FEBS Letters 584 (2010) 2485–2490

journal homepage: www.FEBSLetters .org

Curcumin inhibits hepatitis B virus via down-regulation of the metaboliccoactivator PGC-1a

Maya Mouler Rechtman a, Iddo Bar-Yishay a, Sigal Fishman a, Yaarit Adamovich b,Yosef Shaul b, Zamir Halpern a, Amir Shlomai a,*

a The Institute of Gastroenterology and Liver Disease, Tel-Aviv Sourasky Medical Center, Tel-Aviv, Israelb Department of Molecular Genetics, The Weizmann Institute of Science, Rehovot, Israel

a r t i c l e i n f o

Article history:Received 22 February 2010Revised 19 April 2010Accepted 22 April 2010Available online 29 April 2010

Edited by Hans-Dieter Klenk

Keywords:Hepatitis B virusMetabolovirusAnti-viral therapyNutrition

0014-5793/$36.00 � 2010 Federation of European Biodoi:10.1016/j.febslet.2010.04.067

Abbreviations: HBV, hepatitis B virus; PGC-1a, peroreceptor-coactivator-1a; HBsAg, hepatitis B virus sulently closed circular DNA

* Corresponding author. Address: Department ofDisease, Tel-Aviv Sourasky Medical Center, 6 WeizmIsrael. Fax: +972 3 6974622.

E-mail address: amirsh@tasmc.health.gov.il (A. Sh

a b s t r a c t

Hepatitis B virus (HBV) infects the liver and uses its cell host for gene expression and propagation.Therefore, targeting host factors essential for HBV gene expression is a potential anti-viral strategy.Here we show that treating HBV expressing cells with the natural phenolic compound curcumininhibits HBV gene expression and replication. This inhibition is mediated via down-regulation ofPGC-1a, a starvation-induced protein that initiates the gluconeogenesis cascade and that has beenshown to robustly coactivate HBV transcription. We suggest curcumin as a host targeted therapyfor HBV infection that may complement current virus-specific therapies.� 2010 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

1. Introduction

Hepatitis B virus (HBV) is a small DNA virus infecting the liveralmost exclusively [1]. Chronic infection with HBV might lead tosevere liver pathologies including chronic hepatitis, cirrhosis anda fatal cancer designated hepatocellular carcinoma [2]. HBV-induced liver disease is directly correlated with the level of viralactivity, making an efficient anti-viral therapy an extremely impor-tant component in the management and surveillance of chronicallyinfected patients [3]. The current anti-HBV drugs of choice aremembers of the nucleotide/nucleoside analogues, which suppressHBV through inhibition of its polymerase/reverse-transcriptaseactivity. The virus specificity of these efficient agents is a doubleedge sword, since although almost devoted of unwanted adverseeffects, the prolonged use of polymerase inhibitors carry a substan-tial risk for emerging of escape mutants and a potential flare-up ofthe disease. Indeed, the inability of the reverse-transcriptase

chemical Societies. Published by E

xisome proliferator-activatedrface antigen; cccDNA, cova-

Gastroenterology and Liverann Street, 64239 Tel-Aviv,

lomai).

inhibitors to totally eliminate the HBV cccDNA pool usually neces-sitates a prolonged or life-long therapy [4]. Therefore, an idealtherapy should be the combination of both virus-specific andhost-directed therapies.

Recently, we have shown that the metabolic regulator PGC-1a,a coactivator of key gluconeogenesis genes [5,6], robustly coacti-vates the transcription of HBV through the nuclear receptor HNF4a[7] and the forkhead transcription factor FOXO1 [8]. Physiologi-cally, we have shown that under starvation when PGC-1a is in-duced HBV expression is dramatically enhanced, an effect that islargely reversible upon re-feeding. Notably, knocking-down PGC-1a under both fed and starvation states results in a significantdown-regulation of HBV expression [7]. Therefore, as a ‘‘metabolo-virus” that is largely dependent on the metabolic regulator PGC-1afor its gene expression [9], HBV is extremely susceptible to anymanipulation in PGC-1a level. Thus, targeting PGC-1a is a potentialanti-HBV strategy.

