intra-epithelial leukocytes present in the intestineThese findings suggest that asEP4 might play a role in local immunefunctions as demonstrated in mammals Further studies are re-quired however to demonstrate this

Expression of the EP4 receptor in Atlantic salmon liver was limitedto the bile ducts and intrahepatic monocytes-like cells In rat liver

Fig 2 Validation of anti-EP4 antibodies The coding sequence was cloned into pMAX-FP-GreenC vector (Lonza Basel Switzerland) and overexpressed in EPC cells (a) Stain-ing (red) with anti-asEP4 antibodies (b) GFP-expression (c) Hoechst nuclear staining (d) merge of (a)ndash(c) (e) pMAX-FP-GreenC vector plasmid (no-EP4 sequence) (f) GFP-expression empty vector (g) Hoechst staining (h) merge of (e)ndash(g)

146 AAA Gamil et alDevelopmental and Comparative Immunology 48 (2015) 143ndash150

the expression of EP4 mRNA was detected strongly in the endo-thelial cells while weak or no expression was detected in Kupfferand liver stellate cells (Fennekohl et al 1999) However we did notfind any study that describes the expression of EP4 receptor in

hepatic tissues by immunohistochemistry in other species Whilethe expression of EP4 in the immune cells is well documented theexpression in the bile ducts has not been previously reported al-though EP4 mRNA expression was detected in gall bladder carcinoma

Fig 3 Expression of EP4 receptor in Atlantic salmon skin and fin Skin (AndashD) and fin (EndashH) tissue sections were stained with anti-asEP4 polyclonal antibodies dilutes 11000(b d f h) or 13000 (a c e g) The expression is detected only in the epidermis and is either localized to the surface (a c e g) or to individual intra epidermal cells (b df h) Original magnifications are 200times (a and b endashf) and 400times (cndashd gndashh)

Fig 4 Expression of EP4 receptor in Atlantic salmon gill Gill tissue sections were stained with anti-asEP4 polyclonal antibodies dilutes 11000 (a) or 13000 (b) The ex-pression is exclusively detected only in the epithelial lining of the gill filaments Original magnifications are 100times (a) and 200times (b)

147AAA Gamil et alDevelopmental and Comparative Immunology 48 (2015) 143ndash150

(Asano et al 2002) It is known that PGE2 plays an importantrole in protecting the epithelial lining of the gallbladderfrom the bile salts by stimulating the secretion of mucin ina cAMP dependent manner (Behar 2013 Kuver et al 1994)

The expression of asEP4 in the epithelium of the bile ductssuggests that it may play a role in maintaining the integrityof the bile duct epithelium Other roles cannot be excludedgiven that EP2 has been suggested to play a novel role in PGE2

Fig 5 Expression of EP4 receptor in Atlantic salmon pyloric caeca Sections were stained with anti-asEP4 polyclonal antibodies dilutes 11000 The expression is detectedin the lamina propria and the intra epithelial leukocytes as well as the rodlet cells Original magnifications are 200times (a) and 400times (b)

Fig 6 Expression of EP4 receptor in Atlantic salmon head kidney and spleen Head kidney (a and b) and spleen (cndashf) tissue sections were stained with anti-asEP4 polyclonalantibodies dilutes 11000 The receptor is diffusely expressed in the head kidney hematopoietic tissue while in the spleen it is mainly expressed in the white bulb Note thestrong association between the receptor and the melanomacrophage in the spleen (e and f) Original magnifications are 200times (a and c) 400times (b d e) and 630times (f)

148 AAA Gamil et alDevelopmental and Comparative Immunology 48 (2015) 143ndash150

mediated regulation of glucose metabolism in other fish species(Busby et al 2002)

EP4 receptor is known to mediate the protective effect of PGE2on the respiratory gastrointestinal and glomerular epithelial lining(Aoudjit et al 2006 Kabashima et al 2002 Schmidt et al 2011)In this study the expression of asEP4 in the gills was limited to theepithelial lining suggesting that the EP4 receptor may mediate asimilar protective role In contrast the expression in the pyloric caecawas limited to the intraepithelial leukocytes and no expression wasdetected in the epithelium Our results are in agreement with thefinding of Hult et al who found that the expression of EP4 proteinin human intestine is limited to the lamina propria and the intes-tinal crypts (Hult et al 2011) In humans and mice different patternsof expression are seen across the gastrointestinal tract (Lejeune et al2010 Morimoto et al 1997) Hence the presence of EP4 in otherparts of the gastrointestinal tract in Atlantic salmon should be furtherinvestigated

The expression of EP4 receptor in the skin has previously beeninvestigated in mice (Lee et al 2005 Tober et al 2007) While itis well established that the EP4 receptor can be detected by RT-PCR (Lee et al 2005 Rundhaug et al 2011) contradictory findingshave been reported regarding the expression of EP4 proteins by im-munohistochemistry One study reported that EP4 is undetectable(Lee et al 2005) while another one showed that it can be de-tected in skin epidermal keratinocytes and dermal leukocytes (Toberet al 2007) In the current study asEP4 expression was detectedin Atlantic salmon skin both by RT-PCR and immunohistochemis-try The expression of asEP4 proteins was found to be exclusive tothe epidermis in the examined fish but with different levels and pat-terns The reason behind different levels and patterns of expressionobserved remains unclear It was reported previously that the ex-pression of EP4 receptor in the colon and other EP receptors in theskin become more intense and diffused when it is inflamed or uponexposure to chronic radiation respectively (Lee et al 2005 Lejeuneet al 2010) Since intense and diffuse staining of some mitotic figuresand lymphocytes in some areas in skins were present one possi-ble explanation is that the different patterns of expression observedare due to some ongoing inflammatory process although normalphysiological differences cannot be excluded

