S

D

MN

ARRAA

KBRS

bm2mnTh

g(wgnwVvpsfp(

ckfmd

0h

Journal of Virological Methods 190 (2013) 17– 19

Contents lists available at SciVerse ScienceDirect

Journal of Virological Methods

jou rn al hom ep age: www.elsev ier .com/ locate / jv i romet

hort communication

evelopment of a strand specific SYBRGreen RT-PCR for a GIII.2 bovine norovirus

ette Myrmel ∗

orwegian School of Veterinary Science, P.B. 8146 Dep., 0033 Oslo, Norway

rticle history:eceived 18 December 2012eceived in revised form 8 March 2013

a b s t r a c t

A strand specific SYBRGreen RT-PCR was developed for a bovine norovirus (GIII.2). HEK293 cells weretransfected with a plasmid containing the complete virus genome and copy DNA was produced withviral RNA strand-specific primers that introduced nucleotide changes. Amplicons from the negative and

ccepted 13 March 2013vailable online 26 March 2013

eywords:ovine norovirusT-PCR

positive viral RNA strands, and from potential transcripts made by sequence independent transcription,were separated by melting curve analysis. The RT-PCR showed high strand specificity and could be auseful tool to study virus replication in replicon and reverse genetic systems and in screening for lowlevels of virus replication in norovirus permissive cell lines.

© 2013 Elsevier B.V. All rights reserved.

trand specific

Noroviruses (NVs) are common enteric pathogens that haveeen found in several species. Bovine NVs (BoNVs) are very com-on among calves and cause mild, self-limiting diarrhea (Jor et al.,

010; Oliver et al., 2007), while human NVs (HuNVs) are among theost common viral enteric pathogens in people and may cause sig-

ificant disease with vomiting and diarrhea (Matthews et al., 2012).hese viruses are not efficiently propagated in cell culture and thisas hampered functional studies on their replication.

Noroviruses belong to the Caliciviridae and have a linear sin-le stranded positive-sense RNA genome of 7.5 kb. A virus proteinVPg) is covalently linked to the 5′ UTR (untranslated region),hereas the 3′ UTR is polyadenylated (Green et al., 2001). The NV

enome generally encodes three open reading frames (ORFs). Theon-structural polyprotein is encoded by ORF1 (Liu et al., 1996),hile the major capsid protein, VP1, and the minor capsid protein,P2, are encoded by ORF 2 and ORF 3, respectively. Replication ofiral RNA is by transcription of the positive strand, resulting in theroduction of a negative strand from which positive genomic andub genomic RNA are made. The NV genus is divided into five dif-erent genogroups (G). Human NVs are found in GI, GII, and GIV,orcine NVs belong to GII, BoNVs belong to GIII and murine NVsMuNVs) belong to GV.

The identification of MuNV, which replicates efficiently in tissueulture and has a small animal model available, has increased ournowledge of NV biology (Karst et al., 2003). However, MuNVs dif-

er from the HuNVs in several aspects. They have four ORFs, infect

acrophage-like cells in vivo, and replicate in cultured primaryendritic cells and macrophages (Wobus et al., 2004). Murine NVs

∗ Tel.: +47 22964771.E-mail address: mette.myrmel@nvh.no

166-0934/$ – see front matter © 2013 Elsevier B.V. All rights reserved.ttp://dx.doi.org/10.1016/j.jviromet.2013.03.012

cause severe and lethal disease in STAT1−/− deficient mice, but onlymodest clinical signs in immune competent mice (fecal inconsis-tency) (Kahan et al., 2011). Bovine NVs could be a better model forHuNVs than MuNVs and calves might also be used as an animalmodel of infection. Serology indicates that BoNVs infect humans(Vildevall et al., 2010;Widdowson et al., 2005), and gnotobioticcalves developed gastrointestinal symptoms after inoculation witha human GII.4 NV strain (Souza et al., 2008). In order to establish anadditional system for the study of NV replication, a BoNV replicon(plasmid containing a complete BoNV GIII.2 genome; pHMBoNV)was developed (manuscript in preparation). The replicon was basedon transcription (production of positive stranded viral RNA) by cel-lular RNA polymerase 1, translation of viral mRNA and productionof negative stranded viral RNA by viral RNA dependent RNA poly-merase. The present communication describes the development ofa strand-specific RT-PCR to enable the study of this replicon.

