JOURNAL OF BACTERIOLOGY,0021-9193/99/$04.0010

Aug. 1999, p. 5075–5080 Vol. 181, No. 16

Copyright © 1999, American Society for Microbiology. All Rights Reserved.

Characterization of Binding Sequences for ButyrolactoneAutoregulator Receptors in Streptomycetes

HIROSHI KINOSHITA, TOMOHIRO TSUJI, HIROOMI IPPOSHI, TAKUYA NIHIRA,*AND YASUHIRO YAMADA

Department of Biotechnology, Graduate School of Engineering, Osaka University, 2-1 Yamadaoka, Suita,Osaka 565-0871, Japan

Received 16 February 1999/Accepted 24 May 1999

BarA of Streptomyces virginiae is a specific receptor protein for a member of butyrolactone autoregulatorswhich binds to an upstream region of target genes to control transcription, leading to the production of theantibiotic virginiamycin M1 and S. BarA-binding DNA sequences (BarA-responsive elements [BAREs]), towhich BarA binds for transcriptional control, were restricted to 26 to 29-nucleotide (nt) sequences on barA andbarB upstream regions by the surface plasmon resonance technique, gel shift assay, and DNase I footprintanalysis. Two BAREs (BARE-1 and BARE-2) on the barB upstream region were located 57 to 29 bp (BARE-1)and 268 to 241 bp (BARE-2) upstream from the barB translational start codon. The BARE located on the barAupstream region (BARE-3) was found 101 to 76 bp upstream of the barA start codon. High-resolution S1nuclease mapping analysis revealed that BARE-1 covered the barB transcription start site and BARE-3 coveredan autoregulator-dependent transcription start site of the barA gene. Deletion and mutation analysis ofBARE-2 demonstrated that at least a 19-nt sequence was required for sufficient BarA binding, and A or Tresidues at the edge as well as internal conserved nucleotides were indispensable. The identified bindingsequences for autoregulator receptor proteins were found to be highly conserved among Streptomyces species.

Streptomyces virginiae produces two types of antibiotics, vir-giniamycins M1 and S, both of which act synergistically asirreversible inhibitors of protein synthesis and show bacteri-cidal activity against gram-positive bacteria (1). The production ofthe two antibiotics is induced by nanomolar concentrations ofvirginiae butanolides (VBs), members of low-molecular-weightStreptomyces hormones called butyrolactone autoregulators(14, 24, 27, 29). The signal of VBs is transmitted to the cellthrough binding of VBs to the specific receptor protein buty-rolactone autoregulator receptor (BarA) (19). BarA possessesa helix-turn-helix DNA-binding motif on its amino terminus (5,11), and in-frame deletion of the motif in the genome of S.virginiae resulted in a loss-of-function mutant with respect tothe VB-dependent induction of virginiamycin production (18).In vitro experiments confirmed that BarA binds to DNA se-quences in the absence of VB and dissociates from DNA bybinding with VB (10), suggesting that the DNA-binding abilityis central to the role of BarA as a mediator of the VB signal.

In a previous report (10), we demonstrated that BarA bindsspecifically to upstream regions of the barA gene itself and alsoto the downstream barB gene, which codes for a putative tran-scriptional regulator deduced from the homology with BarA.The aim of the present study was to localize precisely the targetDNA sequences of BarA (BarA-responsive elements[BAREs]) as well as to evaluate by deletion and mutationanalysis the essential nucleotides in BARE. Three identifiedBAREs were all A-T rich and showed potential for forming apartial palindrome. Deletion and mutation analyses revealed aminimum BARE of 19-nucleotide (nt) sequences with severalessential nucleotides for BarA binding.

MATERIALS AND METHODS

Strains, culture media, and cultivation conditions. S. virginiae MAFF10-06014(National Food Research Institute, Ministry of Agriculture, Forestry and Fish-eries, Tsukuba, Japan) was grown at 28°C as described previously (4, 9). VB-C6was added at 8 h of cultivation to a final concentration of 300 nM, comparableto that produced by S. virginiae (VB activity of 32 to 150 U/ml, which is equivalentto 85 to 150 nM VB-A or 425-750 nM VB-C6). For genetic manipulation,Escherichia coli DH5a was used. For expression of the barA gene, E. coliBL21(DE3)/pLysS was used as the host. DNA manipulations in E. coli wereperformed as described by Sambrook et al. (23).