Acknowledgement

This research was funded by the Research Council of NorwaySFI-Sea Lice Research Centre grant number 203513

References

Aoudjit L Potapov A Takano T 2006 Prostaglandin E2 promotes cell survival ofglomerular epithelial cells via the EP4 receptor Am J Physiol Renal Physiol 290F1534ndashF1542

Asano T Shoda J Ueda T Kawamoto T Todoroki T Shimonishi M et al 2002Expressions of cyclooxygenase-2 and prostaglandin E-receptors in carcinoma ofthe gallbladder crucial role of arachidonate metabolism in tumor growth andprogression Clin Cancer Res 8 1157ndash1167

Behar J 2013 Physiology and pathophysiology of the biliary tract the gallbladderand sphincter of oddi a review ISRN Physiol 2013 15

Busby ER Cooper GA Mommsen TP 2002 Novel role for prostaglandinE2 in fish hepatocytes regulation of glucose metabolism J Endocrinol 174137ndash146

Ding M Kinoshita Y Kishi K Nakata H Hassan S Kawanami C et al 1997Distribution of prostaglandin E receptors in the rat gastrointestinal tractProstaglandins 53 199ndash216

Fabre JE Nguyen M Athirakul K Coggins K McNeish JD Austin S et al 2001Activation of the murine EP3 receptor for PGE2 inhibits cAMP production andpromotes platelet aggregation J Clin Invest 107 603ndash610

Fennekohl A Schieferdecker HL Jungermann K Puschel GP 1999 Differentialexpression of prostanoid receptors in hepatocytes Kupffer cells sinusoidalendothelial cells and stellate cells of rat liver J Hepatol 30 38ndash47

Fijan N Sulimanovic D Bearzotti M Muzinic D Zwillenberg LO ChilmonczykS et al 1983 Some properties of the epithelioma-papulosum-cyprini (Epc)cell-line from carp cyprinus-carpio Ann Inst Pasteur Vir 134 207ndash220

Frolov A Yang L Dong H Hammock BD Crofford LJ 2013 Anti-inflammatoryproperties of prostaglandin E2 deletion of microsomal prostaglandin Esynthase-1 exacerbates non-immune inflammatory arthritis in miceProstaglandins Leukot Essent Fatty Acids 89 351ndash358

Fujino H Salvi S Regan JW 2005 Differential regulation of phosphorylation ofthe cAMP response element-binding protein after activation of EP2 and EP4prostanoid receptors by prostaglandin E2 Mol Pharmacol 68 251ndash259

Harizi H Grosset C Gualde N 2003 Prostaglandin E2 modulates dendritic cellfunction via EP2 and EP4 receptor subtypes J Leukoc Biol 73 756ndash763

Hull MA Ko SC Hawcroft G 2004 Prostaglandin EP receptors targetsfor treatment and prevention of colorectal cancer Mol Cancer Ther 3 1031ndash1039

Hult LTO Kleiveland CR Fosnes K Jacobsen M Lea T 2011 EP receptorexpression in human intestinal epithelium and localization relative to the stemcell zone of the crypts PLoS ONE 6

Ikegami R Sugimoto Y Segi E Katsuyama M Karahashi H Amano F et al 2001The expression of prostaglandin E receptors EP2 and EP4 and their differentregulation by lipopolysaccharide in C3HHeN peritoneal macrophages J Immunol166 4689ndash4696

Iwasaki R Tsuge K Morimoto K Inazumi T Kawahara O Kawahara A et al2013 Molecular and pharmacological characterization of zebrafish lsquocontractilersquoand lsquoinhibitoryrsquo prostanoid receptors Biochem Biophys Res Commun 438353ndash358

Kabashima K Saji T Murata T Nagamachi M Matsuoka T Segi E et al 2002The prostaglandin receptor EP4 suppresses colitis mucosal damage and CD4 cellactivation in the gut J Clin Invest 109 883ndash893

Katoh H Watabe A Sugimoto Y Ichikawa A Negishi M 1995 Characterizationof the signal transduction of prostaglandin E receptor EP1 subtype in cDNA-transfected Chinese hamster ovary cells Biochim Biophys Acta 1244 41ndash48

Kuver R Savard C Oda D Lee SP 1994 PGE generates intracellular cAMP andaccelerates mucin secretion by cultured dog gallbladder epithelial cells Am JPhysiol 267 G998ndashG1003

Kwok AH Wang Y Leung FC 2012 Molecular characterization of prostaglandinF receptor (FP) and E receptor subtype 3 (EP3) in chickens Gen Comp Endocrinol179 88ndash98

Larsen R Hansen MB Bindslev N 2005 Duodenal secretion in humans mediatedby the EP4 receptor subtype Acta Physiol Scand 185 133ndash140

Lee JL Kim A Kopelovich L Bickers DR Athar M 2005 Differential expressionof E prostanoid receptors in murine and human non-melanoma skin cancer JInvest Dermatol 125 818ndash825

