characterization of the heparin-binding activity of the ... · pbsm phosphate buffer saline without...

Institute of Virology

University of Veterinary Medicine Hannover

Characterization of the heparin-binding

activity of the bovine respiratory syncytial

virus fusion protein

THESISsubmitted in partial fulfillment of the requirements for the degree

DOCTOR OF PHILOSOPHY- Ph.D. -

in the field of Virologyat the University of Veterinary Medicine Hannover

by

Diana PanayotovaDimitrova

Ruse, Bulgaria

Hannover, Germany, 2005

Supervisor: Priv.-Doz. Dr. G. Zimmer

Advisory Committee: 1. Prof. Dr. T. Schulz

2. Prof. Dr. P. Valentin-Weigand

First Evaluation: 1. Priv.-Doz. Dr. G. Zimmer, Institute of

Virology, University of Veterinary Medicine,

Hannover, Germany

2. Prof. T. Schulz, Institute of Virology,

Medical High School, Hannover,

Germany

3. Prof. P. Valentin-Weigand, Institute of

Microbiology, University of Veterinary

Medicine, Hannover, Germany

Second Evaluation: Priv.-Doz. Dr. A. Maisner, Institute of

Virology, Philipps-University, Marburg,

Germany

Date of Oral Examination: 10.11.2005

1 INTRODUCTION.............................................................................................................. 8

2 BOVINE RESPIRATORY SYNCYTIAL VIRUS (BRSV)............................................ 92.1 TAXONOMY AND CLASSIFICATION .................................................................................. 9

2.1.1 Epidemiology and clinical factors .................................................................................... 112.1.2 Pathogenesis, pathology and immune response................................................................ 112.1.3 Morphology and genome structure ................................................................................... 132.1.4 BRSV proteins .................................................................................................................. 142.1.5 RSV fusion protein ........................................................................................................... 162.1.6 Heparin binding of RSV ................................................................................................... 17

2.2 AIMS OF THE STUDY ..................................................................................................... 19

3 MATERIALS.................................................................................................................... 203.1 CELL LINES................................................................................................................... 203.2 VIRUSES AND BACTERIA ............................................................................................... 213.3 PLASMIDS ..................................................................................................................... 213.4 CELL CULTURE MEDIUM ............................................................................................... 223.5 CULTURE MEDIUM FOR BACTERIA ................................................................................ 233.6 BUFFERS AND SOLUTIONS............................................................................................. 243.7 SYNTHETIC OLIGONUCLEOTIDES................................................................................... 273.8 ENZYMES...................................................................................................................... 293.9 ANTIBODIES.................................................................................................................. 293.10 KITS.............................................................................................................................. 303.11 SUBSTRATES................................................................................................................. 303.12 TRANSFECTIONS REAGENTS.......................................................................................... 313.13 CHEMICALS .................................................................................................................. 313.14 PCR AND GEL ELECTROPHORESIS COMPONENTS........................................................... 33

4 METHODS ....................................................................................................................... 344.1 CELL CULTURE ............................................................................................................. 344.2 VIRUS PROPAGATION.................................................................................................... 35

4.2.1 BRSV................................................................................................................................ 354.3 VIRUS TITRATION ......................................................................................................... 35

4.3.1 Immunoplaque test for BRSV .......................................................................................... 354.4 REPLICATION KINETICS................................................................................................. 364.5 INFECTION INHIBITION ASSAY....................................................................................... 364.6 TRANSIENT TRANSFECTION OF MAMMALIAN CELLS...................................................... 37

4.6.1 Transfection of BSR-T7/5 cells ........................................................................................ 374.6.2 Generation of recombinant BRSV.................................................................................... 37

4.7 DNA RECOMBINATION METHODS................................................................................. 394.7.1 Polymerase Chain Reaction.............................................................................................. 394.7.2 Site-specific mutagenesis.................................................................................................. 404.7.3 Molecular Cloning............................................................................................................ 42

4.7.3.1 Cleavage of DNA with restriction enzymes ...............................................................................424.7.3.2 Recovery of DNA from agarose gels..........................................................................................424.7.3.3 Ligation.......................................................................................................................................434.7.3.4 Preparation of competent E. coli.................................................................................................444.7.3.5 Transformation of E. coli............................................................................................................454.7.3.6 Colony PCR................................................................................................................................454.7.3.7 Plasmid DNA preparation...........................................................................................................464.7.3.8 Sequencing .................................................................................................................................46

4.7.4 Construction of plasmids containing modified BRSV genomes ...................................... 474.8 METHODS FOR PROTEIN ANALYSIS................................................................................ 49

4.8.1 SDS-polyacrylamide gel electrophoresis.......................................................................... 494.8.2 Western Blotting (semi-dry blotting technique) ............................................................... 494.8.3 Immunofluorescence......................................................................................................... 504.8.4 Cell surface biotinylation and immunoprecipitation ........................................................ 50

5 RESULTS.......................................................................................................................... 525.1 GENERATION OF RECOMBINANT BRSV ........................................................................ 52

5.1.1 Modification of BRSV using reverse genetics ................................................................. 525.1.2 Mutagenesis of the F gene ................................................................................................ 545.1.3 Recombinant BRSV rescue .............................................................................................. 56

5.2 ANALYSIS OF THE BRSV MUTANTS.............................................................................. 605.2.1 Viral replication kinetics................................................................................................... 605.2.2 Effect of soluble GAGs on infection with BRSV-∆G/GFP and BRSV-GFP mutants. .... 635.2.3 Effect of heparin on infection with BRSV-∆G/GFP and BRSV-GFP mutants. ............... 645.2.4 Analysis of mutations at position K75 and K77 ............................................................... 685.2.5 Analysis of F protein cell surface transport ...................................................................... 685.2.6 Fusion activity of F mutants ............................................................................................. 70

5.2.6.1 Biotinylation and immunoprecipitation of the mutant F proteins ...............................................715.3 GENERATION OF MBP-F2 HYBRIDS.............................................................................. 72

6 DISCUSSION ................................................................................................................... 736.1 MBP-BASIC AMINO ACID EPITOPE IN F2 SUBUNIT IS NOT SUFFICIENT FOR INTERACTION WITH HEPARIN .............................................................................................................. 746.2 MOST OF THE POINT MUTATIONS IN THE PUTATIVE BINDING DOMAIN OF THE F PROTEIN DO NOT AFFECT VIRUS VIABILITY ................................................................................. 746.3 EFFECT OF DIFFERENT GAGS AS INHIBITORS OF RECOMBINANT BRSV INFECTION...... 756.4 ROLE OF K80N AND R85N MUTATIONS ....................................................................... 756.5 LYSINES AT POSITIONS 75 AND 77 OF THE F2 SUBUNIT PLAY AN ESSENTIAL ROLE FOR F PROTEIN FUNCTION....................................................................................................... 766.6 EXCHANGE OF LYSINES 63 AND 66 HAS A MODULATING EFFECT ON BRSV INFECTIVITY ................................................................................................................. 766.7 G PROTEIN MAY COMPENSATE FOR POINT MUTATIONS IN THE F2 SUBUNIT................... 776.8 RSV ATTACHMENT TO THE CELL SURFACE INVOLVES ADDITIONAL CELLULAR RECEPTOR(S) ................................................................................................................ 786.9 CONCLUSIONS .............................................................................................................. 78

7 SUMMARY....................................................................................................................... 80

8 ZUSAMMENFASSUNG ................................................................................................. 82

9 REFERENCES................................................................................................................. 84

10 SEQUENCES.................................................................................................................... 94

11 ACKNOWLEDGEMENTS............................................................................................. 96

List of abbreviations

Ab antibody

bp base pair

BRSV bovine respiratory syncytial virus

cDNA complementary DNA

CPE cytopathic effect

DNA deoxyribonucleic acid

dNTP 2´-deoxynucleoside 5’-triphosphates

DTT dithiothreitol

E. coli Escherichia coli

et al. et alii (alitar)

EDTA ethylenediamine tetraacetic acid

F protein fusion protein

FITC fluoresceinesothiocyanat

GAGs glycosaminoglycans

FCS fetal calf serum

G protein glycoprotein

HBD heparin-binding domain

h hour

HRSV human respiratory syncytial virus

kb kilo base

kDa kilo dalton

kV kilo volt

LB Luria Bertani

l liter

L protein large protein

M molar

M protein matrix protein

m milli

µ micro

min minute

mA milli ampere

ml milliliter

mM milli molar

MOI multiplicity of infection

ORF open reading frame

ng nano gram

nm nano meter

N protein nucleus protein

Nr. number

NS protein non-structural protein

nt nucleotide

OD optical density

pmol pikomol

P protein phospho protein

PAGE polyacrylamide gel electrophorese

PBS phosphate buffer saline

PBSM phosphate buffer saline without Ca2 and Mg2

pBRSV BRSV-genome in pBlueskript vector

pfu plaque forming unit

PCR polymerase chain reaction

RNA ribonucleic acid

RSV respiratory syncytial virus

RV rabies virus

RT room temperature

SDS sodium dodecyl sulfate

SH protein small hydrophobic protein

TAE tris-acetat-EDTA

Taq Thermus aquaticus

TBE tris borate EDTA

TEMED N, N, N’, N’-tetramethlethylendiamin

Introduction

8

1 Introduction

The human respiratory syncytial virus (HRSV) and the bovine

respiratory syncytial virus (BRSV) are the most common and important

causes of lower respiratory tract illness in young infants and calves leading to

bronchitis, bronchiolitis, and pneumonia. These related viruses share common

epidemiological, clinical, and pathological characteristics. More than 70% of

calves exhibit a positive serological response against BRSV by the age of 12

months.

The envelope of the respiratory syncytial viruses (RSV) contains three

glycoproteins: the attachment protein G, the fusion protein F, and the small

hydrophobic protein SH.

An attachment function has been attributed to the G protein. However

the isolation of a RSV deletion mutant (cp-52) which lacks the SH and G

proteins suggests that the F protein is sufficient to mediate attachment to

cellular receptors. The primary function of the F protein is to mediate fusion

between the viral and the cellular membrane.

The attachment of both BRSV and HRSV to the cell surface depends

on heparin-like structures. The heparin-binding activity of HRSV has been

attributed to the G protein which contains basic amino acid clusters that might

be responsible for this interaction. Apart from the G protein, the F protein was

also shown to bind to heparin. The F2 subunit of the F protein also contains a

cluster of basic amino acids. The role of this domain in virus infection was

investigated in this work.

Literature review

9

2 Bovine respiratory syncytial virus (BRSV)

2.1 Taxonomy and classification

Bovine respiratory syncytial virus (BRSV) is a negative-strand RNA virus

classified in the family Paramyxoviridae, order Mononegavirales (Collins et al.,2001)

(Table 1). Paramyxoviridae are subdivided into two subfamilies. The Paramyxovirinae

includes Sendai virus, measles virus, mumps virus, Newcastle disease virus, simian

virus 5 and human parainfluenza viruses while the second subfamily Pneumovirinae

is represented by the genera Pneumovirus and Metapneumovirus. Pneumoviruses

differ from other paramyxoviruses in several aspects: (1) eight or ten encoded

mRNAs are typical for pneumoviruses compared with six or seven for

paramyxoviruses; (2) proteins not present in paramyxoviruses are: NS1, NS2, M2-1

and M2-2; (3) pneumoviruses lack the V, D and C proteins present in some

paramyxoviruses; (4) the unusual mucin-like G attachment protein of pneumoviruses

is structurally distinct from the hemagglutinin-neuraminidase (HN) or the

hemagglutinin (H) attachment proteins of other paramyxoviruses .

The genus Metapneumovirus consists of human metapneumovirus and avian

pneumovirus (APV). These viruses lack the NS1 and NS2 genes and have a different

gene order with respect to the F and M2 genes (Collins et al.,2001).

Literature review

10

Table 1: Family Paramyxoviridae

Gen

us:

Met

a-

pneu

mov

irus

Hum

an

met

a-

pneu

mov

irus

Avia

n

pneu

mov

irus

Subf

amily

: Pneumovirinae

Gen

us:

Pneumovirus

Bov

ine

resp

irato

rysy

ncyt

ial v

irus

Hum

an

resp

irato

ry

sync

ytia

l viru

s

(RSV

)

Cap

rine

RSV

Ovi

ne

RSV

Pneu

mon

ia

viru

s of

Mic

e (P

VM)

Hen

ipa

viru

ses:

Hen

drav

irus

Nip

ahvi

rus

Tupa

ia-

Para

myx

oviru

s

Gen

us:

Mor

billiv

irus

Mea

sles

viru

s

Can

ine

dist

empe

r viru

s

Phoc

ine

dist

empe

r viru

sR

inde

rpes

t viru

s

Pest

e de

s pe

tites

-

rum

inan

ts v

irus

Gen

us:

Rub

ulav

irus

Mum

ps v

irus

Hum

an p

arai

n-

Flue

nza

viru

s

type

s 2

and

4

Sim

ian

viru

s 5

(can

ine

para

in-

fluen

za v

irus

type

2)

New

cast

le

dise

ase

viru

s

Fam

ily: Paramyxoviridae

Subf

amily

: Par

amyx

oviri

nae

Gen

us:

Res

piro

viru

s

Hum

an

par

ain-

fluen

za

viru

s

type

s 1

and

3

Bovi

ne p

ara-

influ

enza

viru

s ty

pe 3

Send

ai v

irus

Literature review

11

2.1.1 Epidemiology and clinical factors

HRSV and BRSV are closely related and show common epidemiological,

clinical and pathological characteristics. They are the most common and important

cause of lower respiratory tract illness in calves and young infants (Van der Poel et

al., 1994). BRSV was first diagnosed in 1967 by Paccoud and Jacquier in

Switzerland. The virus was first detected in Japan, Belgium and Switzerland, and it

was isolated later in England and USA (Murphy et al., 1999). The presence of BRSV

in cattle herds has been recognized worldwide (Bryson et al.,1978). Severe

respiratory symptoms in calves are almost exclusively observed during autumn and

winter seasons (Van der Poel et al., 1994; Murphy et al., 1999).

Calves that are born early in the year are most likely to suffer from the early

syndrome in their first summer before they are weaned. The clinical signs associated

with the early syndrome typically include coughing, nasal and ocular discharge, and

an elevated temperature. The severity of the early syndrome is usually quite mild and

the calves will often completely recover. However, the early syndrome can

predispose the calves to secondary bacterial infection leading to a more severe and

often fatal pneumonia. The early signs are often mild and transient and would include

such features as a high-pitched dry cough, clear nasal and ocular discharge, mild

anorexia, and mild depression (Backer et al., 1997). The later signs of this disease

are often more evident and include increased temperature, severe anorexia, and

significant weight loss. Often the eyes and surrounding tissues will swell.

2.1.2 Pathogenesis, pathology and immune response

Initially, an animal inhales the aerosolized virus. The virus is able to infect both

ciliated and nonciliated cells of the upper and lower respiratory tract. Cytopathological

changes in these cells result in a necrotizing bronchiolitis. Numerous cytokines and

chemokines are released by infected cells and serve as chemoattractants for

inflammatory cells, particularly neutrophils. BRSV is often associated with secondary

bacterial infections suggesting either an immuno-suppressive activity of the virus or a

role in producing mechanical damage allowing the entry of bacterial pathogens or a

combination of both.

Literature review

12

In experimentally infected calves the virus causes complete loss of the ciliated

epithelium 8-10 days after infection so that pulmonary clearance is compromised

facilitating secondary infections. At necropsy, subpleural and interstitial emphysema

may be seen in all lobes of the lungs. A characteristic finding is the presence of

syncytia in the lungs which are usually larger than those associated with

parainfluenza virus type 3 infection (Murphy et al.,1999).