Chemicals. All chemicals were of reagent or high-performance liquid chro-matography grade and were purchased from either Nacali Tesque, Inc. (Osaka,Japan), Takara Shuzo Co. (Shiga, Japan), or Wako Pure Chemical Industrial,Ltd. (Osaka, Japan).

Primer extension. Primer extension analysis was performed as described bySambrook et al. (23). Total RNA was isolated by a procedure reported byHopwood et al. (6). Quantification of the RNA was performed at an absorbanceat 260 nm. The primer 59-GAAGGCGCGTTCCTGTTTGGGTGTCAA-39,which is complementary to nt 127 to 11 relative to the barB start codon, was59-end labeled with [g-32P]ATP and T4 polynucleotide kinase. The unincorpo-rated ATP was separated by using a Primer/Probe purification kit (AdvancedGenetic Technologies Co.). 32P-labeled primer was annealed to S. virginiae RNA.Rous-associated virus 2 reverse transcriptase was used to extend the reversetranscripts starting from the primer. For the sequencing ladder, the 32P-labeledprimer was used with a BcaBEST dideoxy sequencing kit (Takara Shuzo); theStuI fragment shown in Fig. 1 served as the template. The ladder and the RNAprimer-extended product were resolved on a 6% polyacrylamide–8 M urea gel.

S1 nuclease mapping. Total RNA for S1 nuclease mapping was isolated asdescribed for primer extension experiments. Labeled DNA fragments were pro-duced for the identification of barA transcriptional start sites (TSS). pAR489,which consisted of pUC19 and a 2.8-kbp BamHI fragment containing the barAgene (19), was digested with endonucleases SphI and KpnI. An isolated fragmentwas then subcloned in pUC19, which provided the template for the PCR toprepare the labeled fragment, using M13 primer RV-N (Takara Shuzo) and 59[g-32P]ATP-labeled primer 59-GCCCGTTCCTGTCGCACTGC-39; the latterprimer is complementary to nt 144 to 125 relative to the barA start codon. Thelabeled primer was also used for making DNA sequencing ladders. RNA (50 mg)was dried with the 32P-labeled DNA probes (100,000 cpm). Pellets were sus-pended in 20 ml of 3 M sodium trichloroacetate buffer [40 mM piperazine-N,N9-bis(2-ethanesulfonic acid) (PIPES), 1 mM EDTA (pH 7.0)]. Tubes were placedin a water bath that was kept at 65°C for 15 min; they were then allowed to coolto 45°C overnight. All subsequent steps were as described by Janssen et al. (8).

Biosensor assays of protein-DNA interactions. Protein-DNA interaction wasmeasured by the BIAcore system (Pharmacia Biosensor). BIAcore utilizes sur-face plasmon resonance (SPR), a quantum mechanical phenomenon which de-tects changes in the refractive index of incident light close to the surface of a thin

* Corresponding author. Mailing address: Department of Biotech-nology, Graduate School of Engineering, Osaka University, 2-1Yamadaoka, Suita, Osaka 565-0871, Japan. Phone: 81-6-6879-7433.Fax: 81-6-6879-7432. E-mail: nihira@biochem.bio.eng.osaka-u.ac.jp.

5075

on February 11, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

gold film on a glass support (i.e., sensor chip) (2). The surface of the sensor chipis covered with a carboxymethylated dextran polymer. One of the reactants islinked either directly or indirectly to this polymer, by means of the specificinteraction between biotin and streptavidin, while the other is introduced in flowover the surface. Binding of the soluble ligand to the immobilized one leads toan increase in the ligand concentration at the sensor surface, with a correspond-ing increase in the refractive index. This change in refractive index alters the SPRin an optically detectable manner. Binding is evaluated in arbitrary responseunits (RU), and a linear relationship exists between the mass of ligand bound tothe dextran matrix and the RU observed. A signal of 1,000 RU corresponds to asurface concentration change of approximately 1 ng/mm2.