Lejeune M Leung P Beck PL Chadee K 2010 Role of EP4 receptor andprostaglandin transporter in prostaglandin E2-induced alteration in colonicepithelial barrier integrity Am J Physiol Gastrointest Liver Physiol 299G1097ndashG1105

Fig 7 Expression of EP4 receptor in Atlantic salmon liver Liver tissue sections were stained with anti-asEP4 polyclonal antibodies dilutes 11000 The expression is mainlydetected in the epithelial lining of the bile ducts and in the intrahepatic monocyte-like cells Original magnifications are 200times (a) and 400times (b)

149AAA Gamil et alDevelopmental and Comparative Immunology 48 (2015) 143ndash150

the expression of EP4 mRNA was detected strongly in the endo-thelial cells while weak or no expression was detected in Kupfferand liver stellate cells (Fennekohl et al 1999) However we did notfind any study that describes the expression of EP4 receptor in

hepatic tissues by immunohistochemistry in other species Whilethe expression of EP4 in the immune cells is well documented theexpression in the bile ducts has not been previously reported al-though EP4 mRNA expression was detected in gall bladder carcinoma

Fig 3 Expression of EP4 receptor in Atlantic salmon skin and fin Skin (AndashD) and fin (EndashH) tissue sections were stained with anti-asEP4 polyclonal antibodies dilutes 11000(b d f h) or 13000 (a c e g) The expression is detected only in the epidermis and is either localized to the surface (a c e g) or to individual intra epidermal cells (b df h) Original magnifications are 200times (a and b endashf) and 400times (cndashd gndashh)

Fig 4 Expression of EP4 receptor in Atlantic salmon gill Gill tissue sections were stained with anti-asEP4 polyclonal antibodies dilutes 11000 (a) or 13000 (b) The ex-pression is exclusively detected only in the epithelial lining of the gill filaments Original magnifications are 100times (a) and 200times (b)

147AAA Gamil et alDevelopmental and Comparative Immunology 48 (2015) 143ndash150

(Asano et al 2002) It is known that PGE2 plays an importantrole in protecting the epithelial lining of the gallbladderfrom the bile salts by stimulating the secretion of mucin ina cAMP dependent manner (Behar 2013 Kuver et al 1994)

The expression of asEP4 in the epithelium of the bile ductssuggests that it may play a role in maintaining the integrityof the bile duct epithelium Other roles cannot be excludedgiven that EP2 has been suggested to play a novel role in PGE2

Fig 5 Expression of EP4 receptor in Atlantic salmon pyloric caeca Sections were stained with anti-asEP4 polyclonal antibodies dilutes 11000 The expression is detectedin the lamina propria and the intra epithelial leukocytes as well as the rodlet cells Original magnifications are 200times (a) and 400times (b)

Fig 6 Expression of EP4 receptor in Atlantic salmon head kidney and spleen Head kidney (a and b) and spleen (cndashf) tissue sections were stained with anti-asEP4 polyclonalantibodies dilutes 11000 The receptor is diffusely expressed in the head kidney hematopoietic tissue while in the spleen it is mainly expressed in the white bulb Note thestrong association between the receptor and the melanomacrophage in the spleen (e and f) Original magnifications are 200times (a and c) 400times (b d e) and 630times (f)

148 AAA Gamil et alDevelopmental and Comparative Immunology 48 (2015) 143ndash150

mediated regulation of glucose metabolism in other fish species(Busby et al 2002)

EP4 receptor is known to mediate the protective effect of PGE2on the respiratory gastrointestinal and glomerular epithelial lining(Aoudjit et al 2006 Kabashima et al 2002 Schmidt et al 2011)In this study the expression of asEP4 in the gills was limited to theepithelial lining suggesting that the EP4 receptor may mediate asimilar protective role In contrast the expression in the pyloric caecawas limited to the intraepithelial leukocytes and no expression wasdetected in the epithelium Our results are in agreement with thefinding of Hult et al who found that the expression of EP4 proteinin human intestine is limited to the lamina propria and the intes-tinal crypts (Hult et al 2011) In humans and mice different patternsof expression are seen across the gastrointestinal tract (Lejeune et al2010 Morimoto et al 1997) Hence the presence of EP4 in otherparts of the gastrointestinal tract in Atlantic salmon should be furtherinvestigated

The expression of EP4 receptor in the skin has previously beeninvestigated in mice (Lee et al 2005 Tober et al 2007) While itis well established that the EP4 receptor can be detected by RT-PCR (Lee et al 2005 Rundhaug et al 2011) contradictory findingshave been reported regarding the expression of EP4 proteins by im-munohistochemistry One study reported that EP4 is undetectable(Lee et al 2005) while another one showed that it can be de-tected in skin epidermal keratinocytes and dermal leukocytes (Toberet al 2007) In the current study asEP4 expression was detectedin Atlantic salmon skin both by RT-PCR and immunohistochemis-try The expression of asEP4 proteins was found to be exclusive tothe epidermis in the examined fish but with different levels and pat-terns The reason behind different levels and patterns of expressionobserved remains unclear It was reported previously that the ex-pression of EP4 receptor in the colon and other EP receptors in theskin become more intense and diffused when it is inflamed or uponexposure to chronic radiation respectively (Lee et al 2005 Lejeuneet al 2010) Since intense and diffuse staining of some mitotic figuresand lymphocytes in some areas in skins were present one possi-ble explanation is that the different patterns of expression observedare due to some ongoing inflammatory process although normalphysiological differences cannot be excluded