The natural phenolic compound curcumin has been shown tohave anti-inflammatory, anti-oxidant and anti-proliferative effectson cells, thereby profoundly affecting their metabolism and prolif-erative potential [10,11]. Furthermore, curcumin has been shownto have an inhibitory effect against a variety of organisms suchas bacteria, fungi and viruses, including HBV, HCV and HIV[12–15]. The mechanism by which curcumin mediates its anti-viralactivity differs from virus to virus and may involve a direct

lsevier B.V. All rights reserved.

2486 M. Mouler Rechtman et al. / FEBS Letters 584 (2010) 2485–2490

inhibition of the viral replication machinery, such as in the case ofHIV [14], or inhibition of a cellular signaling pathway essential forviral replication, such as in the case of HCV [13]. Interestingly, inaddition to its ability to inhibit cell signaling at multiple levelsand to affect cellular enzymes, curcumin has been shown to specif-ically target cellular proteins and promote their degradation, aswas recently shown with p53 [16]. This degradation is mediatedthrough a unique ‘‘degradation by default” pathway common toshort-lived regulatory proteins that are intrinsically disordered intheir structure [17,18]. As a short-lived regulatory protein [19]with a predicted disordered structure (unpublished data) we spec-ulated that the HBV coactivator PGC-1a is susceptible to curcumin-induced protein degradation.

Therefore, we examined the potential inhibitory effect of curcu-min on HBV expression and replication and further investigatedwhether curcumin-induced PGC-1a protein degradation is mecha-nistically involved in HBV inhibition.

Fig. 1. Curcumin suppresses both HBV and PGC-1a proteins. (A) HepG2215 cellswere either left untreated or alternatively treated with increasing amounts (100and 150 lM) of curcumin for 4 h each day for three consecutive days after which allcells were left untreated for additional 2 days. Medium from each day was collectedand analyzed for HBsAg level. HBsAg level in medium of untreated cells from eachof the five experiment days was considered as 100% HBsAg level. The results are anaverage ± S.D of three independent experiments, each performed in triplicates. (B)HepG2215 cells were either left untreated or alternatively treated with increasingamounts (100 and 150 lM) of curcumin for 4 h, after which cells were harvested,protein extracted and analyzed by a Western-blot. The relative intensities (RI) of thebands after normalization to actin levels are shown below the correspondingpanels.

2. Materials and methods

2.1. Cell culture and treatments

HepG2, HepG2215 and HEK293 cells were maintained in Dul-becco’s modified Eagle’s minimal essential medium as previouslydescribed [20]. Cells were seeded at about 60% confluence 18–24 h prior to transfection, which was carried out by the CaHPO4

method as previously described [20]. For hormonal treatmentscells were maintained in serum-free DMEM medium and subse-quently were treated with 10–100 lM of forskolin (Sigma, cata-logue number F6886) as previously described [7] with or without50–150 lM of curcumin (dissolved in EtOH) for 4 h as previouslydescribed [16]. Cyclohexamide (60 lM, Sigma catalogue number01810) was added to cells for up to 70 min for translation inhibi-tion experiments. Lamivudine (1 mM, GlaxoSmithKline, Australia)was added to cells for 4 h for viral inhibition. Cell viability was as-sessed by trypan blue exclusion. Briefly, cells were counted in ahemocytometer following 1–2 min incubation with 1:1 0.4% try-pan blue. Counted number of unstained cells represents the per-centage of viable cells.

2.2. Plasmid constructs

For 1.3� HBV construction, an over-length HBV genome (adwstrain) of 4195 bp was produced, harboring a 50 terminus of the un-ique EcoRV site (nt 1043, considering EcoRI unique site in the ori-ginal 3.2 kb HBV construct as nt number 1) and a 30 terminus of theunique Taq1 site (nt 2017). This EcoRV-TaqI fragment was insertedbetween the SmaI-AccI unique sites of a pGEM-3Z plasmid, respec-tively. The 1.3� HBV-Luc plasmid has been previously described[7]. The pSG5-PGC-1a plasmid is a gift from B.M Spiegelman(Dana-Farber, Harvard).