A general approach with strand-specific RT-primers in sepa-rate tubes does not provide the necessary results due to copyDNA (cDNA) production of the incorrect strand by sequence inde-pendent priming (Haddad et al., 2007). Different strategies havebeen used to avoid this problem, including running RT reactions athigh temperatures and using tagged RT-primers and tag-specificprimers in the PCR (Vashist et al., 2012). Also, carryover of RT-primers into the PCR must be avoided. The specificity of the presentassay is ensured by (1) strand-specific RT primers that introducenucleotide substitutions into the amplicons (Feng et al., 2012); (2)RT at a relatively high temperature; (3) low concentrations of RTprimers, and (4) diluted cDNA to prevent carryover of RT primers

(Vashist et al., 2012). Copy DNA from correctly primed positive andnegative strand viral RNA can thereby be identified and separatedfrom cDNA resulting from sequence-independent priming duringa SYBRGreen PCR with final melting curve analysis.

18 M. Myrmel / Journal of Virological Methods 190 (2013) 17– 19

+ strand 5’- TCCCTGAGGGTTGC ACCGAGGCCTTTGGGGTTCC AGTT AGTGAAA TTGCG GTCAGCTCCCATGGT-3’

BoNV RT-Fw 5’- TCC CTGAGGGTTGC ACCG AGATATTTATGGTT C-3

BoNV Fw 5’- TCCCTGAGGGTTGCACCGAG-3

- strand 3’- AGGGACTCCCAACG TGGC TCCGG AAACCCC AAGGTCAATCACTTTAACGCC AGTCG AGGGTACCA-5’

BoNV RT-Rw 3-GGTCACG CGCGCG AACGCCAGTCG AGGGTACCA -5’

BoNV Rw 3-AA CGCCAGTCG AGGGTACCA-5’

F es/pot mers

F

wiioRttinafaTt

(taRteptds(tEtPnuua57tppfTstprace

wt

ig. 1. Sequences of the BoNV positive (+) and negative (−) strands and the sequenche GIII.2 BoNV (JX145650). RT-Fw and RT-Rw refer to the forward and reverse prior simplicity, uracil in the RNA strand has been replaced with thymine (T).

As the BoNV replicon system utilizes human cells, the RT primersere selected from a part of the BoNV genome that has few sim-

larities with the human genome. This low similarity region wasdentified using the primer-BLAST (Ye et al., 2012). The sequencef all primers used and their positions are shown in Fig. 1. TheT-primers were designed to introduce nucleotide substitutionshat resulted in a 3.2 ◦C decrease and a 3.8 ◦C increase in meltingemperature (Tm) of the PCR amplicon from the negative and pos-tive RNA strands, respectively, compared with an amplicon witho substitutions (Tm 77.9 ◦C). The peaks representing the Tm of themplicons from the negative and positive RNA strands would there-ore differ by 7 ◦C in the melting curve analysis, while the Tm of themplicon from pHMBoNV would appear in between (Tm 77.9 ◦C).he online oligonucleotide properties calculator OlicoCalc was usedo calculate Tms (Kibbe, 2007).