Acknowledgement

This research was funded by the Research Council of NorwaySFI-Sea Lice Research Centre grant number 203513

References

Aoudjit L Potapov A Takano T 2006 Prostaglandin E2 promotes cell survival ofglomerular epithelial cells via the EP4 receptor Am J Physiol Renal Physiol 290F1534ndashF1542

Asano T Shoda J Ueda T Kawamoto T Todoroki T Shimonishi M et al 2002Expressions of cyclooxygenase-2 and prostaglandin E-receptors in carcinoma ofthe gallbladder crucial role of arachidonate metabolism in tumor growth andprogression Clin Cancer Res 8 1157ndash1167

Behar J 2013 Physiology and pathophysiology of the biliary tract the gallbladderand sphincter of oddi a review ISRN Physiol 2013 15

Busby ER Cooper GA Mommsen TP 2002 Novel role for prostaglandinE2 in fish hepatocytes regulation of glucose metabolism J Endocrinol 174137ndash146

Ding M Kinoshita Y Kishi K Nakata H Hassan S Kawanami C et al 1997Distribution of prostaglandin E receptors in the rat gastrointestinal tractProstaglandins 53 199ndash216

Fabre JE Nguyen M Athirakul K Coggins K McNeish JD Austin S et al 2001Activation of the murine EP3 receptor for PGE2 inhibits cAMP production andpromotes platelet aggregation J Clin Invest 107 603ndash610

Fennekohl A Schieferdecker HL Jungermann K Puschel GP 1999 Differentialexpression of prostanoid receptors in hepatocytes Kupffer cells sinusoidalendothelial cells and stellate cells of rat liver J Hepatol 30 38ndash47

Fijan N Sulimanovic D Bearzotti M Muzinic D Zwillenberg LO ChilmonczykS et al 1983 Some properties of the epithelioma-papulosum-cyprini (Epc)cell-line from carp cyprinus-carpio Ann Inst Pasteur Vir 134 207ndash220

Frolov A Yang L Dong H Hammock BD Crofford LJ 2013 Anti-inflammatoryproperties of prostaglandin E2 deletion of microsomal prostaglandin Esynthase-1 exacerbates non-immune inflammatory arthritis in miceProstaglandins Leukot Essent Fatty Acids 89 351ndash358

Fujino H Salvi S Regan JW 2005 Differential regulation of phosphorylation ofthe cAMP response element-binding protein after activation of EP2 and EP4prostanoid receptors by prostaglandin E2 Mol Pharmacol 68 251ndash259

Harizi H Grosset C Gualde N 2003 Prostaglandin E2 modulates dendritic cellfunction via EP2 and EP4 receptor subtypes J Leukoc Biol 73 756ndash763

Hull MA Ko SC Hawcroft G 2004 Prostaglandin EP receptors targetsfor treatment and prevention of colorectal cancer Mol Cancer Ther 3 1031ndash1039

Hult LTO Kleiveland CR Fosnes K Jacobsen M Lea T 2011 EP receptorexpression in human intestinal epithelium and localization relative to the stemcell zone of the crypts PLoS ONE 6

Ikegami R Sugimoto Y Segi E Katsuyama M Karahashi H Amano F et al 2001The expression of prostaglandin E receptors EP2 and EP4 and their differentregulation by lipopolysaccharide in C3HHeN peritoneal macrophages J Immunol166 4689ndash4696

Iwasaki R Tsuge K Morimoto K Inazumi T Kawahara O Kawahara A et al2013 Molecular and pharmacological characterization of zebrafish lsquocontractilersquoand lsquoinhibitoryrsquo prostanoid receptors Biochem Biophys Res Commun 438353ndash358

Kabashima K Saji T Murata T Nagamachi M Matsuoka T Segi E et al 2002The prostaglandin receptor EP4 suppresses colitis mucosal damage and CD4 cellactivation in the gut J Clin Invest 109 883ndash893

Katoh H Watabe A Sugimoto Y Ichikawa A Negishi M 1995 Characterizationof the signal transduction of prostaglandin E receptor EP1 subtype in cDNA-transfected Chinese hamster ovary cells Biochim Biophys Acta 1244 41ndash48

Kuver R Savard C Oda D Lee SP 1994 PGE generates intracellular cAMP andaccelerates mucin secretion by cultured dog gallbladder epithelial cells Am JPhysiol 267 G998ndashG1003

Kwok AH Wang Y Leung FC 2012 Molecular characterization of prostaglandinF receptor (FP) and E receptor subtype 3 (EP3) in chickens Gen Comp Endocrinol179 88ndash98

Larsen R Hansen MB Bindslev N 2005 Duodenal secretion in humans mediatedby the EP4 receptor subtype Acta Physiol Scand 185 133ndash140

Lee JL Kim A Kopelovich L Bickers DR Athar M 2005 Differential expressionof E prostanoid receptors in murine and human non-melanoma skin cancer JInvest Dermatol 125 818ndash825

Lejeune M Leung P Beck PL Chadee K 2010 Role of EP4 receptor andprostaglandin transporter in prostaglandin E2-induced alteration in colonicepithelial barrier integrity Am J Physiol Gastrointest Liver Physiol 299G1097ndashG1105