2.3. Protein analysis

Proteins were extracted from cells by RIPA extraction accordingto published protocols, and subsequently fractioned on 7% (forpgc1) or 12.5% (for HBV Core) SDS–PAGE. For western blot analysis,gels were electro-blotted to a nitrocellulose membrane, which waslater soaked for 1 h on a blocking solution [Phosphate buffer saline(PBS) containing 5% non-fat milk and 0.01%v/v tween-20 (Sigma)],and incubated for 1–2 h at RT in the presence of either one of thefollowing antibodies: monoclonal mouse anti HBcAg (clone 22, di-luted 1:5000), mouse anti pgc1 antibody (Calbiochem #ST1202, di-luted 1:2000), mouse anti HA antibody (Covance #MMS-101R,diluted 1:2000), and mouse anti actin antibody (Santa Cruz

sc47778, diluted 1:5000). After incubation, the membrane waswashed three times, and Goat anti mouse conjugated with horseradish peroxidase (Jackson #115-035-062, diluted 1:5000) wasadded and incubation was allowed to proceed for an additional1 h. Antibody-antigen complexes were visualized by ECL on anX-ray film.

2.4. ELISA analysis

Medium from HBV stably-transfected HepG2215 cells was col-lected and analyzed for HBsAg level using the ADVIA Centaur ma-chine (Bayer HealthCare LLC, Tarrytown, NY) with HBsAg reagentkit (ref#03393362).

2.5. RNA analysis

RNA was extracted from cells using EZ-RNA isolation kit (Bio-logical Industries, Israel, Beit Haemek) according to the manufac-turer’s protocol. After treatment with RNase-free DNaseI(Promega #M610A), RNA was subjected to quantitative RT-PCRanalysis using the following primers:

HBV FW: TGTGGATTCGCACTCCTCCAGC;HBV Rev: TGCGAGGC-GAGGGAGTTCTT;

HPRT1 (h/m) FW: TGACACTGGCAAAACAATGCA;HPRT1 (h/m)Rev: GGTCCTTTTCACCAGCAAGCT.

M. Mouler Rechtman et al. / FEBS Letters 584 (2010) 2485–2490 2487

3. Results and discussion

3.1. Curcumin inhibits HBV expression and replication in stably-transfected hepatoma cells

We first investigated the inhibitory effect of curcumin on HBVin a stably-transfected HepG2215 cell line that continuously ex-presses HBV [21] and that more authentically simulates a HBV-in-fected liver. We quantified the secreted HBV surface antigen(HBsAg) level from the medium of HepG2215 cells as a markerfor HBV replication. Cells were treated for 4 h each day for threeconsecutive days with various concentrations of curcumin. At theend of each daily treatment medium was collected, analyzed forHBsAg level and was subsequently replaced by fresh medium. Cellviability was assessed by the trypan blue exclusion method to rule-out a non-specific toxic effect. As shown in Fig. 1A, whereas nochange in the secreted HBsAg level was detected upon curcumintreatment at the end of the first day of treatment, a significantdose-dependent reduction of up to 65% from baseline in HBsAglevels was detected in curcumin-treated cells at the end of the sec-ond and the third days of treatment. Notably, one day after treat-ment cessation HBsAg levels in curcumin-pre-treated cells

Fig. 2. Curcumin suppresses HBV expression through inhibition of PGC-1a. (A) (Upper(Lower panel) HepG2 cells were transfected with the indicated plasmids. Two days afterharvested and analyzed for luciferase activity. Results were normalized to b Gal activitytriplicates (*P = 0.03, calculated by Student t-test). (B) HepG2 cells were transfected with tperformed as indicated, after which cells were harvested, RNA was extracted and subjecte(C) The same experimental procedure as in B was performed, this time cells were harvesteddays later cells were treated as indicated (Forsk 10 lM, Curc 50 lM for 4 h) after which

continued to decrease and reached their nadir level (up to 73%reduction in HBsAg level as compared to non-treated cells). How-ever, on the second post-treatment day an increase in HBsAg levelsof �10% was detected (Fig. 1A), suggesting that the anti-HBV effectin HepG2215 cells is curcumin-dependent.