Both cell-mediated and antibody-mediated immune responses contribute to

the efficient protection of animals. A hallmark of RSV infection is that the immune

response is short-lived and reinfections are common. Neutralizing antibodies are

induced by the F and G proteins as evaluated in calves vaccinated with recombinant

vacinia virus encoding these proteins. High titers of neutralizing antibodies are

induced by the F protein, whereas the G protein only induces a low level of

complement-dependent neutralizing antibodies (Taylor et al., 1997; Thomas et al.,

1998). Maternal antibodies are commonly present in calves but do not provide

complete protection against infection (Kimman et al., 1998). Although infection can

occur in the presence of neutralizing antibodies, they provide some protection as

high antibody titers decrease the severity of the disease in both children and calves

(Kimman and Westenbrink, 1990). Attempts to develop a vaccine against HRSV were

not successful so far. In vaccination studies, increased lung pathology was observed

after application of formalin-inactivated preparations associated with an Arthus-type

reaction, antibody mediated enhancement of macrophage infection, complement

activation, and hypersensitivity reactions. This immunopathology may be a

consequence of a predominant Th2 response of helper cells with the preferential

release of inflammatory cytokines (Murphy et al., 1999). For more than 18 years

BRSV vaccines have been developed and used in some European countries

(Valarcher et al., 2000). Modified-live virus (MVL) and inactivated single fraction and

combination vaccines are currently available; nevertheless, their efficacy and

potential disease enchancing properties remain controversial (Backer et al., 1997;

Bowland and Shewen, 2000). It has been shown that MLV and inactivated BRSV

vaccines stimulate distinctively different antibody responses in cattle. Differences in T

lymphocyte responses have also been reported, and it has been suggested that

natural infection and MLV vaccines stimulate T helper 1 (TH-1)-type responses,

whereas inactivated BRSV stimulates T helper 2 (Th-2)-type responses (Gerschwin

et al., 1998; West et al., 1999, 2000)

Literature review

13

2.1.3 Morphology and genome structure

BRSV virions include irregular spherical particles from 150 to 300 nm in

diameter (Fig. 1). Virion preparations can include a high content of filamentous forms

60 to 100 nm in diameter and up to 10 µm in length (Berthiaume et al., 1974). The

virion contains an helical nucleocapsid enveloped by a lipid bilayer derived from the

host-cell plasma membrane. BRSV lacks the hemagglutination and neuraminidase

activities present in several members of the Paramyxovirinae. However, the absence

of an hemagglutinin is not a general hallmark of pneumoviruses because PVM is able

to agglutinate erythrocytes.

Figure 1. Schematic structure of BRSV

The BRSV genome is a single-stranded, negative-sense RNA of 15 200

nucleotides, and encode 11 proteins (Fig. 2) (Buchholz et al., 1999). BRSV

transcription and replication are similar to those of other Mononegavirales members.

The viral genomic RNA is tightly encapsidated by the N protein and serves as a

template for replication and transcription. The N, P, and L proteins, together with the

RNA genome are the virus-specific components required for RNA replication

(Grosfeld et al., 1995; Yu et al., 1995). It has been shown that these components

also direct RNA transcription which in addition requires the presence of the M2-1

LP

N

GF

MRNA

SHM2

lipid envelope

Literature review

14

protein (Collins et al., 1996; Fearns and Collins, 1999 ). RNA replication involves the

synthesis of a full-length, positive-sense, encapsidated RNA, called the antigenome,

which serves as the template for the synthesis of negative-strand genomes.

Transcription initiates at the 3’ genomic promoter and copies the genes by a linear,

sequential, start-stop mode that yields subgenomic mRNAs (Kuo et al., 1996;

Zamora and Samal, 1992). Each gene begins with a conserved 10 nt start (GS) motif

that directs initiation of transcription, and ends with a 12-13 nt end (GE) motif that

directs polyadenylation and release of the mRNA (Kuo et al.,1997). For the members

of the Mononegavirales, the gene order appears to be a important factor dictating the

relative molar amounts of viral mRNAs synthesized during virus infection (Collins et

al., 1983). The efficiency of gene transcription decreases with increasing distance

from the promoter (Barik, 1992). The first nine BRSV genes are separated by

intergenic regions of variable length and sequence, the role of which in transcription

is not clear (Hardy and Wertz, 1999). The last two genes, M2 and L overlap, by 67 nt

and are expressed as separate mRNAs. The M2 mRNA contains two open reading

frames (ORFs) that slightly overlap (Collins et al.,1990) (Figure 2); the upstream

ORF1 encodes the M2-1 protein and the downstream ORF2 the M2-2 protein which

appears to be involved in regulating the balance between transcription and RNA

replication (Bermingham and Collins, 1999).

Figure 2. Schematic structure of the BRSV genome

2.1.4 BRSV proteins

The BRSV genome encodes eleven proteins:

N is the major nucleocapsid protein. It binds tightly to genomic and

antigenomic RNA.

NS1

3‘ 5‘

NS2 MPN SH G LM2-1/2F

Literature review

15

L is the major polymerase subunit.

P is the most heavily phosphorylated RSV protein. It serves as a polymerase

cofactor.

M2-1 is encoded by the 5’ proximal ORF of the M2-mRNA and serves as a

transcription elongation factor.

M2-2 is encoded by the second internal ORF of the M2-mRNA and is a

putative negative regulatory factor for replication and transcription (Bermingham and

Collins, 1999).

There are three viral transmembrane glycoproteins:

SH (small hydrophobic protein) is a small protein of unknown function

(Olmsted and Collins, 1989; Samal and Zamora, 1991). SH is dispensable for virus

replication in cell culture (Bukreyev et al., 1997). However, recombinant RSV lacking

SH are attenuated in vivo (Bukreyev et al., 1997; Whitehead et al., 1999).

G is the attachment glycoprotein, a heavily glycosylated type II membrane

protein that does not share any sequence or structural homologies with attachment

proteins of other paramyxoviruses (Satake et al., 1985; Wertz et al., 1985). It lacks

hemagglutinatin and neuraminidase activities. It shows a high degree of species- and

strain-specific antigen variation that has led to the definition of serological subgroups

(Lerch et al., 1990; Mallipedi and Samal, 1993; Furze et al., 1994). The receptor-

binding activity of the G protein was demonstrated using G-specific antibodies that

inhibited virus attachment (Levine et al., 1987).

F glycoprotein mediates membrane fusion and syncytium formation. It is the

major antigen inducing neutralizing antibodies.

M is the non-glycosylated matrix protein and has a central role in organizing

the virus envelope (Teng and Collins, 1998). Recent studies suggest that the M

protein may play a role in early stages of infection by inhibiting host cell transcription

(Ghildyal et al., 2003).

NS1 and NS2 are small proteins detected in only trace amounts in purified

virions and therefore have been considered to be nonstructural. NS1 is a putative

negative regulatory factor for replication and transcription. Recombinant RSV lacking

NS1 or NS2 are infectious and replicate in cell cultures (Collins et al., 2001) but show

marked reduction in replication efficacy in vivo (Whitehead et al., 1999; Teng et al.,

2000). These genes have been shown to function as interferon antagonists

(Schlender et al., 2000; Bossert and Conzelmann, 2002; Spann et al., 2004)

Literature review

16

2.1.5 RSV fusion protein

The RSV F protein is synthesized as a non-active precursor F0 which is

cleaved in the trans-Golgi network by the cellular protease furin. The cleavage occurs

at two conserved furin consensus cleavage sites and results in the generation of

three products: a large subunit F1 with a highly conserved hydrophobic N terminus,

the fusion peptide; the small subunit F2, and a glycosylated peptide of 27 amino

acids (pep27) (Gonzales-Reyes et al., 2001; Zimmer et al., 2001, 2002). Pep 27 was

found to be dispensable for viral replication in vitro. It is subject to additional

posttranslational modifications and is secreted by the infected cells as a biologically

active tachykinin (Zimmer et al., 2003). The two subunits F1 and F2 are arranged in a

disulfide-linked complex that represents the biologically active form of the F protein.

The F protein is a type I membrane protein that contains a hydrophobic

transmembrane domain near the C-terminus of the F1 subunit. The carboxyterminal

domain is composed of 24-amino acids and is located in the cytoplasm. The classical

role of the fusion (F) protein is to direct viral penetration by a fusion event between

the viral envelope and the host cell plasma membrane whereby the nucleocapsid is

delivered into the cytoplasm. In addition, when the F protein is expressed on the cell

surface of infected cells, it mediates fusion with neighboring cells resulting in giant,

multinucleated syncytia.

The pneumovirus and paramyxovirus F proteins do not show significant

sequence similarity (Collins et al., 1984). However, in both genera the fusion proteins

have similar structural features like a similar length, and the location of hydrophobic

domains, heptad repeats, and cysteine residues. A common feature of fusion

proteins is that upon proteolytic activation an hydrophobic fusion peptide is exposed

that triggers the fusion reaction (Dutch et al., 2000). The RSV F protein can mediate

entry and syncytium formation in the absence of other RSV proteins. This feature

discriminates it from most other paramyxovirus fusion proteins which require the

assistance of the homologous attachment protein to show fusion activity. Although

the RSV F protein can mediate syncytium formation by itself, coexpression of the G

and SH proteins has been shown to increase fusion efficiency (Heminway et al.,

1994).

Literature review

17

2.1.6 Heparin binding of RSV

Heparan sulfate and chondroitin sulfate B belong to a group of

glycosaminoglycans (GAGs). These two types GAGs are major binding sites for

respiratory syncytial virus on the cell-surface. Glycosaminoglycans are unbranched

polymers of repeating disaccharide units. Some of them are found as a

proteoglycans covalently linked to membrane proteins on the cell surface of most

mammalian cells. One of the prominent physico-chemical properties of GAGs is the

presence of a large and varying number of negative charges. Heparin is frequently

used as a convenient analog of heparin sulfate for experimental purposes (Lindahl et

al., 1994). The heparin-binding properties of RSV were reported for the first time by

Krusat and Streckert in 1997, who showed that heparin is a potent antagonist of RSV

infection. A cellular protein receptor for RSV has not been identified, however there is

evidence that cell surface glycosaminoglycans (GAGs) are important for efficient

infection, at least in vitro. It was shown that RSV infection can be inhibited by

preincubation of the virus with soluble GAGs such as heparin. In addition, RSV

infection was significantly reduced following treatment of the cells with enzymes that

remove GAGs from the cell surface. It was also shown that mutant cell lines with

defects in GAGs synthesis are not efficiently infected by RSV (Krusat and Streckert,

1997; Bourgeois et al., 1998 Hallak et al., 2000; Karger et al., 2001; Techaarpornkul

et al., 2002). Binding of RSV to GAGs is primary mediated by the G protein (Krusat

and Streckert, 1997). Feldman et al. (1999) suggested that region with clusters of

positively charged amino acids that share similarity with heparin-binding domains

from other viral and mammalian proteins represents the major GAG-binding domain.

However, subsequent studies using recombinant viruses showed that this site can be

deleted without affecting infectivity or susceptibility to neutralization by soluble GAGs

(Teng and Collins, 2002). Analysis of the G protein C-terminus revealed that the

postulated heparin-binding domain expands to residue 187-231 (Shields et al., 2003)

confirming the work of Teng and Collins (2002) that the HBD is not confined to the

previously reported residues 184-198 (Feldman et al., 1999). Another report

suggested that heparin-like structures associated with the G protein are involved in

RSV infection (Bourgeois et al., 1998), but these data have not been confirmed.

It was shown that heparan sulfate and dermatan sulfate are the two cell

surface GAGs which are important for efficient RSV infection (Hallak et.al., 2000a).

The common feature of these GAGs is the presence of iduronic acid (IdUA). Three

Literature review

18

other GAGs that do not contain IdUA did not inhibit RSV infection. Furthermore,

sulfation at specific GAG positions and the length of the saccharide chains have also

been found to be important for RSV infection (Hallak et al., 2000b).

The observation that the biologically derived cold-passaged mutant cp-52

which lacks the G and the SH proteins is still dependent on heparin suggests that the

F protein also binds to GAGs on the cell surface to initiate infection (Feldman et al.,

2000). A similar observation was made when the G gene was deleted from HRSV

and BRSV (Karger et al., 2001; Techaarpornkul et al., 2002). When the GAG

dependence of a recombinant virus with F protein as its only glycoprotein was

compared to an isogenic virus containing the complete genome, it turned out that

attachment and infection by both viruses required cell surface heparan sulfate. All

these data suggest that both G and F protein bind to HS. A region in the F protein

responsible for heparin binding have not been identified so far.

Literature review

19

2.2 Aims of the Study

As outlined in the literature review above, the currently available data on the

mechanisms of RSV interaction with the cell surface do not provide a complete

picture of the receptor-binding properties of the virus. However, there is evidence that

the F protein of RSV plays a role not only in fusion, but also in attachment to the cell

surface. This interaction probably includes recognition of cell surface

glycosaminoglycans.

A better understanding of the interaction of the F protein with heparin-like

structures requires analysis of the precise location, distribution and structure of its

heparin-binding domains. The identification of putative heparin-binding domains in

the F protein as well as the identification of additional receptors will provide the

possibility to develop therapeutics that block RSV infection.

The present study was based on the working hypothesis that a cluster of basic

amino acids in the F2 subunit of the BRSV fusion protein is involved in heparin-

binding. Evidence for this hypothesis are: 1) the cluster of basic amino acids in the F2

subunit shows similarity with other heparin-binding domains (HBDs); 2) the F2

subunit determines species specific infection of HRSV and BRSV, respectively; 3)

only F2 subunit contains variable regions in F protein.

Aim of this study was the characterization of the basic domain in the F2

subunit of BRSV using site-directed mutagenesis. By generation of recombinant

viruses the effect of the mutations on virus infection and replication was studied.

Materials and methods

20

3 Materials

3.1 Cell lines

BHK-21-cellsAn established cell line derived from baby hamster kidney. The cell line was

provided by the Institute for Virology, University of Veterinary Medicine Hannover.

Vero cellsAn established cell line derived from African Green Monkey. The cell line was

provided by the Institute for Virology, University of Veterinary Medicine Hannover.

BSR T7/5 cells This cell line is derived from the BHK-21 cell line. The cells stably express T7

RNA polymerase (Buchholz et al., 1999). The cell line was provided by Dr.

Conzelmann, Max-von-Pettenkofer-Institute, München.

PT-cellsAn established cell line derived from calf kidney epithelia. The cell line was

provided by Dr. Riebe, Federal Research Institute of Animal Health, Insel Riems.


21

3.2 Viruses and bacteria

Bovine respiratory syncytial virusBRSV ATue 51908 was provided by Dr. Conzelmann, Max-von-Pettenkofer-

Institute, München.

XL1-Blue E. coliIn this work, the XL1-Blue E. coli cells purchased from Stratagene company

were used for propagation of plasmids.

3.3 Plasmids

pTM1 This plasmid contains a T7 promoter and a T7 termination signal. It contains

also IRES from EMC (Moss et al., 1990) and was used for cytoplasmic expression in

cells with T7 RNA polymerase.

pCR 3.1This plasmid was purchased from Invitrogen company was used for

expression in mammalian cells.

pcR 2.1This plasmid purchased from Invitrogen company was used as a TA cloning

vector.

pBluescript-BRSV (pBRSV)This plasmid contains the complete genome of BRSV strain ATue51908. The

vector was provided by Dr. Conzelmann from Max-von-Pettenkofer-Institute.


22

3.4 Cell culture medium

DMEM (Dulbecco’s Minimal essential medium), pH 6,9

DMEM powder 13.53g

NaHCO3 2.2g

dH2O to1l

Double concentrated DMEM, pH 6.9

Edulb powder 27.06 g

NaHCO3 4.4 g

dH2O to1 l

EMEM (Eagle’s Minimum Essential Medium), pH 7

EMEM powder 9.6 g

NaHCO3 2.2 g

dH2O to 1 l

The powder was provided from GIBCO BRL Life Technologies company. Per

liter of medium were added 0.05 g of streptomycin sulfate and 0.006 g of penicillin G

(Sigma).

Versen-Trypsin 0.125%, pH 7.0

NaCl2 8.0 g

KCl 20 g

Na2HPO4 x 12 H2O 2.31 g

KH2PO4 x 2 H2O 0.20 g

CaCl2 0.13 g

MgSO4 x 7 H2O 0.10 g

Tyrosine 1.25 g

Versen (EDTA) 1.25 g

Streptomycin 0.05 g

Penicillin 0.06 g


23

dH20 to 1 l

All reagents were sterile-filtrated.

MEM (2X ) with glutamine GIBCO BRL Life Technologies

Fetal calf serum (FCS) Biochrom

Not essential amino acids Biochrom

Pyruvate Invitrogen

3.5 Culture medium for bacteria

LB-medium, pH 7.0

Trypton 10 g

NaCl2 10 g

Yeast extract 5 g

dH2O to 1 l

For preparation of LB agar, 20 g of agar-agar to 1 liter LB-medium was added

and autoclaved. When the medium was cooled to 50°C, ampicillin (50mg/ml) was

added (final concentration 50µg/ml) and the medium was poured into petri dishes.