An SA5 sensor chip (research grade; precoated with approximately 4,000 RUof streptavidin) was obtained from Pharmacia Biosensor. Synthesized targetDNA fragments were subcloned into the KpnI-SacI site in pUC19. They werethen biotinylated by PCR with primers 59-GTAAAACGACGGCCAGT-39 andbiotin-59-CAGGAAACA-GCTATGAC-39, located just outside the multicloningsite in pUC19. Seventy microliters of biotinylated DNA (200 mg in 10 mMHEPES [pH 7.0]–1.0 M KCl) was injected over the surface of the chip under acontinuous flow of 5 ml/min of 10 mM HEPES (pH 7.0) containing 1.0 M KCland 0.005% (vol/vol) Tween 20.

Recombinant BarA (rBarA) was expressed and purified as described previ-ously (19). During the interaction between rBarA and DNA, 50 mM triethanol-amine (TEA)-HCl (pH 7.0) containing 0.2 M KCl and 0.005% (vol/vol) Tween20 was used as the running buffer. A 30-ml sample (3.65 mM rBarA in 50 mMTEA-HCl [pH 7.0]) containing 0.2 M KCl) was injected across the sensor surfaceon which the corresponding DNA fragment had been immobilized. All experi-ments were performed at 25°C. Control DNA used in this experiment and in gelshift assays was the PCR fragment containing only the multicloning site ofpUC19 amplified with the above-mentioned primers.

Gel shift assay. The gel shift assay was carried out as described previously (10).The DNA-protein binding reaction was carried out with 250 pg of 32P-labeleddouble-stranded fragments (10,000 to 20,000 cpm) and 1.1 mg (final concentra-tion, 2.92 mM) of purified rBarA in 13 binding buffer [50 mM TEA-HCl (pH7.0) containing 0.2 M KCl, 10% (vol/vol) glycerol, and 1 mg of poly(dI-dC) zpoly(dI-dC)] in a total volume of 15 ml. After incubation at 25°C for 2 min,autoregulators (final concentration, 150 mM) were added, followed by a further5-min incubation at 25°C. The reaction mixture was subjected to electrophoresisat 4°C on a high-ionic-strength gel containing 5% acrylamide and 0.167% N,N9-methylenebisacrylamide with 50 mM Tris-Cl (pH 8.5) containing 380 mM glycineand 2 mM EDTA as a running buffer. Gels were dried and subjected to auto-radiography.

DNase I footprint analysis. DNase I footprint analyses were carried out with45 ml of the DNA-protein binding reaction mixture as described above. Afterincubation at 25°C for 5 min, 5 ml of DNase I solution (100 mM MgCl2, 50 mMCaCl2), with several different amounts of DNase I (1.5 to 0.1 U) purchased fromLife Technologies Inc. (Rockville, Md.), was added to each reaction mixture,which was then incubated for 1 min at 25°C. DNase digestion was stopped by theaddition of 400 ml of DNase I stop solution (150 mM sodium acetate, 10 mMEDTA, 25 mg of tRNA [Boehringer Mannheim Corp., Indianapolis, Ind.] perml). Samples were then subjected to phenol extraction and ethanol precipitation.The resulting pellet was resuspended in 5 ml of sequencing loading buffer andapplied to a 6% polyacrylamide gel.

Nucleotide sequence accession number. Sequences shown in Fig. 1 have beenassigned DDBJ, EMBL, and GenBank accession no. D3251.

RESULTS AND DISCUSSION

Identification of BAREs by the SPR technique, gel shiftassay, and footprint analysis on barA and barB upstream re-gions. In a previous study (10), we found that the VB receptorBarA bound to both upstream regions of the barA and barBgenes and regulated their expression depending on the pres-ence of VB. We concluded that at least two BAREs arepresent in the barB upstream region: one in the 73-bp AgeI-EheI region, and another in the 137-bp Nc137 fragment (NaeI-StuI region in Fig. 1) containing the barB translation startcodon. One BARE is also located in the 258-bp fragmentimmediately upstream of the barA translational start codon(Fig. 1). To further localize BAREs, several fragments of 35 to40 bp (PB01 to PB05) were synthesized from the two regions ofthe barB gene (Table 1). PA01 was constructed on the basis ofthe sequence of the barA promoter region as a putative BARE,as judged from the homology of the sequence of the barBpromoter region. The synthesized oligonucleotides were an-nealed with each complementary fragment and cloned intopUC19. Biotin was introduced into the fragments by PCR witha 59-biotinylated universal primer, and the fragments were