Compatible with these results, protein analysis of curcumin-treated HepG2215 cells revealed a significant dose-dependent de-crease of up to 45% from baseline in HBV Core protein level(Fig. 1B). Interestingly, analysis of PGC-1a protein in those cells re-vealed a substantial level of PGC-1a at baseline that steadily de-creased with curcumin treatment paralleling the decrease in HBVCore protein level (Fig. 1B).

Overall, these results strongly suggest that curcumin inhibitsHBV and that this inhibition correlates with a significant decreasein PGC-1a protein level.

3.2. Curcumin treatment results in suppression of HBV expression in aPGC-1a dependent manner

We have previously shown that PGC-1a strongly coactivatesHBV transcription and that during physiological conditionsin which hepatic PGC-1a is induced, HBV gene expression is

panel) a schematic presentation of the HBV-Luc construct used in this experiment.transfection cells were treated with curcumin (50 lM for 4 h) after which cells were. The results are an average of three independent experiments, each performed inhe indicated plasmids. Two days later treatment with curcumin (50 lM for 4 h) wasd to semi-quantitative (upper panel) and quantitative (lower panel) RT-PCR analysis.

for protein analysis as indicated. (D) HepG2 cells were transfected as indicated. Twocells were harvested, protein extracted and analyzed by a Western-blot.

2488 M. Mouler Rechtman et al. / FEBS Letters 584 (2010) 2485–2490

dramatically enhanced [7]. Based on the results presented in Fig. 1B,showing a correlation between the reduction in HBV Core proteinand PGC-1a level, we asked whether curcumin suppresses HBVexpression through inhibition of PGC-1a. For this, we employedthe HBV-Luc construct in which the luciferase ORF is cloned down-stream to HBV enhancer II and to the core promoter (Fig. 2A, upperpanel) [7]. As expected, over-expression of PGC-1a in HBV-Luctransfected HepG2 cells resulted in a significant induction of HBVtranscription as reflected by increased luciferase activity. Notably,whereas curcumin treatment resulted in a modest but still a signif-icant decrease in HBV-Luc activity under basal conditions in whichPGC-1a level is low, it largely abrogated HBV-Luc induction uponPGC-1a over-expression (Fig. 2A, lower panel). These results sug-gest that curcumin suppresses HBV through inhibition of PGC-1a.

Next, we analyzed both HBV mRNA and HBV Core protein levelsunder basal conditions and upon PGC-1a over-expression. As ex-pected, and consistent with the luciferase experiment results,PGC-1a over-expression resulted in up-regulation of HBV expres-sion at both the mRNA (Fig. 2B) and at the protein (Fig. 2C) levels.This induction was completely abrogated upon curcumin treat-ment and was associated with a sharp decrease in PGC-1a proteinlevel (Fig. 2C).

Hepatic PGC-1a is robustly induced upon starvation [6]. Toinvestigate the inhibitory effect of curcumin on the endogenousPGC-1a level and on HBV expression under conditions mimicking

Fig. 3. PGC-1a protein is degraded by curcumin. (A) (Left panel) HEK293 cells were transuntreated or treated with increasing amounts of curcumin (20 and 50 lM) for 4 h afterpanel) the same experiment protocol, this time RNA was extracted and analyzed by semi-were either pre-treated with curcumin (50 lM for 4 h) or left untreated, after which 60 lextracted and analyzed by a Western-blot for PGC-1a protein level. A representative blot(100 nM). Four hours after treatment, curcumin (100 lM) was added to the medium forextracted and subjected to RT-PCR analysis. The resulting cDNA was further amplifiedmRNA. The results are the average of three independent experiments (� indicates P = 0.