Reverse transcription was performed with Superscript IIIInvitrogen, Life Technologies, Paisley, UK), following the manufac-urer’s instructions for specific priming. The primers BoNVRT-Fwnd BoNVRT-Rw were used for RT in one tube containing 4 �l ofNA in a total volume of 20 �l. To increase the specificity, the reac-ion was run for 25 min at the highest temperature (55 ◦C), yieldingfficient Superscript III activity. A low concentration of the RTrimers was used (0.2 �M) to prevent carryover into the PCR. Addi-ional carryover preventive measures, exonuclease treatment andilution of the cDNA, were tested with regard to specificity and sen-itivity. Separate samples of BoNV RNA (fecal) and the pHMBoNVworst case scenario of primer carryover) were used in RT reac-ions with separate RT primers. The cDNA was either treated withxonuclease 1 (NEB, Ipswich, MA, US), according to the manufac-urer’s instructions, or diluted 1:10, prior to PCR amplification. TheowerSYBRGreen PCR Master Mix (Applied Biosystems, Life Tech-ologies) and primers BoNV Fw and BoNV Rw (0.3 �M each) weresed for PCR. Two �l of cDNA were amplified in a 20 �l reaction vol-me, according to the Master Mix protocol. Cycling conditions weres follows: 95 ◦C for 10 min, and thereafter 35 cycles of 94 ◦C for 15 s,0 ◦C for 30 s and 72 ◦C for 30 s. Fluorescence data were collected at2 ◦C and a melting curve analysis completed the run. According tohe melting curves, amplicons from the BoNV RNA or plasmid sam-les gave a single peak at 84 and 81 ◦C, respectively. There were noeaks indicating amplicons from negative stranded BoNV RNA (noalse positives). The observed Tms were higher than the calculatedms, probably due to the PCR buffers used, however the peaks werepecific and easily separated. The results from the pHMBoNV showhat both dilution and exonuclease treatment were adequate torevent substantial amplification by RT primers that had been car-ied over into the PCR. As the sample containing diluted cDNA gave

lower Ct value than the sample treated with exonuclease, dilutedDNA was used in the following work. The reduced sensitivity with

xonuclease treatment could be a result of cDNA degradation.

In order to extend the specificity test of the RT-primers, theyere included as PCR primers to amplify DNA oligos (Eurogen-

ec, Seraing, Belgium) representing positive and negative strand

sitions of the primers used. The sequences represent the nucleotides 3108–3177 ofused for cDNA synthesis, respectively. The substituted nucleotides are underlined.

BoNV RNA. The primers BoNV Fw/BoNVRT-Rw (positive strand)and BoNVRT-Fw/BoNV Rw (negative strand) were used to amplifythe two DNA oligos. The results show that each primer pair ampli-fied only one oligo giving approximately Tms of 84 and 77 ◦C, forthe positive and negative strand, respectively. Taken together theresults show that the RT-PCRs are highly specific for positive andnegative stranded BoNV RNA and that their amplicons can be sep-arated by melting curve analysis due to a difference in Tm of 7 ◦C.

In order to study BoNV replication using the pHMBoNV, thevector containing the virus genome (GenBank JX145650) was tran-fected into HEK293 cells grown in 24 well plates at 37 ◦C, withRPMI medium (Invitrogen) containing 10% fetal bovine serum and1% streptocillin/penicillin. Transfection was performed with 1 �gpHMBoNV, 2.5 �l Lipofectamine LTX and 1 �l PLUS Reagent accord-ing to the manufacturer (Invitrogen). After 2 h of incubation, thepHMBoNV/transfection mix was removed, the cells were washedtwice with PBS, and medium was added. After 30 min (negativecontrol) and 12 h of incubation the cells were trypsinated, pel-leted and frozen at −80 ◦C. To reduce the vector concentration, RNAwas extracted by a double protocol. The standard Qiazol (Qiagen,Hilden, Germany) protocol was used starting with 600 �l of lysisreagent per cell pellet. After ethanol precipitation and 2 rounds ofethanol wash, the RNA pellet was dried for 1 h in a hood, solubilizedin 100 �l nuclease free water, incubated for 20 min at 70 ◦C anddigested with 20 U of DNase1 (RNase-free, Promega, Madison, WI,USA) for 2 h at 37 ◦C. RNA was precipitated by adding 1/10 volumeof 3 M sodium acetate (pH 5.2) and 2 volumes of 100% ethanol, thesolutions incubated at −20 ◦C for 30 min, and then spun for 15 minat 4 ◦C. The final purification step utilized the Agilent total RNApurification kit (Agilent Technologies, Santa Clara, CA, USA) andRNA was eluted in 50 �l of RNase free water. The two step RT-PCRwas run with 4 �l of RNA and 2 �l of cDNA (diluted 1:10).