SOC mediumTrypton 2%

NaCl2 10 mM

Yeast extract 0.5%

KCl2 2.5 mM

MgCl2 x 6 H2O 10 mM

Glucose 20 mM


24

3.6 Buffers and solutions

10 X TBE bufferTRIS 108 g

Boric acid 53.4 g

EDTA 7.4 g

dH2O to 1 l

10 X TAE buffer, pH 8.0

TRIS 40 mM

Sodium acetate X 3 H2O 20 mM

dH2O to 1 l

PBS, pH 7.5

NaCl 8 g

KCl 0.2 g

Na2HPO4 1.15 g

KH2PO4 0.12 g

MgCl2 x 6 H2O 0.1 g

CaCl2 x 2 H2O 0.132 g

dH2O to 1 l

PBSM, pH 7.5

NaCl 8 g

KCl 0.2 g

Na2HPO4 1.15 g

KH2PO4 0.12 g

dH2O to 1 l

PBSM 0.1 % TweenPBSM 1 l

Tween-20 2 ml


25

SDS running buffer for PAGE (10X stock solution)

SDS 10 g

Tris 30 g

Glycin 144 g

dH20 to 1 l

Stacking gel for PAGEacrylamide/bisacrylamide 30% 0.83 ml

1 M Tris-HCl, pH 6.8 0.63 ml

10% SDS 50 µl

10% ammonium persulfate (APS) 50 µl

TEMED 10 µl

Separating gel 10%

acrylamide/bisacrylamide 30% 3.3 ml

1 M Tris-HCl, pH 8.8 2.5 ml

10% SDS 100 µl

10% ammonium persulfate (APS) 100 µl

TEMED 16 µl

H2O 4 ml

SDS sample buffer (2X)1 M Tris HCl, pH 6.8 100 mM

SDS 4%

Glycerol 20 %

Bromophenol blue 0.02 %

Anode buffer I, pH 9.0

1 M Tris 300 ml

Ethanol or Methanol 200 ml

H2O 500 ml


26

Anode buffer II, pH 7.4

1 M Tris 25 ml

Ethanol 200 ml

H2O 775 ml

Cathode Buffer, pH 9.0

Amino-n-caproic acid 5.25 g

1 M Tris 25 ml

Ethanol 200 ml

H2O 775 ml

Fixation solution for protein gelsMethanol 400 ml

concentrated acidic acid 100 ml

H2O 500 ml

NP40-lysis bufferSodium deoxycholate 0.5 %

Nonidet P40 1%

Tris HCl, pH 7.5 50 mM

NaCl2 150 mM

Protease inhibitor „Complete“ 1 tabl

Phosphate buffer, pH 7

Na2HPO4 50 mM

NaH2HPO4 50 mM

Sodium acetate buffer, pH 5.5

Sodium acetate 150 mM

MgSO4/HEPES bufferMgSO4 100 mM

HEPES 50 mM


27

CaCl2 buffer, pH 7.0

CaCl2 0.9 g

Glycerin 15 ml

Pipes 0.3 g

dH2O to 100 ml

3.7 Synthetic oligonucleotides

The following oligonucleotides were synthesized by MWG, Ebersberg.

Used synthetic oligonuceotides:

N Name Sequence

1 PVM-F2-S TTTTGAATTCAATACATTAACAGAAAAATACTATGAG

2 PVM-F2-AS TTTTGTCGACTCACCTCTTCTTCCTTTTGGACTTCAA

3 Mal-S GAGCGGTCGTCAGACTGTCGATG

4 MBP-hF2-AS3 TTTTGTCGACTCATCTTCTGGCTCGATTGTTTGCTGCTGGTGTGCT

5 F2-Mal-S TTTGAATTCTGTTTTGCTTCTAGTCAAAAAACATCAC

6 hF2(K80N)-AS TCTAATTCTTTGGTTTATCAGATTTTCGTTGGC

7 hF2(K80N)-S AATCGTATAAACCAAGAATTAGATAAATATAAAAATGC

8 Bdouble-S AGTACTGATTCAAACGTGAACTTAATAAAGCAAGAACTA

9 Bdouble-AS TTGCTTTATTAAGTTCACGTTTGAATCAGTACTTTTACA

10 GFP-ins-S GTTGGGGCAAATACAAGTATGGTGAGCAAGGGCGAGGAGCTGTTC

11 GFP-ins-AS TTATATGGAGGTGTGTTGTTACTTGTACAGCTCGTCCATGCCGAGAG

T

12 bGdel-AS CTCGCCCTTGCTCACCATACTTGTATTTGCCCCAACATCTGTATGTAA

13 bGdel-S GACGAGCTGTACAAGTAACAACACACCTCCATATAATATCAATTA

14 bF(K63/66N)-S ATAGAGTTGAGCAACATACAAAACAATGTGTGTAAAAGTACT

15 bF(K63/66N)-AS TTTACACACATTGTTTTGTATGTTGCTCAACTCTATTGTTAC

16 bFmut(70)S AACAATGTGTGTAACAGTACTGATTCAAAAGTG

17 bFmut(70)AS TGAATCAGTACTGTTACACACATTGTTTTGTAT


28

18 bF(75)S AGTACTGATTCAAACGTGAAATTAATAAAGCAA

19 bF(75)AS TATTAATTTCACGTTTGAATCAGTACTTTTACA

20 bF(77)S GATTCAAAAGTGAACTTAATAAAGCAAGAACTA

21 bF(77)AS TTGCTTTATTAAGTTCACTTTTGAATCAGTACT

22 bF(80)S GTGAAATTAATAAACCAAGAACTAGAAAGATAC

23 bF(80)AS TTCTAGTTCTTGGTTTATTAATTTCACTTTTGA

24 bF(85)S CAAGAACTAGAAAATTACAACAATGCAGTAGTG

25 bF(85)AS TGCATTGTTGTAATTTTCTAGTTCTTGCTTTAT

27 BRSV(PflMI) ATCCAATCAAGTACAGCATACACC

28 HF(XhoI)S TATACTCGAGACAATGGAGTTGCCAATCCTCAAAGCAAATGC

29 HF-TM(NehI)-AS TATAGCTAGCTCAGTTACTAAATGCAATATTATTTATAC

30 PCR3.1 (BGHrev.) TAGAAGGCACAGTCGAGG

31 BF-AS(EcoRi) ACTGAGAGGTGTGGTAATACC

32 BF63-S ATAGAGTTGAGCAACATACAAAAAAATGTGTGT

33 BF63-AS ATTTTTTTGTATGTTGCTCAACTCTATTGTTAC

34 BF66-S AGCAAAATACAAAACAATGTGTGTAAAAGTACT

35 BF66-AS TTTACACACATTGTTTTGTATTTTGCTCAACTC

36 BF(75/77/80)-S AGTACTGATTCAAACGTGAACTTAATAAACCAAGAA

37 BF(75/77/80)-AS TTCTAGTTCTTGGTTTATTAAGTTCACGTTTGAATC

Table 2. Used synthetic oligonuceotides.


29

3.8 Enzymes

NheI New England Biolabs

NotI MBI Fermentas

SpeI New England Biolabs

BstE II New England Biolabs

Eco R I MBI Fermentas

XhoI MBI Fermentas

T4 DNA Ligase (5 U/µl) MBI Fermentas

Pfu DNA Polymerase MBI Fermentas

Taq DNA Polymerase MBI Fermentas

calf intestine alkaline

phosphatase (CIAP)

MBI Fermentas

Streptavidin-peroxidase (HRP)-complex Amersham/Pharmacia

Endoglycosidase H (Endo H) Calbiochem

N-glycosidase F (1U/µl) Roche

3.9 Antibodies

Name Provided by:

Mouse anti-RSV polyclonal antibody Biosoft

Mouse anti-RSV F monoclonal N4

antibody

provided by Dr. G. Taylor, Compton, England


antibody



antibody


18G6 anti-RSV matrix protein

monoclonal antibody

provided by Dr. Zimmer, Institute of Virology,

TiHo


30

anti-mouse IgG, biotin conjugate SIGMA

Peroxidase-conjugated rabbit anti-

mouse immunoglobuline

DAKO

Rabbit Anti-F2-MBP New England Biosoft

anti-HRSV monoclonal antibody Serotec, Oxford, United Kingdom

anti-MBP antibody, peroxidase

conjugate

Sigma

3.10 Kits

QIAquick PCR Purification Kit Qiagen

QIAquick Gel Extraction Kit Qiagen

Rneasy Mini Kit Qiagen

QIAfilter Plasmid MIDI und MAXI Kit Qiagen

Qiaex II Gel Extraction Kit Qiagen

Original TA Cloning Kit Invitrogen

BCA Protein Assay Pierce

Expand Reverse Transkriptase Roche

3.11 Substrates

BM Chemiluminescence

Blotting Substrate (POD)

Roche

Super Signal West Dura Pierce


31

3.12 Transfections reagents

SuperFect Transfection Reagent Qiagen

Lipofectamine 2000 Reagent GibcoBRL

Exgene 500 Fermentas

3.13 Chemicals

Name Company

Acetone Roth

Acrylamide 30% Roth

Agar-Agar Roth

Agarose Biozym

Amino-n-caproic acid Sigma

Ammoniumpersulfate (APS) Bio-Rad

Blocking reagent Roche

Boric acid Roth

CaCl2 Roth

Protease inhibitor cocktail-Complete Roche

1,4-dithiothreitol (DTT) Roth

EDTA Roth

Acidic acid Roth

Ethanol Merck

Ethidium bromide Sigma

Glucose Roth

Glycerol Roth

Glycine Roth


32

G418 sulfate (geneticin) Calbiochem

Yeast extract Roth

HEPES Roth

2-propanol Roth

Potassium dihydrogen phosphate Roth

Potassium chloride Roth

Leupeptin Roche

Magnesium chloride Roth

Magnesium sulfate Roth

2-Mercaptoethanol Fluka

Methanol Roth

Methylcellulose Sigma

Mowiol Calbiochem

Sodium acetate Merck

Sodium chloride Roth

Sodium deoxycholate Roth

Sodium dodecyl sulfate (SDS) Roth

Sodium hydrogen phosphate Roth

Sodium hydroxide Roth

TEMED Roth

Nonidet 40 Roche

Paraformaldehyde Fluka

Pepstatin Roche

Sucrose Roth

Sea plaque agarose Biozym


33

Tris-Hydroxymethylaminomethane Roth

Triton X-100 Roth

Trypton Roth

Tween-20 Roth

3.14 PCR and gel electrophoresis components

Name Company

2´-deoxynucleoside 5’-triphosphates

(dNTPs)

MBI Fermentas

Gene Ruler 100bp leader Plus DNA

marker

MBI Fermentas

Lambda DNA EcoRI/HindIII DNA marker MBI Fermentas

6 x loading dye solution MBI Fermentas


34

4 Methods

4.1 Cell culture

The mammalian cells were cultivated in 75cm2 tissue culture dishes (Nunc)

and were passaged twice per week. The cells were washed with PBSM and treated

with Versen-Trypsin for 5-15 minutes at 37°C. Afterwards the cells were resuspended

in a small volume of medium and diluted 1:40. The cultures were incubated at 37°C

in a humidified incubator aerated at 5% CO2 .

BHK-21 cells

The baby hamster kidney cell line BHK-21 was maintained in EMEM

supplemented with 5% FCS and 1% non-essential amino acids.

BSR-T7 cells

The cells were maintained in EMEM supplemented with 5% FCS and G418

Geneticin was added to the medium (a selective antibiotic for the T7 RNA

polymerase expressing cells).

PT-cells

This cell line was maintained in EMEM supplemented with 5-10% FCS, 1%

non-essential amino acids and 1% pyruvate.

Vero cells

The green African monkey kidney cell line was maintained in DMEM

supplemented with 5% FCS.


35

4.2 Virus propagation

4.2.1 BRSV

BRSV was propagated on Vero cells. Twenty-four hours before infection the

cells were treated with Versen-Trypsin and seeded at a concentration of 250.000

cells/ml in 25 cm2 tissue culture dishes (5 ml of cell suspension/dish). The cultures

were incubated for 20-24 hours at 37°C. The medium was removed and the cells

were infected at a multiplicity of infection (MOI) of 0.1 pfu/cell. Following incubation

for 3 hours at 37° C, the virus was removed, complete growth medium was added

and the cells were further incubated for 4-5 days at 37°C. The cells were daily

monitored for syncytia formation. When an extensive cytopathic effect was detected,

virus was released by freezing and thawing, followed by centrifugation at 3000 x g for

10 min at 4°C. The virus was frozen in liquid nitrogen in the presence of 10%

MgSO4/HEPES buffer (100 mM MgSO4 /50 mM HEPES), and stored at –80° C.

4.3 Virus titration

Virus infectious titers were determined by plaque assay. Monolayers of

cultivated cells were infected with serial virus dilutions and incubated with medium

containing either agarose or methylcellulose. When the primary infected cell released

progeny virus, their spread in the culture was restricted to the adjacent cells. As a

result, each infectious particle produced a distinct area of infected cells – a plaque.

To enhance the contrast between the plaque and the surrounding monolayer, the

cells were stained. The titer was expressed as plaque-forming units per ml (pfu/ml).

4.3.1 Immunoplaque test for BRSV

Vero cells were treated with Versen-Trypsin and seeded on 96-well micro-titer-

plates (200.000 cells/ml). The cells were 80-100 % confluent at the time of infection.

Serial 10-fold dilutions (10-2-10-6) of the virus were prepared and 50 µl of each


36

dilution were added in duplicates to the cell monolayers. The cells were incubated

with rocking for 3 hours at 37°C and 200 µl 0.9 % methylcellulose in DMEM with 2 %

FCS was added to each well. The microtiter plates were incubated for 2 days at

37°C. After removal of the methylcellulose and two wash steps with PBS buffer, the

cells were fixed with 3% paraformaldehyde for 20 min at room temperature. In order

to inactivate the paraformaldehyde the cells were washed twice with PBS buffer

containing 0.1 M glycine. After permeabilization with 0.2% Triton X-100 for 5 minutes,

the cells were incubated for 90 min with the 18G6 antibody directed against the

BRSV M protein. After two washing steps the cells were incubated for one hour with

peroxidase conjugated IgG anti-mouse antibody. The infected cells were stained by

incubating the cells for 10 min with AEC peroxidase-substrate. The plaques were

counted under a light microscope.

4.4 Replication kinetics

Four hours before infection, Vero cells were treated with Versen-Trypsin and

seeded on 6 well plates at a density of 0.5 x 106 cells per well. The cells were

infected with recombinant BRSV at a multiplicity of infection of 0.1 pfu per cell. The

cells were incubated with rocking for 3 hours at 37°C. Afterwards, the cells were

washed three times with PBS and fresh medium was added. The plates were

incubated at 37°C. From each well 0.4 ml samples were taken at 24, 48, 72, 96, 120

and 144 hours post infection, respectively, and frozen in liquid nitrogen in the

presence of 10% MgSO4/HEPES. The virus samples were stored at –80°C. The virus

titers were determined by immunoplaque test (see 4.3.1.)

4.5 Infection inhibition assay

Heparin from bovine intestinal mucosa, chondroitin sulfate A from bovine

trachea, chondroitin sulfate B (dermatan sulfate) from porcine intestinal mucose,

chondroitin sulfate C from shark cartilage, hyaluronic acid from bovine vitreous


37

humor and dextran sulfate were diluted in PBS. The different GAGs (final

concentrations of 0.25, 2.5 and 250 µg/ml, respectively), were incubated with

recombinant BRSV for 1.5 h at 37°C prior to addition to Vero cells seeded on 12 mm

cover slips. Following incubation for 1.5 h at 37°C the infected cells were washed

with PBS and covered with methylcellulose in DMEM containing 2 % FCS. Infected

cells were detected at 72 hours post infection by fluorescence microscopy (see

4.8.3). The number of GFP expressing cells was determined. The ratio of infected

cells in the presence of inhibitor to infected cells in the absence of inhibitor was

calculated.

4.6 Transient transfection of mammalian cells

4.6.1 Transfection of BSR-T7/5 cells

BSR-T7/5 cells were transfected with pTM1 plasmids The day before

transfection 2-3 x 105 cells per well were seeded in a volume of 2.5 ml of medium.