immobilized on the sensor chip of a BIAcore system (seeMaterials and Methods for detail). The biological interactionin SPR analysis was evaluated by the maximum increase ofSPR signal attained during the association phase or by the levelof signal slightly after the transition from association phase todissociation phase. With strengthening of the interaction be-tween the immobilized DNA and the free rBarA in the flow,the SPR signal increases more steeply in the association phaseand reaches a higher level. When shifted from the associationphase to the dissociation phase in which rBarA is absent, thesignal drops suddenly and then decreases gradually. The firstdrop reflects the release of weakly bound rBarA, and thegradual decrease reflects the slow dissociation of tightly boundrBarA. The synthesized oligonucleotides PB01, PB02, PB04,and PA01 all showed steep increases and high maximum levelsof SPR signal during the association phase, while PB03 andPB05 showed levels of response similar to that of controlDNA. Furthermore, after being shifted to the dissociationphase, PB01, PB02, PB04, and PA01 showed high levels oftightly bound rBarA, as evident from the 1,300 to 2,000 RU ofslow decreasingly SPR signal, while responses of PB03 andPB05 were negligible compared to that of the control DNA(Fig. 2A). Gel shift assays clearly confirmed BarA binding tothe fragments as well as dissociation of BarA from the frag-ments in the presence of VB (Fig. 2B). From the intensity ofthe shifted bands, PB01 and PA01 seemed to possess an affinityfor BarA higher than those of other fragments (Fig. 2B).

To precisely identify BARE, DNase I footprint analysis wasalso performed for the barA and barB promoter regions. Wheneach 32P-labeled fragment was incubated with various concen-trations of DNase I in the absence and presence of BarA,BarA-dependent protection of regions ranging from 26 to 29bp in length were evident (Fig. 3). The BarA-protected regionsderived from analyses of both coding and noncoding strandsare listed in Table 2. These regions were all A-T rich (41.4,53.6, and 61.5% for BARE-1, -2, and -3, respectively), despitethe high GC content of the Streptomyces genome, and all pos-sessed partial inverted repeat elements. Fragments (PB01,PB04, and PA01) shown to bind with BarA by SPR analysisand gel shift assay contained the DNase I-protected regionsBARE-1, -2, and -3, respectively (Fig. 2; Tables 1 and 2).Although PB02 was shown to bind with BarA, the correspond-ing region was not protected by BarA, probably because of thelow affinity of the PB02 region toward BarA. Alternatively,binding of BarA to BARE-2 might prevent further access ofBarA to the PB02 region.

FIG. 1. Restriction enzyme map around the barA (A) and barB (B) promoterregions. Numbers indicate nucleotide positions.

5076 KINOSHITA ET AL. J. BACTERIOL.

on February 11, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

TSS of barA and barB. To clarify the BarA-dependent reg-ulation mechanism as regards the BAREs, TSS were deter-mined by either primer extension analyses or high-resolutionS1 nuclease mapping. A single extension product of 58 nt from

the C at position 1504 was detected for the barB transcript onlywhen an autoregulator VB was present in the medium as theresult of derepression by the VB (10) (Fig. 4A). The barB TSSwas present 21 bp upstream of the putative ribosome-bindingsequence of AGGAGTT, although neither a typical 235 nor210 sequence was found in the proper position from the TSS(Fig. 5). BARE-1 corresponded to 222 to 13 relative to thebarB TSS. Therefore, we postulated that BarA represses thetranscription of the barB gene in the absence of VB by inter-fering with the binding of RNA polymerase. The secondBARE (BARE-2) in the barB upstream region was about 200nt away from the TSS. Although the physiological function ofBARE-2 is not clear, the double BAREs may coordinate thetight repression of the barB gene by BarA.

For the barA transcript, S1 nuclease mapping was used todetermine the TSS because the primer extension experimentrevealed no signal, probably due to extension inhibition by aputative secondary structure. Three adjacent barA transcriptswere detected with RNA from a 10-h culture, corresponding toinitiations at CGG residues located 40 to 42 bp upstream of thebarA translational start codon (Fig. 4B and 5). Typical tran-scriptional promoter sequences, namely, 210 (TATCTA) and235 (TTGACA), were found at appropriate positions (Fig. 5).On the other hand, with RNA from 12-h cultivation when S.virginiae produced an autoregulator VB, another transcriptfrom an A residue further upstream was detected. This TSSlies in the middle of BARE-3, and no typical 235 or 210sequence was detected. We demonstrated previously that barAhad two modes of transcription; one was constitutive and VB-independent basal-level transcription, and the other was VB-induced transcription which was evident from the enhancedtranscript with internally produced or externally added VB(10). The result of S1 nuclease mapping suggested that thelarger transcript, starting from the middle of BARE-3, wasresponsible for the VB-dependent enhancement of transcrip-tion.