The result of the transfection is shown in Fig. 2. The negative con-trol (cells and pHMBoNV) gave a single peak at approximately 81 ◦C,representing amplification of the plasmid. The cells harvested after12 h showed two specific peaks at 84 and 77 ◦C representing ampli-cons from viral positive and negative strand RNA, respectively. Inspite of a double protocol for RNA extraction and DNase treatment,complete removal or degradation of pHMBoNV was not achieved.However, amplification from pHMBoNV seemed to be suppressedin samples containing viral RNA. The results show that BoNV neg-ative and positive RNA strands can be identified by the RT-PCRwith high specificity. The size of the melting curve peaks showsthe contribution of each amplicon to the fluorescence at the endof the PCR. However, quantitation should be performed in the lin-ear phase of the amplification. Quantitation should therefore beperformed using separate RT reactions, followed by separate PCRs,such individual Ct-values in the linear phase are obtained. Separate

RTs were tested to reveal whether this also changed the sensitivity.The results are shown in Fig. 3. As the PCR is identical for the twoassays, the results indicate that RT of the negative RNA strand wasslightly suppressed by RT of the positive strand. Separate RT-PCR

M. Myrmel / Journal of Virological

Fig. 2. Dissociation curves of amplicons from RNA harvested from a plasmid-basedbovine norovirus replicon system. The red curve ( ) represents RNA harvested after12 h. The blue curve ( ) represents the negative control (cells and plasmid).

Fig. 3. Dissociation curves of amplicons from RNA harvested from a bovinenorovirus replicon system. cDNA was produced using separate or combined RTptG

ass

as

rimers. Blue ( ); RT primer for negative strand RNA, Red ( ); RT primer for posi-ive strand RNA; Green ( ); RT primers for both negative and positive strand RNA,ray ( ); negative control (water).

ssays should therefore be used when quantitation or maximumensitivity is required, e.g. when a low concentration of negative

trand RNA is expected.

This study demonstrates the specific detection of the positivend negative BoNV RNA strands. Although quantitation of eachtrand requires separate reactions, the advantage of the primer

Methods 190 (2013) 17– 19 19

design is that simple, strand-specific detection can be performedin a single tube without false positive results due to sequence inde-pendent cDNA synthesis. The method is a valuable, highly sensitivetool to study BoNV replication and the assay can be adapted to othersingle stranded RNA viruses. For HuNVs, the same genome regioncan be utilized for primer design due to lack of similarity to thehuman genome. For NVs which are not easily grown in cell cultures(all except MuNVs) the assay could be used to study the influenceof chemical compounds and viral and cellular factors on replicons.Inoculation of animals is presently needed to evaluate the infec-tivity these viruses. In the search for permissive cell lines or organcultures, the assay for the negative strand RNA could be used toscreen for replicating viral particles. This would be more simpleand sensitive than analysing for an increase in total viral RNA. Inconclusion, the strand specific RT-PCR presented in this paper ishighly specific and there is considerable potential for its use in arange of investigations.

References

Feng, L., Lintula, S., Ho, T.H., Anastasina, M., Paju, A., Haglund, C., Stenman, U.H.,Hotakainen, K., Orpana, A., Kainov, D., Stenman, J., 2012. Technique for strand-specific gene-expression analysis and monitoring of primer-independent cDNAsynthesis in reverse transcription. Biotechniques 52, 263–270.

Green, K.Y., Chanok, R.M., Kapikian, A.Z., 2001. Human Caliciviruses. In: Knipe,D.M., Griffin, D.E., Lamb, R.A., Martin, M.A., Roizman, B., Straus, S.E. (Eds.),Fields virology, fourth Lippincott Williams & Wilkins. Philadelphia PA,pp. 841–874.