DNA (1 µg) was diluted in medium without serum. The respective transfection

reagent was diluted into antibiotics and FCS free medium and incubated at room

temperature. The diluted DNA and transfection reagent were mixed and further

incubated at room temperature. The DNA-transfection reagent complex was added to

the cells and incubated for 24-48 hours at 37°C.

4.6.2 Generation of recombinant BRSV

Transfection of BSR T7/5 cells was performed with SuperFect transfection

reagent. The day before transfection 2-3 x 105 cells per well were seeded in a volume

of 2.5 ml of EMEM medium. The cells were 60-80% confluent on the next day. At the

day of transfection, 11 µg DNA 5 µg pBRSV containing respective modified BRSV

genome (see 4.7.4), 2 µg pP, 2 µg pN, 1 µg pM2, 1 µg pL were diluted in cell growth

medium (containing no serum, proteins or antibiotics) to a give a final volume of 300


38

µl to which 60 µl SuperFect transfection reagent were added. After following

incubation for 10 min at room temperature, 2 ml medium with FCS was added to

each DNA mix and one ml volume from the mixture was added to each well. After 3

hours incubation at rocking conditions the inoculum was removed from the cells and

fresh medium containing serum and antibiotics was added. Transfected cells were

split twice, and nine days post transfection viral replication was detected by GFP

expression. The recombinant virus was released from the BSRT7/5 cells by freezing

and thawing and clarified supernatant was used for propagation of the virus on Vero

cells. Five days post infection the infected Vero cells were frozen and thawed and the

cell supernatant containing recombinant virus was clarified and stored at –80 °C.


39

4.7 DNA recombination methods

4.7.1 Polymerase Chain Reaction

The polymerase chain reaction (PCR) was used to amplify segments of

double-stranded DNA by a thermostable DNA polymerase (Taq DNA polymerase or

Pfu DNA polymerase).

For a standard PCR the following reagents were mixed:

1. H2O 33 µl

2.enzyme buffer (10-fold concentration) 5 µl

3. dNTPs (10 mM) 1 µl

4. forward primer (10µM) 2.5 µl

5. reverse primer (10µM) 2.5 µl l

6. template DNA (20 ng/µl) 1-5 µl

7. Taq DNA polymerase (1-5 units/µl) 2 units

The standard reaction conditions for PCR were.

1 cycle 95°C 2 min denaturation

95°C 60 sec denaturation

10 cycles 56°C 30 sec annealing

72°C 70 sec polymerization


15 cycles 54°C 30 sec annealing

72°C polymerization 0.5 min/1 kb (Taq)

2 min/1kb (Pfu)

1 cycle 72°C 7 min polymerization


40

The PCR products were analyzed by agarose-gel electrophoresis and

subsequent staining with ethidium bromide.

4.7.2 Site-specific mutagenesis

Site-specific mutagenesis was used in this work to generate modified BRSV F

proteins containing point mutations in the F2 subunit. Lysine and arginine residues in

the putative heparin binding domain were exchanged by asparagine. Three PCR

reactions with two primer pairs were used to create a site-specific mutation (Fig. 3).

One pair of primers (A and B) was used to amplify DNA that contains the mutation

site together with upstream sequences. The second pair of primers (C and D) was

used in a separate PCR to amplify DNA that contains the mutation(s) site together

with downstream sequences. The mutation(s) of interest was located in the

overlapping region of the amplified fragments. The fragments were mixed, denatured,

annealed to each other, and incubated with Pfu polymerase to obtain a complete

double strand cDNA. In a third PCR, this cDNA was amplified with two primers (A

and D) that bind to the extreme ends of the fragments.

Figure 3. Scheme of the site-specific mutagenesis


41

Table 3 summarizes the primers used to generate the indicated mutations in

the F2 subunit.

Mutation Primer B Primer C

K63N 32 33

K66N 34 35

K75N 18 19

K77N 20 21

K80N 22 23

R85N 24 25

K63/66N 14 15

K75/77N 8 9

K75/77/80N 36 37

Table 3. Primer pairs used for site-specific mutagenesis

Denaturation-hybridization step

In order to join the 5´ and 3´ ends of the target gene the overlapping fragments

were mixed, denatured, and annealed to generate heteroduplexes that were

extended. In a PCR tube were mixed:

1. amplification product PCR 1 approx. 100 ng

2. amplification product PCR 2 approx. 100 ng

3. enzyme buffer (10x) 5 µl

4. dNTPs (10 mM) 1 µl

5. Pfu DNA polymerase 1 µl

6. H2O to 50 µl


42

Conditions



cycles 2 60°C 60 sec annealing

72°C 2 min polymerization


4.7.3 Molecular Cloning

The following plasmid vectors were used for molecular cloning in this work:

pTM1, pCR3.1, pBluescript-BRSV (pBRSV) and pCR 2.1.

4.7.3.1 Cleavage of DNA with restriction enzymes

Restriction endonucleases are bacterial enzymes that recognize specific 4- to

8-bp sequences (restriction sites), and cleave both DNA strands at this site. In order

to insert a foreign sequence in a plasmid vector both DNA molecules were treated

with appropriate restriction enzymes. Different temperatures and incubation times

were used in order to meet the particular reaction conditions. For digestion of plasmid

DNA, 2-10 µg were used and the reaction was performed for 1-3 hours with 1-2 units

of the respective enzyme. PCR fragments were treated with 2 units of enzyme for 16-

18 hours.

4.7.3.2 Recovery of DNA from agarose gels

DNA molecules cleaved with endonucleases were separated by agarose

electrophoresis. A gel containing 0.8% agarose in TAE buffer was prepared. The

DNA samples were mixed with gel-loading buffer and loaded into the slots of the gel

as follows: in the first slot- a molecular DNA marker was added. The second received

an aliquot of the sample, the third slot was left free, and into the next couple of slots


43

the remaining sample was applied. The electrophoresis was carried out at 80V for 1

hour. The first part of the gel containing the molecular marker and one slot with

sample was carefully cut with a scalpel and stained with a solution of ethidium

bromide for 5 min. The stained gel was illuminated with ultraviolet light and the

regions of the gel containing the DNA fragments were marked. The corresponding

region was cut from the unstained part of the gel and collected in tubes. The

extraction of the DNA fragments was performed with the QIAquick gel extraction kit

or the QIAex II gel extraction kit (Qiagen). DNA concentration was photometrically

determined at 260 nm.

4.7.3.3 Ligation

The purified PCR fragment was ligated with the treated purified plasmid DNA

under the following condition:

1. PCR DNA fragment 7-15 ng

2. vector DNA 1-5 ng

2. 10x ligase buffer 1-4 µl

3. Bacteriophage T4 DNA ligase 1-4 µl

4. H2O to 10-40 µl

A molar ratio of plasmid vector to PCR DNA fragment of 1:1 to 1:6 was used.

The ligation reaction was performed for 1 hour at room temperature or for 16-18

hours at 14°C.


44

4.7.3.4 Preparation of competent E. coli

Chemicompetent E. coli

E.coli XL-1Blue were used for preparation of chemically competent bacteria.

A single bacterial colony was picked from an agar plate and propagated in 50 ml of

LB medium overnight at 37°C with vigorous agitation. The overnight culture was used

to inoculate 1l of LB medium which was incubated for 3 hours at 37°C with agitation.

When the optical density at 600 nm reached 0.5 the bacterial cells were transferred

to 50 ml centrifugation tubes and cooled on ice for 10 minutes. The cells were

pelleted by centrifugation at 2800 g for 10 minutes at 4°C and resuspended in 12.5

ml ice-cold CaCl2 buffer. After centrifugation as above the cell pellet was

resuspended in 2.5 ml of ice-cold CaCl2 buffer. The cell sediment was aliquoted and

frozen in liquid nitrogen and stored at –80°C.

Electrocompetent bacteria

E.coli XL-1Blue were used for preparation of electrocompetent bacteria. A

single colony of E. coli from a was picked from an agar plate and propagated in 50 ml

of LB medium overnight at 37°C with vigorous agitation. The overnight culture was

used to inoculate 1l of LB medium which was incubated at 37°C with agitation. When

the OD600 of the culture reached 0.4, the flasks was transferred to an ice-water bath

for 15 minutes. Bacteria were harvested by centrifugation for 15 minutes at 4°C. The

cell pellet was resuspended in 1 l of ice-cold H2O and again subjected to

centrifugation. The supernatant was decanted and the cells were resuspended in 500

ml of ice-cold 10% glycerol. The cells were sedimented by centrifugation and

resuspended in 20 ml of ice-cold 10% glycerol, and again pelleted by centrifugation.

The pellet was resuspended in 2 ml of ice-cold 10 % glycerol. The cell sediment was

aliquoted and frozen in liquid nitrogen and stored at –80°C.


45

4.7.3.5 Transformation of E. coli

Transformation of E. coli by electroporation

Electrocompetent cells were thawed on ice. Plasmid DNA in a volume of 1-2 µl

was added (10 pg to 25 ng) to the bacteria. The electroporation apparatus was set to

25 µF capacitance, 2.5 kV voltage, and 200 Ohm resistance. The DNA/cell mixture

was transferred into a pre-cooled electroporation cuvette. The dry cuvette was placed

in the electroporation device and a pulse of electricity was delivered to the cells for 4-

5 milliseconds with a field strength of 12.5 kV/cm. After the pulse, the electroporation

cuvette was removed and 1 ml of LB medium was added at room temperature. The

cells were transferred to a polypropylene tube and the cultures were incubated for 1

hour at 37°C with rotation. A volume of 100 µl from the transfected bacteria were

plated onto LB agar containing ampicillin (50µg/ml) and incubated for 16-18 hours at

37°C.

Heat-shock transformation of E. coli

Plasmid DNA (1-50ng) was added to 100 µl of chemicompetent E. coli and

incubated on ice for 30 min. The bacteria were heated at 42 °C for 30 sec in a water

bath. The tubes were rapidly transferred to an ice bath and cooled for 5 min. 250 µl

SOC or LB medium was added and the cultures were incubated for 30-60 min at

37°C to allow the bacteria to recover and to express the antibiotic resistance marker

encoded by the plasmid. 100 µl of the culture were plated onto LB agar medium

containing ampicillin and incubated for 16-18 hours at 37°C.

4.7.3.6 Colony PCR

To test for the presence of recombinant plasmid, colonies of transfected E. coli

were analyzed by PCR using appropriate primers. A PCR master mix was prepared

of which each PCR tube received 15µl.

For each reaction the following reagents were used:

1. H2O 12.2 µl

2.enzyme buffer (10x) 1.5 µl


46

3. dNTPs (10mM) 0.3 µl

4. forward primer (10 µM) 0.45 µl

5. reverse primer (10 µM) 0.45 µl

6. Taq DNA polymerase 5 units/µl 0.1 µl

A single E. coli was picked with a sterile pipette tip and dispersed first into the

reaction mix and then into a 1.5 ml tube containing 250 Ml of LB-medium. The PCR

reaction was performed under the following conditions:



20 cycles 56°C (-0.2) 30 sec annealing

72°C 60 sec polymerization


The PCR products were run on an agarose gel. The cultures of two positive

clones were used to inoculate 50 ml of LB medium.

4.7.3.7 Plasmid DNA preparation

The propagated bacteria were harvested by centrifugation for 15 min x 4500g

at 4°C and plasmid DNA isolation was performed using QIAfilter Plasmid Midi Maxi

Kits (Qiagen).

4.7.3.8 Sequencing

All plasmid DNA constructs were sequenced by MWG Biotech AG, in the

„Value read“ mode. The BCM Search launcher program was used for multiple

sequence alignments.


47

4.7.4 Construction of plasmids containing modified BRSV genomes

The region spanning the complete G gene was deleted from the BRSV

genome and replaced by the green fluorescence protein (GFP) open reading frame

(BRSV-∆G/GFP). The replacement was accomplished by PCR amplifications using

the pEGFP-N1 plasmid encoding the GFP gene and the pBRSV plasmid encoding

the complete BRSV genome as templates. Figure 4 summarizes the different PCR

reactions and primers used.

Figure 4. Scheme of the construction of the plasmid encoding modified BRSV

genome

GFP

G

PflMIBstEI

GFP

GFP

27

12

13

31

10

11


48

pBRSV plasmid encoding the complete BRSV genome was used as template

for two PCR reaction using two primer pairs (12/27 and 13/31) (see table 2). Primers

12 and 13 contained 15 bp corresponding to the first and the last 15 bp of the GFP

gene, respectively. pEGFP-N1 plasmid encoding the GFP gene was used as a

template for PCR reaction wit primer pair 10/11. Both primers contained few bp from

gene-start and gene-end sequence of G gene. The resulting three PCR products

were denatured and hybridized in a common reaction (primers 27/31). The resulting

PCR product contained GFP gene instead of G gene. Final amplification product as

well as pBRSV plasmid were cleaved with PflMI and BstEI restriction endonucleases

and ligated, resulting in pBRSV plasmid containing BRSV-∆G/GFP genome.


49

4.8 Methods for protein analysis

4.8.1 SDS-polyacrylamide gel electrophoresis

In this work, a standard SDS-polyacrylamide gel electrophoresis protocol was

used (Laemmli, 1970). Gels were prepared in a small (50mm X 80mm X 0.75 mm)

gel format. An acrylamide concentration of 10% was used for the separating gel. The

protein samples were mixed with 2X sample SDS buffer, boiled for 3 minutes at 94

°C and loaded onto the slots.

4.8.2 Western Blotting (semi-dry blotting technique)

After electrophoresis, the stacking gel was cut off and the proteins in the

separating gel were transferred to a nitrocellulose membrane using the semi-dry-blot

method (Kyhse-Andersen, 1984). On the graphite anode plate of the electroblotter

apparatus were placed in the following order:

1. 6 pieces of filter paper soaked in anode I buffer

2. 3 pieces of filter paper soaked in anode II buffer

3. nitrocellulose membrane

4. polyacrylamide gel

5. 9 pieces of filter paper soaked in cathode buffer.

The electroblotter was closed and the transfer was performed for 1 hour at 0.8

mA/cm2. Non-specific binding was blocked by soaking the membrane overnight at

4°C in blocking reagent. The nitrocellulose membrane was incubated for 1 hour at

room temperature with primary antibody, and subsequently washed three times for

10 minutes each time with PBSM containing 0.1% Tween 20. A biotin-conjugated

secondary antibody (diluted 1:1000) was added and incubated with the membrane

for 1 hour followed by three washing steps with PBSM containing 0.1% Tween. The

membrane was incubated with streptavidin-biotinylated horseradish peroxidase

complex (diluted 1:1000) for 1 hour at room temperature. After three washing steps


50

with PBSM containing 0.1% Tween and one with PBSM the blot was incubated for 5

min with West Dura Substrate Solution and the proteins were visualized by

chemiluminescence.

4.8.3 Immunofluorescence

Transfected or infected cells on 12 mm cover slips were washed two times

with cold PBS and fixed for 20 min with 3 % paraformaldehyde. The cells were

washed and incubated for 5 minutes with 0.1 M glycine. For detection of intracellular

antigen the cells were permeabilized with 0.2% Triton X-100. The cells were

incubated for one hour at room temperature with primary antibody. Following three

washing steps, the cover-slips were incubated with FITC-conjugated secondary

antibody at room temperature in the dark for 1 hour. After three washing steps with

PBS and one with dH2O, the cover slips were analyzed with a Zeiss Axioplan 2

microscope.

4.8.4 Cell surface biotinylation and immunoprecipitation

Transient expression of the F protein was performed in BSR-T7/5 cells.

Twenty hours post transfection, the cells were rinsed with ice-cold PBS buffer. Cell

surface proteins were labeled by incubating the cells with sulfo-NHS-biotin (Pierce)

(0.5 mg/ml in PBS, 250µl per well) for 30 min at 4°C with agitation. The monolayers

were washed with ice-cold PBS containing 0.1M glycine and incubated with the same

buffer for 20 min at 4°C. The cells were lysed in 1 ml of NP-40 lysis buffer and

insoluble material was removed by centrifugation (16,000 g for 30 min at 4°C). To

500 µl of each supernatant were added 50 µl of a 50% slurry of protein A-Sepharose

and 2.5 µl of the RSV3216 monoclonal antibody, which is directed against the HRSV

F protein. After agitation for 90 min at 4°C, the immunoprecipitates were collected by

centrifugation (16,000 g for 3 min), washed three times with NP-40 lysis buffer, and

eluted by boiling the beads in twofold-concentrated sodium dodecyl sulfate (SDS)

sample buffer. The immunoprecipitates were separated on an SDS–10%

polyacrylamide gel under reducing conditions and transferred to nitrocellulose by the


51

semidry blotting technique. The membrane was incubated with blocking reagent

overnight at 4°C, washed three times with PBS containing 0.1% Tween 20, and

incubated with streptavidin-peroxidase (1:1000) for 1 h at room temperature. The

nitrocellulose was washed as described above and incubated for 1 min with a

chemiluminescent peroxidase substrate. The resulting light emission was detected

with a super-cooled CCD camera (Chemi-Doc system, BioRad).