Fig 7 Expression of EP4 receptor in Atlantic salmon liver Liver tissue sections were stained with anti-asEP4 polyclonal antibodies dilutes 11000 The expression is mainlydetected in the epithelial lining of the bile ducts and in the intrahepatic monocyte-like cells Original magnifications are 200times (a) and 400times (b)

149AAA Gamil et alDevelopmental and Comparative Immunology 48 (2015) 143ndash150

(Asano et al 2002) It is known that PGE2 plays an importantrole in protecting the epithelial lining of the gallbladderfrom the bile salts by stimulating the secretion of mucin ina cAMP dependent manner (Behar 2013 Kuver et al 1994)

The expression of asEP4 in the epithelium of the bile ductssuggests that it may play a role in maintaining the integrityof the bile duct epithelium Other roles cannot be excludedgiven that EP2 has been suggested to play a novel role in PGE2

Fig 5 Expression of EP4 receptor in Atlantic salmon pyloric caeca Sections were stained with anti-asEP4 polyclonal antibodies dilutes 11000 The expression is detectedin the lamina propria and the intra epithelial leukocytes as well as the rodlet cells Original magnifications are 200times (a) and 400times (b)

Fig 6 Expression of EP4 receptor in Atlantic salmon head kidney and spleen Head kidney (a and b) and spleen (cndashf) tissue sections were stained with anti-asEP4 polyclonalantibodies dilutes 11000 The receptor is diffusely expressed in the head kidney hematopoietic tissue while in the spleen it is mainly expressed in the white bulb Note thestrong association between the receptor and the melanomacrophage in the spleen (e and f) Original magnifications are 200times (a and c) 400times (b d e) and 630times (f)

148 AAA Gamil et alDevelopmental and Comparative Immunology 48 (2015) 143ndash150

mediated regulation of glucose metabolism in other fish species(Busby et al 2002)

EP4 receptor is known to mediate the protective effect of PGE2on the respiratory gastrointestinal and glomerular epithelial lining(Aoudjit et al 2006 Kabashima et al 2002 Schmidt et al 2011)In this study the expression of asEP4 in the gills was limited to theepithelial lining suggesting that the EP4 receptor may mediate asimilar protective role In contrast the expression in the pyloric caecawas limited to the intraepithelial leukocytes and no expression wasdetected in the epithelium Our results are in agreement with thefinding of Hult et al who found that the expression of EP4 proteinin human intestine is limited to the lamina propria and the intes-tinal crypts (Hult et al 2011) In humans and mice different patternsof expression are seen across the gastrointestinal tract (Lejeune et al2010 Morimoto et al 1997) Hence the presence of EP4 in otherparts of the gastrointestinal tract in Atlantic salmon should be furtherinvestigated

The expression of EP4 receptor in the skin has previously beeninvestigated in mice (Lee et al 2005 Tober et al 2007) While itis well established that the EP4 receptor can be detected by RT-PCR (Lee et al 2005 Rundhaug et al 2011) contradictory findingshave been reported regarding the expression of EP4 proteins by im-munohistochemistry One study reported that EP4 is undetectable(Lee et al 2005) while another one showed that it can be de-tected in skin epidermal keratinocytes and dermal leukocytes (Toberet al 2007) In the current study asEP4 expression was detectedin Atlantic salmon skin both by RT-PCR and immunohistochemis-try The expression of asEP4 proteins was found to be exclusive tothe epidermis in the examined fish but with different levels and pat-terns The reason behind different levels and patterns of expressionobserved remains unclear It was reported previously that the ex-pression of EP4 receptor in the colon and other EP receptors in theskin become more intense and diffused when it is inflamed or uponexposure to chronic radiation respectively (Lee et al 2005 Lejeuneet al 2010) Since intense and diffuse staining of some mitotic figuresand lymphocytes in some areas in skins were present one possi-ble explanation is that the different patterns of expression observedare due to some ongoing inflammatory process although normalphysiological differences cannot be excluded

Acknowledgement

This research was funded by the Research Council of NorwaySFI-Sea Lice Research Centre grant number 203513

References

Aoudjit L Potapov A Takano T 2006 Prostaglandin E2 promotes cell survival ofglomerular epithelial cells via the EP4 receptor Am J Physiol Renal Physiol 290F1534ndashF1542

Asano T Shoda J Ueda T Kawamoto T Todoroki T Shimonishi M et al 2002Expressions of cyclooxygenase-2 and prostaglandin E-receptors in carcinoma ofthe gallbladder crucial role of arachidonate metabolism in tumor growth andprogression Clin Cancer Res 8 1157ndash1167

Behar J 2013 Physiology and pathophysiology of the biliary tract the gallbladderand sphincter of oddi a review ISRN Physiol 2013 15

Busby ER Cooper GA Mommsen TP 2002 Novel role for prostaglandinE2 in fish hepatocytes regulation of glucose metabolism J Endocrinol 174137ndash146

Ding M Kinoshita Y Kishi K Nakata H Hassan S Kawanami C et al 1997Distribution of prostaglandin E receptors in the rat gastrointestinal tractProstaglandins 53 199ndash216

Fabre JE Nguyen M Athirakul K Coggins K McNeish JD Austin S et al 2001Activation of the murine EP3 receptor for PGE2 inhibits cAMP production andpromotes platelet aggregation J Clin Invest 107 603ndash610