starvation, HBV-transfected HepG2 cells were pre-treated with for-skolin and were subsequently treated with curcumin. As shown inFig. 2D, both PGC-1a and HBV Core protein levels were inducedupon forskolin treatment, an induction largely abrogated by curcu-min treatment. Notably, the level of a control GFP protein re-mained unchanged, ruling out a non-specific degradation ortranslational inhibition effect. Noteworthy is the observation thateven under basal conditions curcumin treatment suppressed HBVexpression, although to a much lower extent (Fig. 2A–D). Thismodest effect correlates well with the low level of hepatic PGC-1a under basal conditions (Fig. 2C and D) in which the gluconeo-genesis cascade is not activated.

3.2.1. Curcumin inhibition of PGC-1a is at the protein levelWe next investigated the mechanism by which curcumin inhib-

its PGC-1a. HEK293 cells were transfected with a PGC-1a expres-sion plasmid and were subsequently treated with increasingamounts of curcumin. A co-transfected GFP expression plasmidwas used as a control. A Western-blot analysis revealed thatwhereas GFP protein level remained stable, curcumin treatmentresulted in a significant reduction in PGC-1a protein level in adose-dependent manner (Fig. 3A left panel). Curcumin effect onPGC-1a is at the protein level, since no change in PGC-1a mRNA le-vel was detected upon curcumin treatment (Fig. 3A right panel).Based on its predicted intrinsically disordered structure (unpub-

fected with the indicated plasmids. Two days after transfection cells were either leftwhich cells were harvested, protein extracted and analyzed by western blot. (Rightquantitative RT-PCR. (B). HepG2 cells transfected with a PGC-1a expression plasmid

M of cyclohexamide was added for the indicated times. Cells were harvested, proteinis shown. (C). HepG2 cells were treated with forskolin (10 lM) and dexamethasoneadditional 4 h. Eight hours after treatment initiation all cells were harvested, RNA

using real-time PCR with the indicated primers. Results were normalized to actin006, calculated by student’s t-test).

M. Mouler Rechtman et al. / FEBS Letters 584 (2010) 2485–2490 2489

lished data), we speculated that PGC-1a protein is susceptible tocurcumin-induced protein degradation, as was recently shownwith p53 [16]. Therefore, we further investigated the effect of cur-cumin on PGC-1a protein stability. For this, cells were transfectedwith a PGC-1a expression plasmid, and were subsequently eithertreated with curcumin or left untreated. As shown in Fig. 3B, fol-lowing treatment with the translation inhibitor cyclohexamidePGC-1a protein level decreased much more rapidly in curcuminpre-treated cells as compared to non-treated cells, indicating thatcurcumin treatment results in a significant shortening of PGC-1aprotein half-life. These results strongly suggest that curcumin en-hances PGC-1a protein degradation.

Next, we asked whether curcumin-induced PGC-1a proteindegradation also translates to a decrease in the expression of the‘‘classical” PGC-1a target genes. For this, we pre-treated HepG2cells with dexamethasone and forskolin, two known inducers ofPGC-1a in the liver that simulate a starvation state [6,7], and sub-sequently treated those cells with curcumin. We analyzed themRNA level of the key gluconeogenesis gene G6Pase, a well-knowntarget of PGC-1a coactivation [6,22]. As expected, the mRNA levelsof both PGC-1a and G6Pase were significantly induced by the com-

Fig. 4. Curcumin as an additive host-directed anti-HBV therapy. (A) HepG2215 cellswere left either untreated or alternatively treated for 4 h with either Lamivudine(1 mM), curcumin (150 lM) or the combination of both. Four hour after treatmentinitiation cells were harvested and analyzed for HBV mRNA level using quantitativeRT-PCR. Results are presented after normalization to Hypoxanthine-guaninephosphoribosyltransferase 1 (HPRT1) level as a mean ± S.D. of three experiments,each performed in triplicates. The P value was calculated using a standard student t-test. (B) A schematic presentation of HBV life cycle and the targets for conventionalanti-viral (i.e. nucleotide/nucleoside analogues) and the potential host-directedcurcumin therapy.