Haddad, F., Qin, A.X., Giger, J.M., Guo, H., Baldwin, K.M., 2007. Potential pitfallsin the accuracy of analysis of natural sense-antisense RNA pairs by reversetranscription-PCR. BMC. Biotechnol. 7, 21.

Jor, E., Myrmel, M., Jonassen, C.M., 2010. SYBR Green based real-time RT-PCR assayfor detection and genotype prediction of bovine noroviruses and assessment ofclinical significance in Norway. J. Virol. Methods 169, 1–7.

Kahan, S.M., Liu, G., Reinhard, M.K., Hsu, C.C., Livingston, R.S., Karst, S.M., 2011. Com-parative murine norovirus studies reveal a lack of correlation between intestinalvirus titers and enteric pathology. Virology 421, 202–210.

Karst, S.M., Wobus, C.E., Lay, M., Davidson, J., Virgin, H.W., 2003. STAT1-dependentinnate immunity to a Norwalk-like virus. Science 299, 1575–1578.

Kibbe, W.A., 2007. OligoCalc: an online oligonucleotide properties calculator.Nucleic Acids Res. 35, W43–W46.

Liu, B., Clarke, I.N., Lambden, P.R., 1996. Polyprotein processing in Southamptonvirus: identification of 3C-like protease cleavage sites by in vitro mutagenesis.J. Virol. 70, 2605–2610.

Matthews, J.E., Dickey, B.W., Miller, R.D., Felzer, J.R., Dawson, B.P., Lee, A.S., Rocks, J.J.,Kiel, J., Montes, J.S., Moe, C.L., Eisenberg, J.N., Leon, J.S., 2012. The epidemiologyof published norovirus outbreaks: a review of risk factors associated with attackrate and genogroup. Epidemiol. Infect. 140, 1161–1172.

Oliver, S.L., Wood, E., Asobayire, E., Wathes, D.C., Brickell, J.S., Elschner, M., Otto,P., Lambden, P.R., Clarke, I.N., Bridger, J.C., 2007. Serotype 1 and 2 bovinenoroviruses are endemic in cattle in the United kingdom and Germany. J. Clin.Microbiol. 45, 3050–3052.

Souza, M., Azevedo, M.S., Jung, K., Cheetham, S., Saif, L.J., 2008. Pathogenesis andimmune responses in gnotobiotic calves after infection with the genogroup II.4-HS66 strain of human norovirus. J. Virol. 82, 1777–1786.

Vashist, S., Urena, L., Goodfellow, I., 2012. Development of a strand specific real-timeRT-qPCR assay for the detection and quantitation of murine norovirus RNA. J.Virol. Methods 184, 69–76.

Vildevall, M., Grahn, A., Oliver, S.L., Bridger, J.C., Charpilienne, A., Poncet, D., Lar-son, G., Svensson, L., 2010. Human antibody responses to bovine (Newbury-2)norovirus (GIII.2) and association to histo-blood group antigens. J. Med. Virol.82, 1241–1246.

Widdowson, M.A., Rockx, B., Schepp, R., Van Der Poel, W.H., Vinje, J., van Duynhoven,Y.T., Koopmans, M.P., 2005. Detection of serum antibodies to bovine norovirusin veterinarians and the general population in the Netherlands. J. Med. Virol. 76,119–128.

Wobus, C.E., Karst, S.M., Thackray, L.B., Chang, K.O., Sosnovtsev, S.V., Belliot, G., Krug,A., Mackenzie, J.M., Green, K.Y., Virgin, H.W., 2004. Replication of Norovirus in

cell culture reveals a tropism for dendritic cells and macrophages. PLoS. Biol. 2,e432.

Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I., Rozen, S., Madden, T.L., 2012.Primer-BLAST: a tool to design target-specific primers for polymerase chainreaction. BMC. Bioinformatics. 13, 134.