Fennekohl A Schieferdecker HL Jungermann K Puschel GP 1999 Differentialexpression of prostanoid receptors in hepatocytes Kupffer cells sinusoidalendothelial cells and stellate cells of rat liver J Hepatol 30 38ndash47

Fijan N Sulimanovic D Bearzotti M Muzinic D Zwillenberg LO ChilmonczykS et al 1983 Some properties of the epithelioma-papulosum-cyprini (Epc)cell-line from carp cyprinus-carpio Ann Inst Pasteur Vir 134 207ndash220

Frolov A Yang L Dong H Hammock BD Crofford LJ 2013 Anti-inflammatoryproperties of prostaglandin E2 deletion of microsomal prostaglandin Esynthase-1 exacerbates non-immune inflammatory arthritis in miceProstaglandins Leukot Essent Fatty Acids 89 351ndash358

Fujino H Salvi S Regan JW 2005 Differential regulation of phosphorylation ofthe cAMP response element-binding protein after activation of EP2 and EP4prostanoid receptors by prostaglandin E2 Mol Pharmacol 68 251ndash259

Harizi H Grosset C Gualde N 2003 Prostaglandin E2 modulates dendritic cellfunction via EP2 and EP4 receptor subtypes J Leukoc Biol 73 756ndash763

Hull MA Ko SC Hawcroft G 2004 Prostaglandin EP receptors targetsfor treatment and prevention of colorectal cancer Mol Cancer Ther 3 1031ndash1039

Hult LTO Kleiveland CR Fosnes K Jacobsen M Lea T 2011 EP receptorexpression in human intestinal epithelium and localization relative to the stemcell zone of the crypts PLoS ONE 6

Ikegami R Sugimoto Y Segi E Katsuyama M Karahashi H Amano F et al 2001The expression of prostaglandin E receptors EP2 and EP4 and their differentregulation by lipopolysaccharide in C3HHeN peritoneal macrophages J Immunol166 4689ndash4696

Iwasaki R Tsuge K Morimoto K Inazumi T Kawahara O Kawahara A et al2013 Molecular and pharmacological characterization of zebrafish lsquocontractilersquoand lsquoinhibitoryrsquo prostanoid receptors Biochem Biophys Res Commun 438353ndash358

Kabashima K Saji T Murata T Nagamachi M Matsuoka T Segi E et al 2002The prostaglandin receptor EP4 suppresses colitis mucosal damage and CD4 cellactivation in the gut J Clin Invest 109 883ndash893

Katoh H Watabe A Sugimoto Y Ichikawa A Negishi M 1995 Characterizationof the signal transduction of prostaglandin E receptor EP1 subtype in cDNA-transfected Chinese hamster ovary cells Biochim Biophys Acta 1244 41ndash48

Kuver R Savard C Oda D Lee SP 1994 PGE generates intracellular cAMP andaccelerates mucin secretion by cultured dog gallbladder epithelial cells Am JPhysiol 267 G998ndashG1003

Kwok AH Wang Y Leung FC 2012 Molecular characterization of prostaglandinF receptor (FP) and E receptor subtype 3 (EP3) in chickens Gen Comp Endocrinol179 88ndash98

Larsen R Hansen MB Bindslev N 2005 Duodenal secretion in humans mediatedby the EP4 receptor subtype Acta Physiol Scand 185 133ndash140

Lee JL Kim A Kopelovich L Bickers DR Athar M 2005 Differential expressionof E prostanoid receptors in murine and human non-melanoma skin cancer JInvest Dermatol 125 818ndash825

Lejeune M Leung P Beck PL Chadee K 2010 Role of EP4 receptor andprostaglandin transporter in prostaglandin E2-induced alteration in colonicepithelial barrier integrity Am J Physiol Gastrointest Liver Physiol 299G1097ndashG1105

Fig 7 Expression of EP4 receptor in Atlantic salmon liver Liver tissue sections were stained with anti-asEP4 polyclonal antibodies dilutes 11000 The expression is mainlydetected in the epithelial lining of the bile ducts and in the intrahepatic monocyte-like cells Original magnifications are 200times (a) and 400times (b)

149AAA Gamil et alDevelopmental and Comparative Immunology 48 (2015) 143ndash150

mediated regulation of glucose metabolism in other fish species(Busby et al 2002)

EP4 receptor is known to mediate the protective effect of PGE2on the respiratory gastrointestinal and glomerular epithelial lining(Aoudjit et al 2006 Kabashima et al 2002 Schmidt et al 2011)In this study the expression of asEP4 in the gills was limited to theepithelial lining suggesting that the EP4 receptor may mediate asimilar protective role In contrast the expression in the pyloric caecawas limited to the intraepithelial leukocytes and no expression wasdetected in the epithelium Our results are in agreement with thefinding of Hult et al who found that the expression of EP4 proteinin human intestine is limited to the lamina propria and the intes-tinal crypts (Hult et al 2011) In humans and mice different patternsof expression are seen across the gastrointestinal tract (Lejeune et al2010 Morimoto et al 1997) Hence the presence of EP4 in otherparts of the gastrointestinal tract in Atlantic salmon should be furtherinvestigated