These results indicated that the BarA binding, in the ab-sence of VB to BAREs overlapping with transcriptional startsites, resulted in transcriptional repression of downstreamgenes. When the autoregulator VB is produced, it binds toBarA, thus forcing BarA to dissociate from BAREs. Hence,

TABLE 1. Nucleotide sequences used for BarA binding

Probe SequenceaAffinity

forBarA

PB01 GGCCAAAAACAAGGCAACCGGTCTGGTTTGACTTG 1*** ***

PB02 ACTTGGCAATCGGGTCTGACGGTTTGTATCGTGAT 1PB03 GTGATGCCGCAGCGCCGCAACTCGCACCGGGCGCCCGTTC 2PB04 AGGCAAGCGAACCGCTCGGTTTGCTGAACGTCTCGTGTGCT 1PB05 TTGCCTCAGCCAAACGGTGCACGTCAGGAGTTGCCTTGACA 2PB011 CAAAAACAAGGCAACCGGTCTGGTTTG 1PB012 AAACAAGGCAACCGGTCTGGTTTG 1PB013 ACAAGGCAACCGGTCTGGT 1PB11 GGCCAAAAACAAGGCAACCG 2PB12 CAAGGCAACCGGTCTGGTTT 2PB13 CAACCGGTCTGGTTTGACTT 2PB01c GGCCAAAAACAAGGCAACttGcCTtGTTTGACTTG 6

–•PB01d GGCCAAgctCtAGGCAACCGGTCTGcgaTGACTTG 2PA01 AAGATACATACCAACCGGTTCTTTTG 1

a Lowercase letters indicate substituted residues; asterisks mark residues required for binding. The sequence of PB04 is from complementary chain compared to otherprobes.

FIG. 2. (A) Localization of BARE on barA and barB promoters by the SPRtechnique. rBarA (3.65 mM) in 50 mM TEA-HCl buffer (pH 7.0) containing 0.2M KCl was introduced over the surface of the sensor chip to analyze BarAbinding to the indicated fragments during the association phase (100 to 460 s).rBarA was omitted from the flow during the dissociation phase (460 to 630 s). Ineach sensor chip, DNA corresponding to 800 to 1,000 RU was immobilized. (B)Gel shift assay with oligonucleotides containing BARE. In the rBarA row, aminus sign indicates that rBarA was omitted from the binding reaction and a plussign indicates that 2.92 mM rBarA was present. In the VB row, a minus signindicates that VB was not added to the binding reaction and a plus sign indicatesthat 150 mM VB was added. In all lanes, 125 pg of a 32P-labeled DNA probe waselectrophoresed. PB03, used as control DNA, showed no binding for BarA inSPR analysis.

VOL. 181, 1999 BarA-RESPONSIVE ELEMENT IN S. VIRGINIAE 5077

on February 11, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

the approach of RNA polymerase is enabled in order to initi-ate transcription.

Nucleotides in BARE essential for BarA binding. To deter-mine the essential nucleotides in BARE, several deleted ormodified BAREs were synthesized based on the sequences ofBARE-2 in the barB promoter, because BARE-2 showed thehighest symmetry (Table 2). The oligonucleotides (PB011 toPB01d) used as probes are listed in Table 1. The affinity towardBarA was investigated by the SPR technique using a BIAcoresystem. The minimum length of BAREs was determined to be19 bp of PB013 (Fig. 6A and Table 1). The affinity of PB011

and PB012 toward BarA was strong and almost equal to that ofPB01. However, PB013 showed a slightly reduced affinity, asevident from the SPR profile at the dissociation stage startingfrom 460 (Fig. 6A). Judging from the weak binding towardPB013 and the lack of binding toward PB12, BarA seemed torequire consecutive A and T residues for sufficient binding totake place (marked with asterisks in Table 1).