bination of dexamethasone and forskolin treatment. However,whereas PGC-1a mRNA level remained unchanged upon curcumintreatment, the mRNA level of its target gene G6Pase was signifi-cantly reduced (Fig. 3C), suggesting that curcumin inhibits PGC-1a at the protein level and that this inhibition results in a reducedexpression of its target genes.

3.3. Curcumin and the reverse-transcriptase inhibitor, Lamivudine,synergistically suppress HBV expression

So far our results indicate that curcumin inhibits HBV throughpromoting the degradation of its coactivator PGC-1a. We nextasked whether curcumin treatment could complement the anti-viral activity of the nucleotide/nucleoside analogues, which areconsidered as the gold standard for anti-HBV therapy. For this,HBV expressing HepG2215 cells were treated with either Lamivu-dine alone, curcumin alone or with the combination of both. Asshown in Fig. 4A, a 4 h treatment with either Lamivudine or curcu-min resulted in a significant suppression of HBV transcription by�35% and �62%, respectively. However, the combination of bothtreatments resulted in an enhanced suppression of HBV expressionby up to 75%, as compared to non-treated cells. These results sug-gest that curcumin may work synergistically with the current anti-HBV nucleotide/nucleoside analogous, and that this combinationmay result in a better suppression of HBV.

Taken together, in this study we show that PGC-1a protein isreadily degraded by the natural phenolic compound curcumin.Mechanistically, we show that curcumin promotes the degradationof PGC-1a protein and significantly shortens its half-life (Fig. 3).We speculate that as a short-lived regulatory protein withpredicted intrinsically disordered structure (unpublished data),PGC-1a joins a growing group of proteins called IDPs (intrinsicallydisordered proteins) that are rendered to degradation upon curcu-min treatment [16,18,23]. However, although our study clearlyshows that curcumin promotes the degradation of PGC-1a, the ex-act molecular pathway of this degradation is a subject for furtherstudies.

Taking advantage of the dependency of HBV on its coactivatorPGC-1a [7], we show that inhibition of PGC-1a by curcumin treat-ment results in a significant suppression of HBV gene expressionand replication markers. Indeed, the inhibitory effect of curcuminon HBV expression is seen mainly under conditions in which hepa-tic PGC-1a is over-expressed or induced, such as upon forskolintreatment mimicking starvation. A much more modest effect,although still substantial, is seen under basal conditions in whichhepatic PGC-1a levels is relatively low.

Thus, this study joins previous works and provides additionalevidence for the potential importance of nutrition among HBV-in-fected patients [7,9]. In addition, as a ‘‘metabolovirus” that is pro-foundly affected by nutritional cues and by hepatic metabolicpathways [7,9], HBV is potentially susceptible to manipulationsof key molecular players in hepatic metabolic processes such asgluconeogenesis.

Therefore, we suggest curcumin as a potential host-directedtherapy that may complement the current nucleotide/nucleosideanalogues that directly suppress HBV replication in a virus-specificmanner (Fig. 4B). As shown experimentally in this study, this com-bination therapy synergistically suppresses HBV (Fig. 4A). Further-more, the addition of curcumin to the standard treatment ofnucleotide/nucleoside analogues may minimize the risk of viralflare-ups under physiological conditions, such as during a short-term starvation, in which hepatic PGC-1a is induced to coactivateHBV transcription [7].