The expression of EP4 receptor in the skin has previously beeninvestigated in mice (Lee et al 2005 Tober et al 2007) While itis well established that the EP4 receptor can be detected by RT-PCR (Lee et al 2005 Rundhaug et al 2011) contradictory findingshave been reported regarding the expression of EP4 proteins by im-munohistochemistry One study reported that EP4 is undetectable(Lee et al 2005) while another one showed that it can be de-tected in skin epidermal keratinocytes and dermal leukocytes (Toberet al 2007) In the current study asEP4 expression was detectedin Atlantic salmon skin both by RT-PCR and immunohistochemis-try The expression of asEP4 proteins was found to be exclusive tothe epidermis in the examined fish but with different levels and pat-terns The reason behind different levels and patterns of expressionobserved remains unclear It was reported previously that the ex-pression of EP4 receptor in the colon and other EP receptors in theskin become more intense and diffused when it is inflamed or uponexposure to chronic radiation respectively (Lee et al 2005 Lejeuneet al 2010) Since intense and diffuse staining of some mitotic figuresand lymphocytes in some areas in skins were present one possi-ble explanation is that the different patterns of expression observedare due to some ongoing inflammatory process although normalphysiological differences cannot be excluded

Acknowledgement

This research was funded by the Research Council of NorwaySFI-Sea Lice Research Centre grant number 203513

References

Aoudjit L Potapov A Takano T 2006 Prostaglandin E2 promotes cell survival ofglomerular epithelial cells via the EP4 receptor Am J Physiol Renal Physiol 290F1534ndashF1542

Asano T Shoda J Ueda T Kawamoto T Todoroki T Shimonishi M et al 2002Expressions of cyclooxygenase-2 and prostaglandin E-receptors in carcinoma ofthe gallbladder crucial role of arachidonate metabolism in tumor growth andprogression Clin Cancer Res 8 1157ndash1167

Behar J 2013 Physiology and pathophysiology of the biliary tract the gallbladderand sphincter of oddi a review ISRN Physiol 2013 15

Busby ER Cooper GA Mommsen TP 2002 Novel role for prostaglandinE2 in fish hepatocytes regulation of glucose metabolism J Endocrinol 174137ndash146

Ding M Kinoshita Y Kishi K Nakata H Hassan S Kawanami C et al 1997Distribution of prostaglandin E receptors in the rat gastrointestinal tractProstaglandins 53 199ndash216

Fabre JE Nguyen M Athirakul K Coggins K McNeish JD Austin S et al 2001Activation of the murine EP3 receptor for PGE2 inhibits cAMP production andpromotes platelet aggregation J Clin Invest 107 603ndash610

Fennekohl A Schieferdecker HL Jungermann K Puschel GP 1999 Differentialexpression of prostanoid receptors in hepatocytes Kupffer cells sinusoidalendothelial cells and stellate cells of rat liver J Hepatol 30 38ndash47

Fijan N Sulimanovic D Bearzotti M Muzinic D Zwillenberg LO ChilmonczykS et al 1983 Some properties of the epithelioma-papulosum-cyprini (Epc)cell-line from carp cyprinus-carpio Ann Inst Pasteur Vir 134 207ndash220

Frolov A Yang L Dong H Hammock BD Crofford LJ 2013 Anti-inflammatoryproperties of prostaglandin E2 deletion of microsomal prostaglandin Esynthase-1 exacerbates non-immune inflammatory arthritis in miceProstaglandins Leukot Essent Fatty Acids 89 351ndash358

Fujino H Salvi S Regan JW 2005 Differential regulation of phosphorylation ofthe cAMP response element-binding protein after activation of EP2 and EP4prostanoid receptors by prostaglandin E2 Mol Pharmacol 68 251ndash259

Harizi H Grosset C Gualde N 2003 Prostaglandin E2 modulates dendritic cellfunction via EP2 and EP4 receptor subtypes J Leukoc Biol 73 756ndash763

Hull MA Ko SC Hawcroft G 2004 Prostaglandin EP receptors targetsfor treatment and prevention of colorectal cancer Mol Cancer Ther 3 1031ndash1039

Hult LTO Kleiveland CR Fosnes K Jacobsen M Lea T 2011 EP receptorexpression in human intestinal epithelium and localization relative to the stemcell zone of the crypts PLoS ONE 6

Ikegami R Sugimoto Y Segi E Katsuyama M Karahashi H Amano F et al 2001The expression of prostaglandin E receptors EP2 and EP4 and their differentregulation by lipopolysaccharide in C3HHeN peritoneal macrophages J Immunol166 4689ndash4696

Iwasaki R Tsuge K Morimoto K Inazumi T Kawahara O Kawahara A et al2013 Molecular and pharmacological characterization of zebrafish lsquocontractilersquoand lsquoinhibitoryrsquo prostanoid receptors Biochem Biophys Res Commun 438353ndash358

Kabashima K Saji T Murata T Nagamachi M Matsuoka T Segi E et al 2002The prostaglandin receptor EP4 suppresses colitis mucosal damage and CD4 cellactivation in the gut J Clin Invest 109 883ndash893

Katoh H Watabe A Sugimoto Y Ichikawa A Negishi M 1995 Characterizationof the signal transduction of prostaglandin E receptor EP1 subtype in cDNA-transfected Chinese hamster ovary cells Biochim Biophys Acta 1244 41ndash48