Since BARE seemed to have palindromic structures with Cas the center of symmetry (double underlined on PB01 orBAREs; Tables 1 and 2), mutated BAREs that have a sym-metrical structure were designed. No BarA binding was de-

FIG. 3. DNase I footprint analysis on the barA and barB promoter regions to identify BARE. rBarA (2.92 mM) was added to the reaction mixture to detect theBarA-protected sequence (1). The amount of DNase I was increased toward the right as indicated by the upper triangle. The sequences around PB04 (BARE-1). PB01(BARE-2), and PA01 (BARE-3) are in focus in panels a, b, and c.

TABLE 2. Protected region in DNase I footprint analyses and binding sites of autoregulator receptor protein from Streptomyces species

Region Sequencea

barB promoter (1506–1478b; BARE-1) GAGGCAAGCGAACCGCTC-GGTTTGCTGAA_ _ _ – • _ _ _barB promoter (1267–1294; BARE-2) CAAAAACAAGGCAACCGGTCTGGTTTGA___ __ – • __ ___barA promoter (353–378; BARE-3) AGATACATACCAACCGGT-TCTTTTGA_ _ – • _ _farA promoter (1429–1456; FARE) TAAGATACGAACGGGACGGAC-GGTTTGCAGC_ __ – • __ _ArpA binding site ACATACGGGACGGTC-GGTTTG__ – • __

AA GAACConsensus sequence aCa c CGgtc-ggTTTGTG CGGA

a Double underlines denote the center of the palindromic structure; arrows indicate the complementary pairs.b Complementary strand.

5078 KINOSHITA ET AL. J. BACTERIOL.

on February 11, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

tected on the probes covering the left half (PB11), the righthalf (PB13), or the mutant with disrupted symmetry at bothedges (PB01d) (Fig. 6B). With PB01c, a probe designed toform a complete palindrome by changing only 4 nt in the righthalf, BarA binding was significantly reduced (Fig. 6B). Theseresults suggested that the palindromic structure composed ofA and T rows at both ends was required but not sufficient forrecognition by BarA. In addition, the internal nucleotides sub-stituted in PB01c were essential for recognition by BarA. Con-

servation of the inner sequences among BARE-1, -2, and -3also seemed to indicate that these nucleotides are indispens-able for BarA binding.

The binding characteristics of the above-mentioned frag-ments were investigated by gel shift assay. Probes PB01,PB011, PB012, and PB013 were all confirmed as capable ofbinding with BarA (Fig. 7). The shifted band of PB011 andPB012 was strong, whereas that of PB01 was clear but weak.The shifted band of PB013 migrated only a little slower thandid the free probe and produced smear bands as well. Theseresults suggested that the affinity with BarA was strong in thecase of PB011 and PB012, weaker with PB01, and quite re-duced in the case PB013. The smear bands with PB013 areprobably due to the specific binding with BarA, as evidenced bythe fact that the shifted bands disappeared in the presence ofVB. Other probes (PB11, PB12, and PB01d) showed no signsof specific BarA binding. This observation is in good agree-

FIG. 4. Identification of the barA and barB TSS. (A) Primer extension anal-ysis of the barB transcripts in S. virginiae. Lanes T, G, C, and A represent asequencing ladder generated by the same primer. The asterisk represents theTSS. Lanes: 1, RNA after 10-h cultivation; 2, RNA after 8-h cultivation followedby 2-h cultivation with added VB. (B) High-resolution S1 mapping of the barAtranscripts in S. virginiae. Lanes A, C, G, and T represent a sequencing laddergenerated by the primer used for making the probe. Asterisks indicated theVB-independent TSS, and the outlined letter indicated the VB-dependent TSS.Lanes: 1, RNA after 10-h cultivation; 2, RNA after 12-h cultivation.

FIG. 5. Locations of the BARE sequences in barA and barB promoter re-gions. Sequences protected by BarA from DNase I digestion are indicated bybroken lines; locations of the TSS of barA and barB are indicated by arrows;putative 210 and 235 sequences for the constitutive barA TSS are underlined;the putative ribosome-binding site (RBS) of barB is boxed; translational startcodons of barA and a plausible start codon for barB are double underlined.