Obviously, some major obstacles have to be overcome prior tothe clinical use of curcumin as an anti-HBV drug in humans. First,whereas host-directed anti-viral therapy has the advantage of

2490 M. Mouler Rechtman et al. / FEBS Letters 584 (2010) 2485–2490

avoiding viral-resistance, it carries a substantial risk for unwantedadverse effects. Accordingly, targeting a cellular coactivator in-volved in metabolic and energy-related processes such as PGC-1a[5,6] might result in clinically significant adverse outcomes. In-deed, following curcumin treatment a modest but still significantdown-regulation of the key gluconeogenic enzyme G6Pase was ob-served (Fig. 3C). Therefore, further studies in animals and humansshould be carried out to adjust curcumin dosages that are mini-mally toxic on the one hand, but still result in a substantial impair-ment of HBV gene expression and replication on the other hand.

Second, the clinical use of curcumin is hampered by its low sol-ubility in water, its short half-life and its low bioavailability follow-ing oral administration [24,25]. Therefore, the reduction in HBVexpression observed in our in vitro studies might be insufficientin vivo in terms of efficient viral suppression. This obstacle canbe overcome by adopting one of the emerging techniques to in-crease curcumin bioavailability, such as its oral co-administrationwith the alkaloid piperine [26], its liposomal encapsulation forintravenous administration [27] or using curcumin nanoparticlesthat render curcumin completely dispersible in aqueous media[28]. However, although the feasibility of these techniques in thecontext of curcumin-induced HBV inhibition is a subject of furtherstudies, it holds promise for future use of the ‘‘golden spice” curcu-min as an efficient anti-HBV therapy that may replace, or at leastcomplement the ‘‘conventional” anti-viral drugs.

Acknowledgment

This work was supported by the following Grants: SchraiberGrant from the Sackler faculty of Medicine, Tel-Aviv University,The Weizmann–Ichilov Joint Grant and Grant No. 2007285 fromthe United States-Israel Binational Science Foundation (BSF).

References

[1] Seeger, C. and Mason, W.S. (2000) Hepatitis B virus biology. Microbiol. Mol.Biol. Rev. 64, 51–68.

[2] Ganem, D. and Prince, A.M. (2004) Hepatitis B virus infection – natural historyand clinical consequences. N. Engl. J. Med. 350, 1118–1129.

[3] Feld, J.J., Wong, D.K. and Heathcote, E.J. (2009) Endpoints of therapy in chronichepatitis B. Hepatology 49, S96–S102.

[4] Zoulim, F. (2004) Antiviral therapy of chronic hepatitis B: can we clear thevirus and prevent drug resistance? Antivir. Chem. Chemother. 15, 299–305.

[5] Finck, B.N. and Kelly, D.P. (2006) PGC-1 coactivators: inducible regulators ofenergy metabolism in health and disease. J. Clin. Invest. 116, 615–622.

[6] Yoon, J.C. et al. (2001) Control of hepatic gluconeogenesis through thetranscriptional coactivator PGC-1. Nature 413, 131–138.

[7] Shlomai, A., Paran, N. and Shaul, Y. (2006) PGC-1alpha controls hepatitis Bvirus through nutritional signals. Proc. Natl. Acad. Sci. USA 103, 16003–16008.

[8] Shlomai, A. and Shaul, Y. (2009) The metabolic activator FOXO1 binds hepatitisB virus DNA and activates its transcription. Biochem. Biophys. Res. Commun.381, 544–548.

[9] Shlomai, A. and Shaul, Y. (2008) The ‘‘metabolovirus” model of hepatitis Bvirus suggests nutritional therapy as an effective anti-viral weapon. Med.Hypotheses 71, 53–57.

[10] Aggarwal, B.B. and Sung, B. (2009) Pharmacological basis for the role ofcurcumin in chronic diseases: an age-old spice with modern targets. TrendsPharmacol. Sci. 30, 85–94.

[11] Joe, B., Vijaykumar, M. and Lokesh, B.R. (2004) Biological properties ofcurcumin-cellular and molecular mechanisms of action. Crit. Rev. Food Sci.Nutr. 44, 97–111.

[12] Kim, H.J. et al. (2009) Antiviral effect of Curcuma longa Linn extract againsthepatitis B virus replication. J. Ethnopharmacol. 124, 189–196.