Results

52

5 Results

5.1 Generation of recombinant BRSV

In 1994, Schnell and colleagues generated recombinant rabies virus (RV) and

demonstrated for the first time that a negative-sense RNA virus can be produced

from cloned cDNA. This approach has become a powerful tool for studying the

function of individual viral proteins in the context of a virus infection. Recently, BRSV

and RSV deletion mutants lacking individual genes have been generated using this

system (Collins et al., 1995; Buchholz et al., 1999; Karger et al., 2001;

Techaarpornkul et al., 2001, 2002).

In this work BRSV mutants were generated by reverse genetics and used to

analyze a cluster of basic amino acids in the F2 subunit of the fusion protein for

interaction with cell-surface glycosaminoglycans.

5.1.1 Modification of BRSV using reverse genetics

In contrast to the RSV G protein for which a domain has been suggested to be

responsible for the interaction with cell surface glycosaminoglycans (Feldman et al.,

1999; Shields et al., 2003), data for the heparin-binding domain in the F protein are

not available. In the present work the role of basic amino acids of a putative heparin-

binding domain in the F protein was analyzed independently of the heparin-binding

activity of the G protein. Therefore, a deletion mutant lacking the G gene was

generated. The region spanning the complete G gene was deleted from the BRSV

genome and replaced by the green fluorescence protein (GFP) open reading frame

(BRSV-∆G/GFP) (Fig. 5). Furthermore, to assess the role of the G protein, several

mutants were generated from BRSV retaining the G gene. Here, the GFP open

reading frame was inserted as an additional transcription unit located upstream of the

NS1 gene (Fig. 5). This virus which was designated BRSV-GFP, was provided by

Wiebke Koehl. Both modified BRSV genomes were used as backbone genomes in

Results

53

which point mutations were introduced into the putative heparin-binding domain in

F2.

Figure 5. Scheme of the BRSV-∆G/GFP (A) and BRSV-GFP (B) genomes. Enlargements

show the GFP gene insertion with the transcription-start signals shown as ovals and

transcription–end signals represented by bars

NS1 NS2 N P M SH GFP F M2 L3´

M FSH

GFP

BRSV-∆G/GFP

PflMI NheII

GFP3´

NS1

BRSV-GFP

GFP NS1 NS2 N P M SH G F M2 L3´ 5´

5´

Results

54

5.1.2 Mutagenesis of the F gene

The main aim of this work was to analyze whether the different basic amino

acids in the putative heparin-binding domain of F2 affect BRSV-GAG interaction.

Therefore, basic amino acids were replaced with asparagine by site-directed

mutagenesis (4.6.2). A cloning cassette containing the ORFs of the M2 and F genes

introduced into the pCR3.1 plasmid was used for this purpose (Fig. 6). The mutants

were generated by replacement of the lysines at positions K63, K66, K70, K75, K77,

K80 and arginine R85 by asparagine either individually or in combinations. The AAC

triplet which encodes the amino acid asparagine was used to replace the triplet AAA

or AAG both of which encode the amino acid lysine, or AGA and AGG encoding

arginine.

Figure 6. Scheme of the BRSV cloning cassette used for generation of the F protein

mutants.

The nucleotide exchanges were confirmed by DNA sequencing of the pCR3.1

plasmid containing the modified BRSV F gene. Figure 7 summarizes the generated

point mutations.

F

XhoI EcoRIBstEII

T7

BGH reV

NheI

M2

Results

55

Figure 7. Sequence of the putative heparin binding domain in the BRSV F protein

with the introduced point mutations.

The generated constructs containing the F2 sequence with one, two or three

point mutations were introduced by molecular cloning into BRSV-∆G/GFP and BRSV-

GFP cDNAs. Thus, the mutations were present both in a BRSV genome containing

the G gene and in BRSV genome lacking the G gene. All modified cDNAs were used

for generation of recombinant BRSV.

F1F2

S-S

N C

63 66 70 75 77 80 85SKIQKNVCKSTDSKVKLIKQELERY parental

. N . . . . . . . . . . . . . . . . . . . . . . . K63N

. . . . N . . . . . . . . . . . . . . . . . . . . K66N

. . . . . . . . . . . . . N . . . . . . . . . . . K75N

. . . . . . . . . . . . . . . N . . . . . . . . . K77N

. . . . . . . . . . . . . . . . . . N . . . . . . K80N

. . . . . . . . . . . . . . . . . . . . . . . N . K85N

. N . . N . . . . . . . . . . . . . . . . . . . . K63/66N

. N . . N . . . N . . . . . . . . . . . . . . . . K63/66/70N

. . . . . . . . . . . . . N . N . . . . . . . . . K75/77N

. . . . . . . . . . . . . N . N . . N . . . . . . K75/77/80N

Results

56

5.1.3 Recombinant BRSV rescue

To produce recombinant viruses a T7 RNA polymerase driven system

described previously (Buchholz et al., 1999) was used. A cell line stably expressing

T7 phage RNA polymerase was used for transfection. BSRT7/5 cells were

transfected with plasmids encoding the respective modified BRSV genomes along

with plasmids encoding the BRSV polymerase complex composed of the N, P, L and

M2 proteins. All cDNA constructs were under the control of the T7 promoter (Fig. 8).

Figure 8. System for the generation of BRSV viruses from cloned cDNA

T7 RNApolymerasepromoter

BRSVgenomiccDNA N P M2 L

T7 RNApolymerase

(+) RNA (-) RNA

ReplicationTranscription

mRNA

N, P, M2, Lproteins

BSRT7/5 cells

Results

57

Transfected cells were split twice, and viral replication was detected by GFP

expression. The recombinant virus was released from the BSRT7/5 cells by freezing

and thawing and clarified supernatant was used for propagation of the virus on Vero

cells (Fig. 9). In most cases, transfection of cDNA resulted in infectious recombinant

BRSV. Table 4 summarizes all successfully generated recombinant BRSV. The cells

transfected with BRSV-∆G/GFP(K77N) and BRSV-GFP (K77N) cDNAs showed very

low GFP expression indicating that replication of these viruses was impaired.

Attempts to propagate this virus on Vero cells failed probably due to low infectivity of

the virus. No GFP expression from BRSV-∆G/GFP(K75N) or BRSV-/GFP (K75N)

transfected cells was detected suggesting that these mutants did not replicate.

Possible reasons for the failure to recover the K75N mutants are discussed later

(6.3).

Results

58

BRSV-GFP(parental) BRSV-∆G/GFP(parental)

BRSV-∆G/GFP(K63N) BRSV-∆G/GFP(K66N)

BRSV-∆G/GFP(K80N) BRSV-∆G/GFP(R85N)

BRSV-∆G/GFP(K63/66N) BRSV-∆G/GFP(K63/66/70N)

Figure 9. Syncytia formation in Vero cells of both BRSV-GFP parental viruses and

BRSV-∆G/GFP mutants.

Results

59

Name of the virus GFP expression in

transfected BSRT7/5 cells

Replication in Vero

cells

BRSV-GFP parental + +

BRSV-GFP(K75N) − −

BRSV-GFP(K77N) + −

BRSV-GFP(K80N) + +

BRSV-GFP(R85N) + +

BRSV-GFP(K75/77N) − −

BRSV-GFP(K63/66N) + +

BRSV-GFP(K63/66/70N) + +

BRSV-GFP(K75/77/80N) − −

BRSV-∆G/GFP parental + +

BRSV-∆G/GFP(K63N) + +


BRSV-∆G/GFP(K75N) − −

BRSV-∆G/GFP(K77N) + −


BRSV-∆G/GFP(R85N) + +

BRSV-∆G/GFP(K63/66N) + +

BRSV-∆G/GFP(K75/77N) − −

BRSV-∆G/GFP(K63/66/70N) + +

BRSV-∆G/GFP(K75/77/80N) − −

Table 4. Overview of the recovered BRSV.

Results

60

5.2 Analysis of the BRSV mutants

The formation of syncytia was analyzed two days post-infection in Vero cells

(Fig. 9). The syncytia induced by BRSV-∆G/GFP(K63N), BRSV-∆G/GFP(K66N) and

BRSV-∆G/GFP(K80N) were comparable or even larger (containing more nuclei) than

those of parental BRSV-∆G/GFP. In contrast syncytia induced by the double mutant

BRSV-∆G/GFP(K63/66N) and the triple mutant BRSV-∆G/GFP(K63/66/70N) were

considerably smaller than the syncytia induced by parental virus. Very small syncytia

were also observed with BRSV-∆G/GFP(R85N).

5.2.1 Viral replication kinetics

To assess the effect of the introduced point mutations on virus replication, the

kinetics of most of the generated viruses were analyzed. Monolayers of Vero cells

were infected in duplicate with the respective mutants using a multiplicity of infection

(MOI) of 0.1. At the indicated time-points samples were collected from the culture

supernatant and used for virus titration by plaque assay on Vero cells. BRSV-

∆G/GFP(R85N) showed very low titers after several passages in Vero cells and was

not included in this analysis.

The parental viruses BRSV-GFP and BRSV-∆G/GFP showed a similar

replication kinetics up to 96 hours but from that time point on the BRSV-∆G/GFP titer

dropped faster than that of BRSV-GFP (Fig. 10 A). On most time points tested, virus

titers of BRSV-GFP(K80N) were approximately 10-fold higher than in the BRSV-

∆G/GFP(K80N) mutant (Fig. 10 A). BRSV-GFP(K63/66N) and BRSV-

∆G/GFP(K63/66N) mutants replicated with the same efficiency (Fig. 10 B). The

BRSV-GFP(K63/66/70N) mutant replicated with better efficiency after the fourth day

compared with BRSV-∆G/GFP(K63/66/70N). The triple mutants compared with

BRSV-GFP and BRSV-∆G/GFP parental viruses, as well as with BRSV-

GFP(K63/66N) and BRSV-∆G/GFP(K63/66N) double mutants, showed much higher

efficiency and produced significantly higher titers

Results

61

A.

B.

Figure 10. Multi-step replication kinetics of BRSV ∆G/GFP mutants

2

3

4

5

6

24 48 72 96 120 144Time post-infection (hours)

Tite

r (lo

g 10

PFU

/ml)

GparG80

dG

d80

GFP parental

GFP K80N

∆G/GFP parental

∆G/GFP K80N

≤

2

3

4

5

6

7

24 48 72 96 120 144

Time post-infection (hours)

Tite

r (lo

g 10

PFU

/ml)

Gdb

Gtr

ddb

dtr

GFP K63/66N

GFP K63/66/70N

∆G/GFP K63/66N

∆G/GFP K63/66/70N

≤

Results

62

Figure 11. Multi-step replication kinetics of BRSV-∆G/GFP mutants.

In Figure 11 the replication kinetics of BRSV-∆G/GFP and 5 mutants derived

from the same genomic backbone are compared. The single mutant BRSV-

∆G/GFP(K63N) and the double mutant BRSV-∆G/GFP(K63/66) showed similar

kinetics compared to the parental virus. In contrast BRSV-∆G/GFP(K66N) and the

triple mutant BRSV-∆G/GFP(K63/66/70N) produced significant higher titers than the

parental virus. The BRSV-∆G/GFP(K80N) mutant showed a slower replication

kinetics than the parental virus.

2

3

4

5

6

24 48 72 96 120 144

Time post-infection (hours)

Tite

r (lo

g 10

PFU

/ml)

dG

d63d66ddbdtr

d80

∆G/GFP parental

∆G/GFP K63N

∆G/GFP K66N

∆G/GFP K63/66N

∆G/GFP K63/66/70

∆G/GFP K80N

≤

Results

63

5.2.2 Effect of soluble GAGs on infection with BRSV-∆G/GFP and BRSV-GFPmutants.

To assess the BRSV-GFP and BRSV-∆G/GFP interaction with

glycosaminoglycans, we tested the ability of soluble GAGs, including chondroitin

sulfate A, chondroitin sulfate B (dermatan sulfate), chondroitin sulfate C, hyaluronic

acid and heparin, to inhibit infection of Vero cells with the respective BRSV mutants.

Curves for soluble GAG inhibition of BRSV-GFP infectivity are shown in Figure 12.

The effect of soluble GAGs on BRSV infection was more pronounced when the

competitor was pre incubated with the virus before inoculation with Vero cells. A

lower inhibition activity was found when soluble heparin was present only during

infection. Heparin and chondroitin sulfate B (dermatan sulfate) were the most

effective inhibitors of BRSV-∆G/GFP reducing the infectivity in a concentration-

dependent manner. At 2.5 µg/ml infection was reduced by more than 50% compared

with untreated control.

Figure 12. Inhibition of BRSV ∆G/GFP virus infectivity by various GAGs. Mean values

calculated from 3 separate experiments.

GAGs concentration25µg/ml 250µg/ml2.5µg/ml

0

20

40

60

80

1 2 3

Infe

ctiv

ity (%

of c

ontr

ol)

Chondroitin sulfateCDextransulfate

Hyaluronic acid

Chondroitin sulfateADermatansulfate

Heparin

Chondroitin sulfate C

Dextran sulfate

Hyaluronic acid

Chondroitin sulfate A

Dermatan sulfate

Heparin

Results

64

5.2.3 Effect of heparin on infection with BRSV-∆G/GFP and BRSV-GFPmutants.

To analyze the influence of the basic amino acids in the F2 putative heparin-

binding domain on the interaction with soluble heparin, the infection of Vero cells by

BRSV-GFP and BRSV-∆G/GFP mutants with replaced basic residues was analyzed.

In a competition assay, heparin was chosen as competitor as this GAG showed the

highest inhibition activity towards to BRSV-∆G/GFP.

Figure 13. Inhibition of BRSV-∆G/GFP mutants infectivity by soluble heparin.

Mean values calculated from 3 separate experiments are shown.

BRSV-∆G/GFP parental virus infectivity was reduced by more than 50 % at a

concentration of 2.5 µl/ml compared with the untreated control. The infectivity of

parental and mutant viruses was slightly reduced in the presence of 0.25 µg/ml

soluble heparin. All BRSV-∆G/GFP mutants with point mutations in the F2 subunit

showed a higher sensitivity to inhibition with soluble heparin than the parental virus

(Fig. 13).

The highest sensitivity towards heparin was found with BRSV-

∆G/GFP(K63/66) and BRSV-∆G/GFP(K63/66/70). BRSV-∆G/GFP(K85N) showed the

0.25 µg/ml 2.5 µg/ml 25 µg/ml 250 µg/ml Heparin concentration

0

10

20

30

40

50

60

70

80

90

0,25µg/ml 2,5µg/ml 25µg/ml 250µg/ml

Infe

ctiv

ity (%

of c

ontro

l)

∆G/GFPparental

∆G/GFPK63N

∆G/GFPK66N

∆G/GFPK63/66N

∆G/GFPK63/66/70N

∆G/GFPK80N

∆G/GFPR85N

∆G/GFP parental

∆G/GFP K63N

∆G/GFP K63/66N

∆G/GFP K63/66/70N

∆G/GFP K80N

∆G/GFP R85N

∆G/GFP K66N

Results

65

lowest sensitivity to inhibition compared with all other mutants. None of the viruses

showed complete inhibition of infection even at a concentration of 250 µg/ml

suggesting an alternative pathway that led to productive infection.

Soluble heparin differentially affected the infectivity of the mutants depending

on the presence of the G protein. All mutants expressing the G protein showed a

lower sensitivity to inhibition compared with the corresponding mutants lacking the G

gene. This indicates that the decline in heparin binding of the recombinant viruses

containing point mutation in F2 could be compensated to some extent from the

heparin binding activity of the G protein. The degree of compensation differs between

different mutants (Fig. 14).

A.

Figure 14. Inhibition of recombinant BRSV viruses by soluble heparin.