Kuver R Savard C Oda D Lee SP 1994 PGE generates intracellular cAMP andaccelerates mucin secretion by cultured dog gallbladder epithelial cells Am JPhysiol 267 G998ndashG1003

Kwok AH Wang Y Leung FC 2012 Molecular characterization of prostaglandinF receptor (FP) and E receptor subtype 3 (EP3) in chickens Gen Comp Endocrinol179 88ndash98

Larsen R Hansen MB Bindslev N 2005 Duodenal secretion in humans mediatedby the EP4 receptor subtype Acta Physiol Scand 185 133ndash140

Lee JL Kim A Kopelovich L Bickers DR Athar M 2005 Differential expressionof E prostanoid receptors in murine and human non-melanoma skin cancer JInvest Dermatol 125 818ndash825

Lejeune M Leung P Beck PL Chadee K 2010 Role of EP4 receptor andprostaglandin transporter in prostaglandin E2-induced alteration in colonicepithelial barrier integrity Am J Physiol Gastrointest Liver Physiol 299G1097ndashG1105

Fig 7 Expression of EP4 receptor in Atlantic salmon liver Liver tissue sections were stained with anti-asEP4 polyclonal antibodies dilutes 11000 The expression is mainlydetected in the epithelial lining of the bile ducts and in the intrahepatic monocyte-like cells Original magnifications are 200times (a) and 400times (b)

149AAA Gamil et alDevelopmental and Comparative Immunology 48 (2015) 143ndash150

Leong JS Jantzen SG von Schalburg KR Cooper GA Messmer AM Liao NYet al 2010 Salmo salar and Esox lucius full-length cDNA sequences revealchanges in evolutionary pressures on a post-tetraploidization genome BMCGenomics 11 279

Luschnig-Schratl P Sturm EM Konya V Philipose S Marsche G Frohlich E et al2011 EP4 receptor stimulation down-regulates human eosinophil function CellMol Life Sci 68 3573ndash3587

Minakuchi R Wacholtz MC Davis LS Lipsky PE 1990 Delineation of themechanism of inhibition of human T cell activation by PGE2 J Immunol 1452616ndash2625

Mita H Hasegawa M Higashi N Akiyama K 2002 Characterization of PGE2receptor subtypes in human eosinophils J Allergy Clin Immunol 110 457ndash459

Morimoto K Sugimoto Y Katsuyama M Oida H Tsuboi K Kishi K et al 1997Cellular localization of mRNAs for prostaglandin E receptor subtypes in mousegastrointestinal tract Am J Physiol 272 G681ndashG687

Nakanishi M Rosenberg DW 2013 Multifaceted roles of PGE2 in inflammationand cancer Semin Immunopathol 35 123ndash137

Nataraj C Thomas DW Tilley SL Nguyen MT Mannon R Koller BH et al2001 Receptors for prostaglandin E(2) that regulate cellular immune responsesin the mouse J Clin Invest 108 1229ndash1235

Okada Y Hara A Ma H Xiao CY Takahata O Kohgo Y et al 2000Characterization of prostanoid receptors mediating contraction of the gastricfundus and ileum studies using mice deficient in prostanoid receptors Br JPharmacol 131 745ndash755

Pfaffi MW 2004 Quantification strategies in real-time PCR In Bustin SA (Ed)AZ of Quantitative PCR International University Line La Jolla CA USA pp 87ndash112

Rundhaug JE Simper MS Surh I Fischer SM 2011 The role of the EP receptorsfor prostaglandin E2 in skin and skin cancer Cancer Metastasis Rev 30465ndash480

Schmidt LM Belvisi MG Bode KA Bauer J Schmidt C Suchy MT et al 2011Bronchial epithelial cell-derived prostaglandin E2 dampens the reactivity ofdendritic cells J Immunol 186 2095ndash2105

Smith WL 1992 Prostanoid biosynthesis and mechanisms of action Am J Physiol263 F181ndashF191

Sugimoto Y Narumiya S 2007 Prostaglandin E receptors J Biol Chem 28211613ndash11617

Sugimoto Y Negishi M Hayashi Y Namba T Honda A Watabe A et al 1993Two isoforms of the EP3 receptor with different carboxyl-terminal domainsIdentical ligand binding properties and different coupling properties with Giproteins J Biol Chem 268 2712ndash2718

Takeuchi K Ukawa H Kato S Furukawa O Araki H Sugimoto Y et al 1999Impaired duodenal bicarbonate secretion and mucosal integrity in mice lackingprostaglandin E-receptor subtype EP3 Gastroenterology 117 1128ndash1135

Tober KL Thomas-Ahner JM Kusewitt DF Oberyszyn TM 2007 Effects of UVBon E prostanoid receptor expression in murine skin J Invest Dermatol 127214ndash221

Tsuge K Iwasaki R Morimoto K Inazumi T Kawahara O Kawahara A et al2013 Molecular and pharmacological characterization of zebrafish lsquorelaxantrsquoprostanoid receptors Biochem Biophys Res Commun 436 685ndash690

Yao C Sakata D Esaki Y Li Y Matsuoka T Kuroiwa K et al 2009 ProstaglandinE2-EP4 signaling promotes immune inflammation through Th1 cell differentiationand Th17 cell expansion Nat Med 15 633ndash640

150 AAA Gamil et alDevelopmental and Comparative Immunology 48 (2015) 143ndash150