[13] Kim, K., Kim, K.H., Kim, H.Y., Cho, H.K., Sakamoto, N. and Cheong, J. (2010)Curcumin inhibits hepatitis C virus replication via suppressing the Akt-SREBP-1 pathway. FEBS Lett. 584, 707–712.

[14] Li, C.J., Zhang, L.J., Dezube, B.J., Crumpacker, C.S. and Pardee, A.B. (1993) Threeinhibitors of type 1 human immunodeficiency virus long terminal repeat-directed gene expression and virus replication. Proc. Natl. Acad. Sci. USA 90,1839–1842.

[15] Romero, M.R., Efferth, T., Serrano, M.A., Castano, B., Macias, R.I., Briz, O. andMarin, J.J. (2005) Effect of artemisinin/artesunate as inhibitors of hepatitis Bvirus production in an ‘‘in vitro” replicative system. Antiviral Res. 68, 75–83.

[16] Tsvetkov, P., Asher, G., Reiss, V., Shaul, Y., Sachs, L. and Lotem, J. (2005)Inhibition of NAD(P)H: quinone oxidoreductase 1 activity and induction ofp53 degradation by the natural phenolic compound curcumin. Proc. Natl.Acad. Sci. USA 102, 5535–5540.

[17] Asher, G., Reuven, N. and Shaul, Y. (2006) 20S proteasomes and proteindegradation ‘‘by default”. BioEssays 28, 844–849.

[18] Tsvetkov, P., Reuven, N. and Shaul, Y. (2009) The nanny model for IDPs. Nat.Chem. Biol. 5, 778–781.

[19] Puigserver, P. et al. (2001) Cytokine stimulation of energy expenditurethrough p38 MAP kinase activation of PPAR[gamma] coactivator-1. Mol. Cell8, 971–982.

[20] Shlomai, A. and Shaul, Y. (2003) Inhibition of hepatitis B virus expression andreplication by RNA interference. Hepatology 37, 764–770.

[21] Sells, M.A., Chen, M.-L. and Acs, G. (1987) Production of hepatitis B virusparticles in Hep G2 cells transfected with cloned hepatitis B virus DNA. PNAS84, 1005–1009.

[22] Rhee, J., Inoue, Y., Yoon, J.C., Puigserver, P., Fan, M., Gonzalez, F.J. andSpiegelman, B.M. (2003) Regulation of hepatic fasting response byPPARgamma coactivator-1alpha (PGC-1): requirement for hepatocytenuclear factor 4alpha in gluconeogenesis. Proc. Natl. Acad. Sci. USA 100,4012–4017.

[23] Tsvetkov, P., Reuven, N. and Shaul, Y. (2010) Ubiquitin-independent p53proteasomal degradation. Cell Death Differ. 17, 103–108.

[24] Bisht, S. and Maitra, A. (2009) Systemic delivery of curcumin: 21st centurysolutions for an ancient conundrum. Curr. Drug Discov. Technol. 6, 192–199.

[25] Wahlstrom, B. and Blennow, G. (1978) A study on the fate of curcumin in therat. Acta Pharmacol. Toxicol. (Copenh.) 43, 86–92.

[26] Shoba, G., Joy, D., Joseph, T., Majeed, M., Rajendran, R. and Srinivas, P.S. (1998)Influence of piperine on the pharmacokinetics of curcumin in animals andhuman volunteers. Planta Med. 64, 353–356.

[27] Li, L., Braiteh, F.S. and Kurzrock, R. (2005) Liposome-encapsulated curcumin:in vitro and in vivo effects on proliferation, apoptosis, signaling, andangiogenesis. Cancer 104, 1322–1331.

[28] Bisht, S., Feldmann, G., Soni, S., Ravi, R., Karikar, C., Maitra, A. and Maitra, A.(2007) Polymeric nanoparticle-encapsulated curcumin (‘‘nanocurcumin”): anovel strategy for human cancer therapy. J. Nanobiotechnol. 5, 3.