2.5µg/ml 25µg/ml 250µg/ml

Heparin concentration

0

10

20

30

40

50


Infe

ctiv

ity (%

of c

ontr

ol)

GFP K63/66/70N

∆G/GFPK63/66/70N

GFP parental

∆G/GFP parental

Results

66

B.

C.


2.5µg/ml 25µg/ml 250µg/mlHeparin concentration

250µg/ml25µg/ml2.5µg/mlHeparin concentration

0

10

20

30

40


Infe

ctiv

ity (%

of c

ontr

ol)

GFPK80N∆G/GFP

GFP K80N∆G/GFP K80N

0

10

20

30

40

50


Infe

ctiv

ity (%

of c

ontro

l)

GFP R85N

∆G/GFPR85N

GFP R85N

∆G/GFP R85N

Results

67

D.

E.


Heparin concentration2.5µg/ml 25µg/ml 250µg/ml

0

10

20

30

40

50


Infe

ctiv

ity (%

of c

ontr

ol)

GFP K63/66N

∆G/GFP K63NGFP K63/66N∆G/GFP K63/66N

0

10

20

30

40

50


Infe

ctiv

ity (%

of c

ontr

ol)

GFP K63/66/70N

∆G/GFPK63/66/70N

GFP K63/66/70N

∆G/GFP K63/66/70N

2.5µg/ml 25µg/ml 250µg/mlHeparin concentration

Results

68

5.2.4 Analysis of mutations at positions K75 and K77

A reverse genetics system is not feasible if mutations affect the viability of the

recombinant virus. Attempts to generate recombinant viruses containing asparagine

at positions K75 and K77 were not successful. To elucidate how the exchange of

these amino acids may affect F protein function, a plasmid driven expression system

was used. The open reading frame of the parental F protein and F protein containing

mutations at the positions 75, 77, and 80 were cloned into the pTM1 vector to give

pTM1-bF parental, pTM1-bF(K75N), pTM1-bF(K77N), pTM1-bF(K75/77N), or pTM1-

bF(K75/77780N), respectively. pTM plasmid vector was constructed for expression of

genes under control of T7 promoter and contains an internal ribosomal entry site from

encephalomyocarditis virus to allow cap-independent translation of the transcripts

(Moss et al., 1990). BSR-T7/5 cells stably expressing the T7-RNA polymerase

(Buchholz et al., 1999) were infected with vaccinia virus containing the T7-RNA

polymerase gene before transfection with the respective pTM1 constructs in order to

enhance the expression level of the F protein. Transfected cells expressing the

modified F proteins were analyzed by fluorescence microscopy, flow cytometry and

surface biotinylation. The parental and the mutant proteins F(K75N), F(K77N),

F(K75/77N) and F(K75/77/80N) were characterized with respect to proteolytic

cleavage, cell surface transport and fusion activity.

5.2.5 Analysis of F protein cell surface transport

To determine if the mutants F(K75N), F(K77), F(K75/77N), and F(K75/77/80N)

are transported to the cell surface, indirect immunofluorescence of transfected

BSRT7/5 cells was performed. Transfected cells were labeled with F-specific

monoclonal antibodies. Figure 15 shows that F(K75N) and F(K77N) as well as the

double mutant F(K75/77N) were detected at the cell surface like the parental F

protein. Only the F(K75/77/80N) triple mutant showed a reduced cell surface

expression compared to parental F protein.

Results

69

Figure 15. Indirect immunofluorescence of BSR-T7/5 cells expressing modified

F protein. The cells were examined at 400X magnification.

BRSV F parental BRSV F K75N

BRSV F K77N BRSV F K75/77N

BRSV F K75/77/80N

Results

70

Cell surface expression of the F protein mutants was also quantitatively

determined by flow cytometry. Transfected cells were detached without trypsin

treatment and were stained with a FITC-conjugated bovine anti-BRSV serum. As a

negative control, cells were transfected with non-recombinant pTM1 plasmid and

stained in the same way. Table 5 summarizes the results of three independent

transfection experiments. The F(K75N) and F(K77N) mutants as well as the double

mutant F(K75/77N) showed similar percent of fluorescent cells as the parental BRSV

F protein whereas the triple mutant F(K7/77/780N) showed a 75 % reduction,

suggesting that the combination of three point mutations has an effect on cell surface

transport.

pTm-F mutant % fluorescent cells X mean

pTM F wt 11.2 45

pTM F K75N 10.4 47

pTM F K77N 10.6 46

pTM F K75/77N 9.0 40

pTM F K75/77/80N 2.5 48

Table 5. Flow-cytometric analysis of BSR-T7/5 cells expressing modified BRSV F

proteins.

5.2.6 Fusion activity of F mutants

The ability of the mutant F protein to induce formation of syncytia in

transfected BSRT7/5 cells was analyzed. Transfected BSR-T7/5 cells with pTM1-F

protein mutants were examined at 400X magnification. Only the mutant F(K77N)

protein induced formation of syncytia the size of which was comparable to those

formed by the parental F protein. F(K75N) as well as F(K75/77N) and F(K75/77/80N)

showed F protein expression in single cells but no syncytia formation was detected

(Fig. 15).

Results

71

5.2.6.1 Biotinylation and immunoprecipitation of the mutant F proteins

To analyze whether F protein cleavage is affected by the exchange of the

lysines at positions 75 and 77 in the F2 subunit, transfected BSR-T7/5 cells were

labeled with sulfo-NHS-biotin at 4 °C. This reagent does not penetrate the plasma

membrane and therefore reacts only with proteins at the cell surface (Le Bivic et al.,

1989). The labeled cells were immunoprecipitated from the cell lysates by a

monoclonal antibody directed against the F1 subunit of the fusion protein. The

immunoprecipitates were separated by SDS-PAGE under reducing conditions in the

presence of dithiothreitol in order to reduce disulfide bonds. The samples were

transferred to nitrocellulose membrane and probed with streptavidin-peroxidase (Fig.

16). All F proteins appeared as single bands of 50 kDa representing the F1 subunit

suggesting that the point mutations at positions K75, K77 and K75/77 did not affect

furin mediated cleavage of the F0 precursor. Densitometric analysis of the bands

revealed that three of the samples showed very similar densities as the parental F

protein. In contrast, the triple mutant was detected in lower amounts at the cell

surface accounting for about 20%-40% of the amount of the parental F protein.

bF wt bF K75N bF K77N bF K75/77N bF K75/77/80N

Figure 16. Surface biotinylation of the F protein mutants.

Taken together, indirect immunofluorescence, flow cytometry and cell surface

biotinylation provide evidence that three of the mutants, namely K75N, K77N and

K75/77N of the BRSV F protein are efficiently cleaved and transported to the cell

surface, with only slight differences in the rate of transport. The third mutant with

three point mutations, F(K75/77/80N), showed a reduced cell surface transport.

F1 (50 KDa)

F0 (70 KDa)

Results

72

5.3 Generation of MBP-F2 hybrids

As an alternative approach for characterization of the F protein heparin-

binding activity, a chimeric protein composed of the F2 subunit and the maltose-

binding protein (MBP) was generated. cDNA encoding the F2 subunit of HRSV,

BRSV and PVM fusion proteins was cloned into the pMaL-c2 plasmid in frame with

the maleE gene which encodes the maltose-binding protein of E. coli. The chimeric

proteins (MBP-F2) were expressed in E.coli and purified by affinity chromatography

on immobilized amylose. Three different approaches were used to analyze the

binding capacity of the chimeric proteins: flow cytometry, ELISA using biotin-heparin

conjugates bound to streptavidin-coated microtiter plates, and a pull-down assay

using heparin-agarose. With neither approach a binding activity of MBP-F2 was

detected suggesting that the presence of the F1 subunit might be necessary to obtain

a functional molecule. Besides, N-glycosylation which is absent from MBP-F2 might

be important to allow the protein to adopt a proper conformation.

Discussion

73

6 Discussion

Growing evidence suggests that RSV F protein, apart from its fusion activity has

also receptor binding activities. A first indication for this additional activity of the F protein

came from the isolation of an RSV mutant lacking SH and G genes, cp-52 (Karron et al.,

1997). This mutant grew to relatively high titers in cultured cells, but was poorly

infectious in mice and humans. Therefore, not only the fusion but also an attachment

function was attributed to the F protein. RSV deletion mutants lacking G and/or SH

genes have also been generated by reverse genetics (Techaarpornkul et al., 2001;

Karger et al., 2001). Using these mutants the heparin-binding activities of the F protein

were demonstrated for HRSV and BRSV strains (Feldman et al., 2000; Karger et al.,

2001). In contrast to the G protein, the sequence responsible for interaction of the F

protein with heparin-like molecules has not been identified so far.

Several characteristics of the F2 subunit make this part of the BRSV fusion

protein a promising candidate for a domain which can bind cell surface GAGs:

1) It has been shown that the F2 subunit of the F protein accounts for the species

specificity of RSV infection (Schlender et al., 2003). This property suggests the presence

of a specific receptor binding site in the F2 subunit of HRSV and BRSV, respectively.

2) Comparison of different HRSV and BRSV strains revealed extensive sequence

variation in the F2 subunit (Fig. 17). In contrast, the F1 subunit is highly conserved with

90% identity between different RSV strains.

3) Within the F2 subunit there exists a cluster of basic amino acids. This region of basic

residues between amino acids positions 62 and 86 is a promising candidate for a

heparin-binding domain.

63 66 70 75 77 80 85

BRSV (A Tue51908) ...SKIQKNVCKSTDSKVKLIKQELERYNN...HRSV (Long) ...SKIKENKCNGTDAKVKLIKQELDKYKN...

Figure 17. Partial amino acid sequence of the F2 subunit of HRSV and BRSV. The

basic amino acids of the putative heparin-binding domain are shown in bold letters.

Discussion

74

6.1 MBP-basic amino acid epitope in F2 subunit is not sufficient forinteraction with heparin

In a first attempt to analyze the effect of point mutations in the putative heparin-

binding domain only the small F2 subunit of the BRSV F protein was used. A chimeric

protein composed of the F2 subunit and the maltose binding protein (MBP) from E.coli

was generated. Using these chimeric constructs an interaction with glycosaminoglycans

could not be detected suggesting that the MBP-basic amino acids epitope is not

sufficient for interaction with heparin. Furthermore, N-glycosylation which is absent from

the MBP-F2 chimeric protein expressed in bacterial cells might be important to allow the

protein to adopt a conformation which allows interaction with GAGs. Therefore this

approach was not suitable to characterize the basic amino acids of the F2 subunit.

6.2 Most of the point mutations in the putative binding domain of theF protein do not affect virus viability

Recently, reverse genetics has become a powerful tool for studying the function

of individual viral proteins in the context of an RSV infection. RSV deletion mutants

lacking individual genes have been generated from cDNA by this system (Collins et al.,

1995; Buchholz et al., 1999).

Reverse genetics was used in this work for the generation of mutant BRSV

containing point mutations in the putative heparin-binding domain of the F2. To exclude

the heparin-binding activity of the G protein, deletion mutants were generated by

replacing the G gene with the gene encoding the green fluorescent protein (GFP),

BRSV-∆G/GFP. Point mutations were introduced also into a second BRSV genome

containing the GFP gene as an additional transcription unit, BRSV-GFP. BRSV-GFP

and BRSV-∆G/GFP viruses containing the parental F protein were successfully

recovered and showed formation of syncytia with similar size. Both mutants were similar

in their replication kinetics in accordance with previously published data (Karger et al.,

2001). They showed that recombinant BRSV containing the F protein as the only

Discussion

75

glycoprotein replicates well in cell culture.

6.3 Effect of different GAGs as inhibitors of recombinant BRSVinfection

The analysis of the interaction of BRSV with GAG has shown that compounds

containing iduronic acid are more efficient inhibitors than are those containing glucuronic

acid. In this respect BRSV is very similar to HRSV which also has been reported to be

more sensitive to inhibition by heparin and dermatan sulfate compared to glucuronic acid

containing GAGs (Hallak et al., 2000a).

6.4 Role of K80N and R85N mutations

K80N mutants were rescued with high efficiency and propagated on Vero cells to

high titers. Though this lysine is conserved in both HRSV and BRSV, replacement of this

amino acid with asparagine did not reduce the viability of the mutant in contrast to the

conserved residues K75 and K77 the replacement of which had detrimental effects on

receptor binding and/or fusion activity of the F protein. The recovered K80N mutant virus

was more sensitive to inhibition by heparin and thus – like K63 and K66 – appears to

have a modulating effect on the interaction of the F protein with GAG.

The mutation at residue R85 had a more dramatic effect. Amino acid 85 of F2 is a

basic residue conserved in both bovine and human strains. In HRSV, this position is

lysine, in BRSV it is arginine, suggesting that the presence of a positively charged amino

acid may have some functional importance. Mutant R85N could be recovered. However,

it grew only to very low titers. The ability of this virus to induce syncytia infected Vero

cells was strongly reduced. Therefore, we conclude that the arginine residue at position

85 plays an important role for the fusion activity of BRSV.

Discussion

76

6.5 Lysines at positions 75 and 77 of the F2 subunit play an essentialrole for F protein function

Attempts to recover recombinant viruses containing point mutations at highly

conserved residues K75 and K77 were not successful, neither with the BRSV-∆G/GFP

nor with the BRSV-GFP backbone. The failure to recover the K75N mutant may be

explained by an impaired fusion activity. Upon plasmid-driven expression, the mutant

protein was unable to induce syncytia formation. As the protein was transported to the

cell surface, proteolytically cleaved into subunits, and detected by a monoclonal

antibody we assume that the mutation did not affect the conformation. Therefore, K75

appears to be directly involved in the fusion activity of the F protein. Like K75N, no virus

could be recovered for mutant K77N. The reason for this is unclear. The respective

mutant protein not only was transported to the cell surface it also effectively induced the

formation of syncytia. Thus, this protein had retained its fusion activity. Furthermore it is

not known whether replacement of the basic residues by amino acids other than

asparagine will show the same effect. Further studies are needed to understand the

importance of lysine77. It should be interesting to know whether mutation of this basic

amino acid in the HRSV F protein has a similar effect as observed for the BRSV fusion

protein.

6.6 Exchange of lysines 63 and 66 has a modulating effect on BRSVinfectivity

Lysines located at positions 63 and 66 in the BRSV fusion protein are positioned at

residues 65 and 66 in the corresponding protein of HRSV. The different location may

reflect the different importance of these basic amino acids for BRSV. The viability of

BRSV was not affected when either or both residues were replaced by asparagines. In

fact, mutant K66N grew to higher titers than the parental virus, while lower titers were

determined for mutant K63N. These difference may be connected with the differences

observed in the syncytia formation induced by both mutant viruses. Syncytia induced by

Discussion

77

the K63N mutant were somewhat larger compared to the parental virus, whereas

infection by the K66N mutant resulted in somewhat smaller syncytia. An inverse relation

between the extent of syncytium formation and the titer of infectious virus released into

the supernatant has also been reported for other paramyxoviruses. An explanation of

the difference in syncytia formation is difficult as the three-dimensional structure of the

fusion protein has not yet been elucidated. The inhibition studies indicate that both

mutants are more sensitive to heparin inhibition compared with parental virus, but no

significant difference between the two mutants was detected. Maybe the two lysines

contribute in a similar way to the binding of the F protein to GAG, but differ in their

contribution to the transition to the next step, the fusion reaction. As both lysines are

conserved, mutations at residues 63 or 66 obviously have no selection advantage in

nature. So far the mutants have been analysed only for growth on cell cultures. In the

future, virus growth should be determined also on differentiated airway epithelial cells.

This cell system closer to the natural situation of an RSV infection. Maybe, under such

conditions, residues 63 and 66 are more important for virus growth compared to

infection of conventional cell cultures.

6.7 G protein may compensate for point mutations in the F2 subunit

Some of the recombinant viruses containing point mutations in the F2 subunit and

expressing G protein were less affected by soluble heparin than viruses containing the

same mutations but lacking the G gene. This indicates that the heparin binding activity of

the G protein, compensates to some extent for the decline of heparin binding due to the

mutations in the F2 subunit.

Discussion

78

6.8 RSV attachment to the cell surface involves additional cellularreceptor(s)

As has been shown for parental HRSV and BRSV, we also found for the mutants

that infectivity was sensitive to inhibition by heparin. In the inhibition experiments even

higher concentrations of soluble heparin did not completely abolish virus infection. The

residual infectivity may be explained by the interaction with a ligand different from GAG.

The existence of a so far unidentified receptor has also been suggested by results

obtained with chimeric BRSV. Be analysing chimeric F proteins, the F2 subunit was

shown to be responsible for the species-specific interaction of RSV with differentiated

airway epithelial cells (Schlender et al., 2002). As appears difficult to explain species-

specific differences in the binding acitivity by binding to GAG, it has been suggested that

the F2 subunit not only harbours residues for the interaction with GAG, but also a

binding site for a protein receptor (Schlender et al., 2003).

6.9 Conclusions

Viral fusion proteins that have been studied in more detail, e.g. the HA protein of

influenza A virus or the gp120/gp41 of HIV, are known to undergo a conformational

change prior to the fusion reaction (Skehel and Wiley, 2000; Weissenhorn et al., 1999).

This intermolecular rearrangement that makes the protein fusion-active is induced in

influenza virus by the low pH encountered within endosomes upon internalisation of the

virus. HIV does not require endocytotic uptake. Following attachment to CD4 receptors

the interaction with members of the family of chemokine receptors triggers the

conformational change that makes gp41 fusion-active (Furuta et al., 1998) . Sequential

interaction with cell surface molecules in the initiation of infection has also been reported

for members of the herpesvirus family, herpes simplex-1 (HSV-1) and pseudorabies.

With these viruses, attachment is mediated by binding of the viral surface glycoprotein

gC to cell surface heparan sulphate proteoglycans (WuDunn and Spear, 1989). Virus

entry, i.e. fusion of the viral membrane with the plasma membrane, requires the

interaction of the viral glycoprotein gD with a member of the nectin family or an

Discussion

79

alternative cell surface receptor (Krummenacher et al., 1998). A conformational change

is also expected to render the F protein of RSV fusion active. In theory, interaction with

GAG may provide such a stimulus. However, it is also possible that as in the case of

herpesviruses, interaction with GAG only mediates attachment and that subsequent

interaction with a protein receptor is required to induce the fusion of the viral membrane

with the plasma membrane.

Summary

80

7 Summary

Characterization of the heparin-binding activity of the bovine respiratorysyncytial virus fusion protein

Diana Panayotova

Cell surface glycosaminoglycans (GAGs) are a major factor for respiratory

syncytial virus (RSV) attachment to cultured cells leading to infection. The viral

glycoprotein G binds to GAGs and was thought to be the only viral attachment protein.

Recently, mutant virus lacking the G protein was shown to be infectious in cell culture

suggesting that the F protein, which has long been known for its fusion activity has also

receptor binding activities. A linear heparin-binding domain has been identified in the G

protein. This domain is characterized by clusters of basic amino acids that are supposed

to be important for the interaction with the negatively charged groups of GAGs. The

respective domains in the F protein responsible for the interaction with GAGs are not

known so far.

The present study was based on the working hypothesis that basic amino acids

concentrated in a short domain located in the BRSV fusion protein F2 subunit are

involved in heparin-binding. The experimental work was designed to provide a better

understanding of the interaction between BRSV F protein and heparin-like structures.

Recombinant BRSV with mutations in the putative-heparin binding domain of the F2

subunit were analyzed. The significance of these mutations with respect to virus

infectivity and heparin binding were investigated.

The following results were obtained:

Summary

81

First, 13 recombinant viruses containing point mutations in the F2 subunit of the F

protein were generated and characterized with respect to replication and syncytia

formation.

Second, an essential role of lysine K75 in F protein function was demonstrated.

Analysis of transfected cells revealed that this mutation do not affect either proteolytic

activation, or cell surface transport of the F protein, but had an effect on fusion activity.

Like K75N, no virus could be recovered from mutant K77N. The reason for this is

unclear.

Third, inhibition of BRSV infection indicated that the basic amino acids K63, K66,

K80, and R85 have modulating effects on virus infectivity.

Fourth, it was demonstrated that even higher concentrations of soluble heparin

did not completely abolish virus infection suggesting the existence of additional cellular

receptors which are involved in viral attachment.

Zusammenfassung

82

8 Zusammenfassung

Charakterisierung der Heparin-Bindungsaktivität des Fusionsproteins desbovinen respiratorischen Synzytialvirus

Diana Panayotova

Glukosaminoglykane (GAG) auf der Zelloberfläche sind ein wichtiger Faktor für

die Bindung des respiratorischen Synzytialvirus (RSV) an Zellen bei der Einleitung einer

Infektion. Das virale Glykoprotein G bindet an GAG und galt früher als alleiniges

Anheftungsprotein. Kürzlich wurde gezeigt, dass Virusmutanten, denen das G-Protein

fehlt, Zellkulturen infizieren können. Daraus folgt, dass das F-Protein neben seiner

bekannten Fusionsaktivität auch über Rezeptor-bindende Aktivität verfügt. Auf dem G-

Protein ist eine lineare Heparin-bindende Domäne identifiziert worden. Dieser

Proteinabschnitt ist gekennzeichnet durch eine Anhäufung basischer Aminosäuren, von

denen man annimmt, dass sie für die Wechselwirkung mit den negativ geladenen

Gruppen von GAG wichtig sind. Eine entsprechende für die Wechselwirkung mit GAG

verantwortliche Domäne war auf dem F-Protein bislang nicht bekannt.

Die vorliegende Studie basiert auf der Arbeitshypothese, dass basische

Aminosäuren, die in einem kurzen Abschnitt der F2-Untereinheit gehäuft auftreten, an

der Heparin-Bindung beteiligt sind. Die experimentelle Arbeit war darauf ausgerichtet,

ein besseres Verständnis der Wechselwirkung zwischen dem BRSV-F-Protein und

Heparin-ähnlichen Strukturen zu vermitteln. Rekombinantes BRSV mit Mutationen in der

mutmaßlichen Heparin-Bindungsdomäne der F2-Untereinheit wurde analysiert. Die

Bedeutung dieser Mutationen hinsichtlich Infektiosität und Heparin-Bindung wurde

untersucht.

Folgende Ergebnisse wurden erhalten:

1. Dreizehn rekombinante Viren mit Punktmutationen in der F2-Untereinheit des

F-Proteins wurden erzeugt und hinsichtlich Replikation und Synzytium-Bildung

charakterisiert.

Zusammenfassung

83

2. Für die Lysine K75 und K77 wurde eine essentielle Rolle für die Funktion des

F-Proteins nachgewiesen. Die Analyse transfizierter Zellen zeigte, dass diese

Mutationen weder die proteolytische Aktivierung noch den Oberflächentransport des F-

Proteins beeinflussen, wohl aber die Fusionsaktivität (K75). Rekombinantes Virus mit

diesen Mutationen konnte nicht isoliert werden.

3. Die Hemmung der BRSV-Infektion zeigte, dass die basischen Aminosäuren

K63, K66, K80 und R85 einen modulierenden Effekt auf die Virusinfektiosität haben.

4. Es wurde gezeigt, dass selbst hohe Konzentrationen löslichen Heparins die

Virusinfektion nicht völlig verhinderten. Dieses Ergebnis spricht für die Existenz eines

zusätzlichen zellulären Rezeptors, der an der Virusbindung beteiligt ist.

References

84

9 References• Baker, J. C., J. A. Ellis, and E. G. Clark. 1997. Bovine respiratory syncytial

virus. Vet. Clin. North Am. Food Anim. Pract. 13:425-454.

• Barik, S. 1992. Transcription of human respiratory syncytial virus genome

RNA in vitro: requirement of cellular factor(s). J. Virol. 66:6813-6818.

• Bermingham, A. and P. L. Collins. 1999. The M2-2 protein of human

respiratory syncytial virus is a regulatory factor involved in the balance

between RNA replication and transcription. Proc. Natl. Acad. Sci. U. S. A

96:11259-11264.

• Berthiaume, L., J. Joncas, and V. Pavilanis. 1974. Comparative structure,

morphogenesis and biological characteristics of the respiratory syncytial

(RS) virus and the pneumonia virus of mice (PVM). Arch. Gesamte

Virusforsch. 45:39-51.

• Bossert, B. and K. K. Conzelmann. 2002. Respiratory syncytial virus

(RSV) nonstructural (NS) proteins as host range determinants: a chimeric

bovine RSV with NS genes from human RSV is attenuated in interferon-

competent bovine cells. J. Virol. 76:4287-4293.

• Bourgeois, C., J. B. Bour, K. Lidholt, C. Gauthray, and P. Pothier. 1998.

Heparin-like structures on respiratory syncytial virus are involved in its

infectivity in vitro. J. Virol. 72:7221-7227.

• Bowland, S. L. and P. E. Shewen. 2000. Bovine respiratory disease:

commercial vaccines currently available in Canada. Can. Vet. J. 41:33-48.

• Bryson, D. G., J. B. McFerran, H. J. Ball, and S. D. Neill. 1978.

Observations on outbreaks of respiratory disease in housed calves--(1)

Epidemiological, clinical and microbiological findings. Vet. Rec. 103:485-

489.

• Buchholz, U. J., S. Finke, and K. K. Conzelmann. 1999. Generation of

bovine respiratory syncytial virus (BRSV) from cDNA: BRSV NS2 is not

References

85

essential for virus replication in tissue culture, and the human RSV leader

region acts as a functional BRSV genome promoter. J. Virol. 73:251-259.

• Bukreyev, A., S. S. Whitehead, B. R. Murphy, and P. L. Collins. 1997.

Recombinant respiratory syncytial virus from which the entire SH gene has

been deleted grows efficiently in cell culture and exhibits site-specific

attenuation in the respiratory tract of the mouse. J. Virol. 71:8973-8982.

• Cardin, A. D. and H. J. Weintraub. 1989. Molecular modeling of protein-

glycosaminoglycan interactions. Arteriosclerosis 9:21-32.

• Collins, P. L., M. G. Hill, E. Camargo, H. Grosfeld, R. M. Chanock, and B.

R. Murphy. 1995. Production of infectious human respiratory syncytial

virus from cloned cDNA confirms an essential role for the transcription

elongation factor from the 5' proximal open reading frame of the M2 mRNA

in gene expression and provides a capability for vaccine development.

Proc. Natl. Acad. Sci. U. S. A 92:11563-11567.

• Collins, P. L., M. G. Hill, J. Cristina, and H. Grosfeld. 1996. Transcription

elongation factor of respiratory syncytial virus, a nonsegmented negative-

strand RNA virus. Proc. Natl. Acad. Sci. U. S. A 93:81-85.

• Collins, P. L., M. G. Hill, and P. R. Johnson. 1990. The two open reading

frames of the 22K mRNA of human respiratory syncytial virus: sequence

comparison of antigenic subgroups A and B and expression in vitro. J.

Gen. Virol. 71 ( Pt 12):3015-3020.

• Collins, P. L., Y. T. Huang, and G. W. Wertz. 1984. Nucleotide sequence

of the gene encoding the fusion (F) glycoprotein of human respiratory

syncytial virus. Proc. Natl. Acad. Sci. U. S. A 81:7683-7687.

• Collins, P. L.,K. McIntosh, and R. M. Chanock. 2001. Respiratory syncytial

virus, p. 1443-1485. In D. M. Knipe, P. M. Howley, and D. E. Griffin (ed.),

Fields virology, 4th ed., vol.2. Lippincott Williams & Wilkins, Philadelphia,

Pa.

References

86

• Collins, P. L. and G. W. Wertz. 1983. cDNA cloning and transcriptional

mapping of nine polyadenylylated RNAs encoded by the genome of

human respiratory syncytial virus. Proc. Natl. Acad. Sci. U. S. A 80:3208-

3212.

• Dutch, R. E., T. S. Jardetzky, and R. A. Lamb. 2000. Virus membrane

fusion proteins: biological machines that undergo a metamorphosis.

Biosci. Rep. 20:597-612.

• Fearns, R. and P. L. Collins. 1999. Role of the M2-1 transcription

antitermination protein of respiratory syncytial virus in sequential

transcription. J. Virol. 73:5852-5864.

• Feldman, S. A., S. Audet, and J. A. Beeler. 2000. The fusion glycoprotein

of human respiratory syncytial virus facilitates virus attachment and

infectivity via an interaction with cellular heparan sulfate. J. Virol. 74:6442-

6447.

• Feldman, S. A., R. M. Hendry, and J. A. Beeler. 1999. Identification of a

linear heparin binding domain for human respiratory syncytial virus

attachment glycoprotein G. J. Virol. 73:6610-6617.

• Furuta, R. A., C. T. Wild, Y. Weng, and C. D. Weiss. 1998. Capture of an

early fusion-active conformation of HIV-1 gp41. Nat. Struct. Biol. 5:276-

279

• Furze, J., G. Wertz, R. Lerch, and G. Taylor. 1994. Antigenic

heterogeneity of the attachment protein of bovine respiratory syncytial

virus. J. Gen. Virol. 75 ( Pt 2):363-370.

• Gerschwin J., E. Schelegle, R. Gunther, et al., 2000. A bovine model of

vaccine enhanced respiratory syncytial virus pathophysiology. Vaccine 16:

1225-1236.

• Ghildyal, R., C. Baulch-Brown, J. Mills, and J. Meanger. 2003. The matrix

protein of Human respiratory syncytial virus localises to the nucleus of

infected cells and inhibits transcription. Arch. Virol. 148:1419-1429.

References

87

• Gonzalez-Reyes, L., M. B. Ruiz-Arguello, B. Garcia-Barreno, L. Calder, J.

A. Lopez, J. P. Albar, J. J. Skehel, D. C. Wiley, and J. A. Melero. 2001.

Cleavage of the human respiratory syncytial virus fusion protein at two

distinct sites is required for activation of membrane fusion. Proc. Natl.

Acad. Sci. U. S. A 98:9859-9864.

• Grosfeld, H., M. G. Hill, and P. L. Collins. 1995. RNA replication by

respiratory syncytial virus (RSV) is directed by the N, P, and L proteins;

transcription also occurs under these conditions but requires RSV

superinfection for efficient synthesis of full-length mRNA. J. Virol. 69:5677-

5686.

• Hallak, L. K., P. L. Collins, W. Knudson, and M. E. Peeples. 2000a.

Iduronic acid-containing glycosaminoglycans on target cells are required

for efficient respiratory syncytial virus infection. Virology 271:264-275.

• Hallak, L. K., D. Spillmann, P. L. Collins, and M. E. Peeples. 2000b.

Glycosaminoglycan sulfation requirements for respiratory syncytial virus

infection. J. Virol. 74:10508-10513.

• Hardy, R. W., S. B. Harmon, and G. W. Wertz. 1999. Diverse gene

junctions of respiratory syncytial virus modulate the efficiency of

transcription termination and respond differently to M2-mediated

antitermination. J. Virol. 73:170-176.

• Heminway, B. R., Y. Yu, Y. Tanaka, K. G. Perrine, E. Gustafson, J. M.

Bernstein, and M. S. Galinski. 1994. Analysis of respiratory syncytial virus

F, G, and SH proteins in cell fusion. Virology 200:801-805.

• Hileman, R. E., J. R. Fromm, J. M. Weiler, and R. J. Linhardt. 1998.

Glycosaminoglycan-protein interactions: definition of consensus sites in

glycosaminoglycan binding proteins. Bioessays 20:156-167.

• Karger, A., U. Schmidt, and U. J. Buchholz. 2001. Recombinant bovine

respiratory syncytial virus with deletions of the G or SH genes: G and F

proteins bind heparin. J. Gen. Virol. 82:631-640.

References

88

• Karron, R. A., D. A. Buonagurio, A. F. Georgiu, S. S. Whitehead, J. E.

Adamus, M. L. Clements-Mann, D. O. Harris, V. B. Randolph, S. A. Udem,

B. R. Murphy, and M. S. Sidhu. 1997. Respiratory syncytial virus (RSV)

SH and G proteins are not essential for viral replication in vitro: clinical

evaluation and molecular characterization of a cold-passaged, attenuated

RSV subgroup B mutant. Proc. Natl. Acad. Sci. U. S. A 94:13961-13966.

• Kimman, T. G. and F. Westenbrink. 1990. Immunity to human and bovine

respiratory syncytial virus. Arch. Virol. 112:1-25.

• Kimman, T. G., G. M. Zimmer, F. Westenbrink, J. Mars, and E. van

Leeuwen. 1988. Epidemiological study of bovine respiratory syncytial virus

infections in calves: influence of maternal antibodies on the outcome of

disease. Vet. Rec. 123:104-109.

• Krummenacher, C., A. V. Nicola, J. C. Whitbeck, H. Lou, W. Hou, J. D.

Lambris, R. J. Geraghty, P. G. Spear, G. H. Cohen, and R. J. Eisenberg.

1998. Herpes simplex virus glycoprotein D can bind to poliovirus receptor-

related protein 1 or herpesvirus entry mediator, two structurally unrelated

mediators of virus entry. J. Virol. 72:7064-7074.

• Krusat, T. and H. J. Streckert. 1997. Heparin-dependent attachment of

respiratory syncytial virus (RSV) to host cells. Arch. Virol. 142:1247-1254.

• Kuo, L., R. Fearns, and P. L. Collins. 1997. Analysis of the gene start and

gene end signals of human respiratory syncytial virus: quasi-templated

initiation at position 1 of the encoded mRNA. J. Virol. 71:4944-4953.

• Kuo, L., H. Grosfeld, J. Cristina, M. G. Hill, and P. L. Collins. 1996. Effects

of mutations in the gene-start and gene-end sequence motifs on

transcription of monocistronic and dicistronic minigenomes of respiratory

syncytial virus. J. Virol. 70:6892-6901.

• Kyhse-Andersen, J. 1984. Electroblotting of multiple gels: a simple

apparatus without buffer tank for rapid transfer of proteins from

References

89

polyacrylamide to nitrocellulose. J. Biochem. Biophys. Methods 10:203-

209.

• Le Bivic, A., F. X. Real, and E. Rodriguez-Boulan. 1989. Vectorial

targeting of apical and basolateral plasma membrane proteins in a human

adenocarcinoma epithelial cell line. Proc. Natl. Acad. Sci. U. S. A 86:9313-

9317.

• Lerch, R. A., K. Anderson, and G. W. Wertz. 1990. Nucleotide sequence

analysis and expression from recombinant vectors demonstrate that the

attachment protein G of bovine respiratory syncytial virus is distinct from

that of human respiratory syncytial virus. J. Virol. 64:5559-5569.

• Levine, S., R. Klaiber-Franco, and P. R. Paradiso. 1987. Demonstration

that glycoprotein G is the attachment protein of respiratory syncytial virus.

J. Gen. Virol. 68 ( Pt 9):2521-2524.

• Lindahl, U., K. Lidholt, D. Spillmann, and L, Kjellen. 1994. More to

“heparin” than anticoagulation. Thromb. Res. 75:1-32

• Mallipeddi, S. K. and S. K. Samal. 1993. Sequence variability of the

glycoprotein gene of bovine respiratory syncytial virus. J. Gen. Virol. 74 (

Pt 9):2001-2004.

• Moss, B., O. Elroy-Stein, T. Mizukami, W. A. Alexander, and T. R. Fuerst.

1990. Product review. New mammalian expression vectors. Nature

348:91-92.

• Murphy, F. A., P. J. Gibbs, M.C. Horzinek, and M. J. Studdert. 1999.

Paramyxoviridae. p. 412-428. Veterinary Virology. 3rd ed., Academic

Press. A division of Harcour Brace & Company.

• Olmsted, R. A. and P. L. Collins. 1989. The 1A protein of respiratory

syncytial virus is an integral membrane protein present as multiple,

structurally distinct species. J. Virol. 63:2019-2029.

References

90

• Paccaud, M. F. and C. Jacquier. 1970. A respiratory syncytial virus of

bovine origin. Arch. Gesamte Virusforsch. 30:327-342.

• Samal, S. K. and M. Zamora. 1991. Nucleotide sequence analysis of a

matrix and small hydrophobic protein dicistronic mRNA of bovine

respiratory syncytial virus demonstrates extensive sequence divergence of

the small hydrophobic protein from that of human respiratory syncytial

virus. J. Gen. Virol. 72 ( Pt 7):1715-1720.

• Satake, M., J. E. Coligan, N. Elango, E. Norrby, and S. Venkatesan. 1985.

Respiratory syncytial virus envelope glycoprotein (G) has a novel

structure. Nucleic Acids Res. 13:7795-7812.

• Schlender, J., B. Bossert, U. Buchholz, and K. K. Conzelmann. 2000.

Bovine respiratory syncytial virus nonstructural proteins NS1 and NS2

cooperatively antagonize alpha/beta interferon-induced antiviral response.

J. Virol. 74:8234-8242.

• Schlender, J., G. Zimmer, G. Herrler, and K. K. Conzelmann. 2003.

Respiratory syncytial virus (RSV) fusion protein subunit F2, not attachment

protein G, determines the specificity of RSV infection. J. Virol. 77:4609-

4616.

• Schnell, M. J., T. Mebatsion, and K. K. Conzelmann. 1994. Infectious

rabies viruses from cloned cDNA. EMBO J. 13:4195-4203.

• Shields, B., J. Mills, R. Ghildyal, P. Gooley, and J. Meanger. 2003. Multiple

heparin binding domains of respiratory syncytial virus G mediate binding to

mammalian cells. Arch. Virol. 148:1987-2003.

• Skehel, J. J. and D. C. Wiley. 2000. Receptor binding and membrane

fusion in virus entry: the influenza hemagglutinin. Annu. Rev. Biochem.

69:531-569.

• Spann, K. M., K. C. Tran, B. Chi, R. L. Rabin, and P. L. Collins. 2004.

Suppression of the induction of alpha, beta, and lambda interferons by the

References

91

NS1 and NS2 proteins of human respiratory syncytial virus in human

epithelial cells and macrophages [corrected]. J. Virol. 78:4363-4369.

• Sutter, G., M. Ohlmann, and V. Erfle. 1995. Non-replicating vaccinia vector

efficiently expresses bacteriophage T7 RNA polymerase. FEBS Lett.

371:9-12.

• Taylor, G., L. H. Thomas, J. M. Furze, R. S. Cook, S. G. Wyld, R. Lerch,

R. Hardy, and G. W. Wertz. 1997. Recombinant vaccinia viruses

expressing the F, G or N, but not the M2, protein of bovine respiratory

syncytial virus (BRSV) induce resistance to BRSV challenge in the calf

and protect against the development of pneumonic lesions. J. Gen. Virol.

78 ( Pt 12):3195-3206.

• Techaarpornkul, S., N. Barretto, and M. E. Peeples. 2001. Functional

analysis of recombinant respiratory syncytial virus deletion mutants lacking

the small hydrophobic and/or attachment glycoprotein gene. J. Virol.

75:6825-6834.

• Techaarpornkul, S., P. L. Collins, and M. E. Peeples. 2002. Respiratory

syncytial virus with the fusion protein as its only viral glycoprotein is less

dependent on cellular glycosaminoglycans for attachment than complete

virus. Virology 294:296-304.

• Teng, M. N. and P. L. Collins. 1998. Identification of the respiratory

syncytial virus proteins required for formation and passage of helper-

dependent infectious particles. J. Virol. 72:5707-5716.

• Teng, M. N. and P. L. Collins. 2002. The central conserved cystine noose

of the attachment G protein of human respiratory syncytial virus is not

required for efficient viral infection in vitro or in vivo. J. Virol. 76:6164-6171.

• Teng, M. N., S. S. Whitehead, A. Bermingham, M. St Claire, W. R. Elkins,

B. R. Murphy, and P. L. Collins. 2000. Recombinant respiratory syncytial

virus that does not express the NS1 or M2-2 protein is highly attenuated

and immunogenic in chimpanzees. J. Virol. 74:9317-9321.

References

92

• Thomas, L. H., R. S. Cook, S. G. Wyld, J. M. Furze, and G. Taylor. 1998.

Passive protection of gnotobiotic calves using monoclonal antibodies

directed at different epitopes on the fusion protein of bovine respiratory

syncytial virus. J. Infect. Dis. 177:874-880.

• Valarcher, J. F., F. Schelcher, and H. Bourhy. 2000. Evolution of bovine

respiratory syncytial virus. J. Virol. 74:10714-10728.

• Van der Poel, W. H., A. Brand, J. A. Kramps, and J. T. Van Oirschot.

1994. Respiratory syncytial virus infections in human beings and in cattle.

J. Infect. 29:215-228.

• Weissenhorn, W., A. Dessen, L. J. Calder, S. C. Harrison, J. J. Skehel,

and D. C. Wiley. 1999. Structural basis for membrane fusion by enveloped

viruses. Mol. Membr. Biol. 16:3-9.

• Wertz, G. W., P. L. Collins, Y. Huang, C. Gruber, S. Levine, and L. A. Ball.

1985. Nucleotide sequence of the G protein gene of human respiratory

syncytial virus reveals an unusual type of viral membrane protein. Proc.

Natl. Acad. Sci. U. S. A 82:4075-4079.

• West K., L. Petrie, and C. Konoby. 2000. The efficacy of modified-live

bovine respiratory syncytial virus vaccines in experimentally infected

calves. Vaccine 18:907-919

• West K., L. Petrie, and D. M. Haines. 1999. The effect of formalin-

inactivated vaccine of respiratory disease associated with live bovine

respiratory syncytial virus infection in calves. Vaccine 17:809-820.

• Whitehead, S. S., A. Bukreyev, M. N. Teng, C. Y. Firestone, M. St Claire,

W. R. Elkins, P. L. Collins, and B. R. Murphy. 1999. Recombinant

respiratory syncytial virus bearing a deletion of either the NS2 or SH gene

is attenuated in chimpanzees. J. Virol. 73:3438-3442.

• WuDunn, D. and P. G. Spear. 1989. Initial interaction of herpes simplex

virus with cells is binding to heparan sulfate. J. Virol. 63:52-58.

References

93

• Yu, Q., R. W. Hardy, and G. W. Wertz. 1995. Functional cDNA clones of

the human respiratory syncytial (RS) virus N, P, and L proteins support

replication of RS virus genomic RNA analogs and define minimal trans-

acting requirements for RNA replication. J. Virol. 69:2412-2419.

• Zamora, M. and S. K. Samal. 1992. Gene junction sequences of bovine

respiratory syncytial virus. Virus Res. 24:115-121.

• Zimmer, G., L. Budz, and G. Herrler. 2001. Proteolytic activation of

respiratory syncytial virus fusion protein. Cleavage at two furin consensus

sequences. J. Biol. Chem. 276:31642-31650.

• Zimmer, G., K. K. Conzelmann, and G. Herrler. 2002. Cleavage at the furin

consensus sequence RAR/KR(109) and presence of the intervening

peptide of the respiratory syncytial virus fusion protein are dispensable for

virus replication in cell culture. J. Virol. 76:9218-9224.

• Zimmer, G., M. Rohn, G. P. McGregor, M. Schemann, K. K. Conzelmann,

and G. Herrler. 2003. Virokinin, a bioactive peptide of the tachykinin family,

is released from the fusion protein of bovine respiratory syncytial virus. J.

Biol. Chem. 278:46854-46861

Sequences

94

10 Sequences

Amino acid sequence of the complete F protein (amino acid 1-574)

MATTAMRMII SIIFISTYVT HITLCQNITE EFYQSTCSAV SRGYLSALRT

GWYTSVVTIE LSKIQKNVCK STDSKVKLIK QELERYNNAV VELQSLMQNE

PASFSRAKRG IPELIHYTRN STKKFYGLMG KKRKRRFLGF LLGIGSAVAS

GVAVSKVLHL EGEVNKIKNA LLSTNKAVVS LSNGVSVLTS KVLDLKNYID

KELLPQVNNH DCRISNIETV IEFQQKNNRL LEIAREFSVN AGITTPLSTY

MLTNSELLSL INDMPITNDQ KKLMSSNVQI VRQQSYSIMS VVKEEVIAYV

VQLPIYGVID TPCWKLHTSP LCTTDNKEGS NICLTRTDRG WYCDNAGSVS

FFPQTETCKV QSNRVFCDTM NSLTLPTDVN LCNTDIFNTK YDCKIMTSKT

DISSSVITSI GAIVSCYGKT KCTASNKNRG IIKTFSNGCD YVSNKGVDTV

SVGNTLYYVN KLEGKALYIK GEPIINYYDP LVFPSDEFDA SIAQVNAKIN

QSLAFIRRSD ELLHSVDVGK STTNVVITTI IIVIVVVILM LIAVGLLFYC

KTKSTPIMLG KDQLSGINNL SFSK

Nucleotide sequence of the complete F gene (bp 5570-7294)

a tggcgacaac

5581 agccatgagg atgatcatca gcattatctt catctctacc tatgtgacac atatcacttt

5641 atgccaaaac ataacagaag aattttatca atcaacatgc agtgcagtta gtagaggtta

5701 ccttagtgca ttaagaactg gatggtatac aagtgtggta acaatagagt tgagcaaaat

5761 acaaaaaaat gtgtgtaaaa gtactgattc aaaagtgaaa ttaataaagc aagaactaga

5821 aagatacaac aatgcagtag tggaattgca gtcacttatg caaaatgaac cggcctcctt

5881 cagtagagca aaaagaggga taccagagtt gatacattat acaagaaact ctacaaaaaa

5941 gttttatggg ctaatgggca agaagagaaa aaggagattt ttaggattct tgctaggtat

6001 tggatctgct gttgcaagtg gtgtagcagt gtccaaagta ctacacctgg agggagaggt

6061 gaataaaatt aaaaatgcac tgctatccac aaataaagca gtagttagtc tatccaatgg

6121 agttagtgtc cttactagca aagtacttga tctaaagaac tatatagaca aagagcttct

6181 acctcaagtt aacaatcatg attgtaggat atccaacata gaaactgtga tagaattcca

6241 acaaaaaaac aatagattgt tagaaattgc tagggaattt agtgtaaatg ctggtattac

6301 cacacctctc agtacataca tgttgaccaa tagtgaatta ctatcactaa ttaatgatat

6361 gcctataacg aatgaccaaa aaaagctaat gtcaagtaat gttcaaatag tcaggcaaca

Sequences

95

6421 gagttattcc attatgtcag tggtcaaaga agaagtcata gcttatgttg tacaattgcc

6481 tatttatgga gttatagaca ccccctgttg gaaactacac acctctccgt tatgcaccac

6541 tgataataaa gaagggtcaa acatctgctt aactaggaca gatcgtgggt ggtattgtga

6601 caatgcaggc tctgtgtctt ttttcccaca gacagagaca tgtaaggtac aatcaaatag

6661 agtgttctgt gacacaatga acagtttaac tctgcctact gacgttaact tatgcaacac

6721 tgacatattc aatacaaagt atgactgtaa aataatgaca tctaaaactg acataagtag

6781 ctctgtgata acttcaattg gagctattgt atcatgctat gggaagacaa aatgtacagc

6841 ttctaataaa aatcgtggaa tcataaagac tttttccaat gggtgtgatt atgtatcaaa

6901 caaaggagta gatactgtat ctgttggtaa cacactatat tatgtaaata agctagaggg

6961 gaaagcactc tatataaagg gtgaaccaat tattaattac tatgatccac tagtgtttcc

7021 ttctgatgag tttgatgcat caattgccca agtaaacgca aaaataaacc aaagcctggc

7081 cttcatacgt cgatctgatg agttacttca cagtgtagat gtaggaaaat ccaccacaaa

7141 tgtagtaatt actactatta tcatagtgat agttgtagtg atattaatgt taatagctgt

7201 aggattactg ttttactgta agaccaagag tactcctatc atgttaggga aggatcagct

7261 cagtggtatc aacaatcttt cctttagtaa atga

96

11 Acknowledgements

I would like to thank to my supervisor PD Dr. Gert Zimmer and to Prof. Dr.

Georg Herrler, for the initiation of this study and for their continuous guidance,

help and confidence.

Furthermore, I would like to thank the members of my advisory committee,

Prof. Dr. Peter Valentin-Weigand and Prof. Dr. Thomas Schulz for their intense

interest in my work and for their valuable discussions.

I thank to the whole staff of Virology Institute, University of Veterinary

Medicine Hannover, for their continuous help in the laboratory, as well as their

friendly and cordially attitude.

Last but not least, I would like to thank my family and friends for their

continuous support and encouragement.

This study was supported by the German Research Council (Deutsche

Forschungsgemeinschaft), grant GRK 745.

characterization of the heparin-binding activity of the ... · pbsm phosphate buffer saline without...

Documents