FIG. 6. SPR analysis of deleted (A) and mutated (B) versions of BARE-2.rBarA (3.65 mM) in 50 mM TEA-HCl buffer (pH 7.0) containing 0.2 M KCl wasintroduced over the surface of the sensor chip to analyze BarA-DNA interaction.Association phase, 100 to 460 s; dissociation phase, 460 to 630 s. In each sensorchip, DNA corresponding to 800 to 1,000 RU was immobilized.

FIG. 7. Gel shift assay with oligonucleotides containing modified BARE. Inthe rBarA row, a minus sign indicates that rBarA was omitted from the bindingreaction and a plus sign indicates that 2.92 mM rBarA was present. In the VBrow, a minus sign indicates that VB was not added to the binding reaction anda plus sign indicates that 150 mM VB was added. In all lanes, 125 pg of a32P-labeled DNA probe was electrophoresed.

VOL. 181, 1999 BarA-RESPONSIVE ELEMENT IN S. VIRGINIAE 5079

on February 11, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

ment with the results from the SPR analyses. The unknownband shown in PB11 and PB01d was judged to be nonspecific,because the mobility of the band was too small and the shift didnot disappear in the presence of VB. Probe PB01c showed avery weak but definite BarA binding in SPR analysis (probablybecause of the high sensitivity of SPR analysis, which candetect even a faint interaction of BarA with the probe) but nospecific retardation in the gel shift assay.

In Streptomyces species, 10 butyrolactone autoregulatorsclassified into three groups (VB type, IM-2 type, and A-factortype) (3, 7, 13–16, 22, 25–28) have been identified, and threereceptor proteins corresponding to the three types of auto-regulators have been characterized (19, 20, 30). The threereceptors (VB receptor BarA, IM-2 receptor FarA, and A-fac-tor receptor ArpA) show high overall homology, especially ofthe N termini where helix-turn-helix DNA-binding motifs arepresent. This finding suggests that similar DNA sequences maybe recognized by these autoregulator receptors. Although ar-tificial binding sequences for ArpA were screened from a ran-dom synthetic oligonucleotide pool by PCR amplification (21),no genes containing the reported ArpA-binding sequenceshave been identified. In the case of FarA, an IM-2 receptor,the FarA-binding sequence was localized in the farA promoterregion overlapping with the farA TSS (12). The close alignmentof BAREs, the FarA-binding sequence, and the artificialArpA-binding sequences (although their physiological rele-vance is not clear at present) suggests that the binding se-quences are all A-T rich, are only partially palindromic with Aand T rows at both ends, and share several highly conservedresidues (Table 2). The well-conserved target sequence forautoregulator receptors as well as the wide distribution ofautoregulators in Streptomyces suggest that transcriptional reg-ulation involving BARE-like sequences is widespread in thisgenus.

REFERENCES

1. Cocitto, C. 1979. Antibiotics of the virginiamycin family, inhibitors whichcontain synergistic components. Microbiol. Rev. 43:145–198.

2. Garland, P. B. 1996. Optical evanescent wave methods for the study ofbiomolecular interactions. Q. Rev. Biophys. 29:91–117.

3. Grafe, U., W. Schade, I. Eritt, W. F. Fleck, and L. Radics. 1982. A newinducer of anthracycline biosynthesis from Streptomyces viridochromogenes.J. Antibiot. 35:1722–1723.

4. Hillen, W., and C. Berens. 1994. Mechanisms underlying expression of tn10encoded tetracycline resistance. Annu. Rev. Microbiol. 48:345–369.

5. Hinrichs, W., C. Kisker, M. Duvel, A. Muller, K. Tovar, W. Hillen, and W.Saenger. 1994. Structure of the Tet repressor-tetracycline complex and reg-ulation of antibiotic resistance. Science 264:418–420.

6. Hopwood, D. A., M. J. Bibb, K. F. Chater, T. Kieser, C. J. Bruton, H. M.Kieser, D. J. Lydiate, C. P. Smith, J. M. Ward, and H. Schrempf. 1985.Genetic manipulation of Streptomyces: a laboratory manual. The John InnesFoundation, Norwich, United Kingdom.

7. Horinouchi, S., and T. Beppu. 1992. Autoregulatory factors and communi-cation in actinomycetes. Annu. Rev. Microbiol. 46:377–398.

8. Janssen, G. R., J. M. Ward, and M. J. Bibb. 1989. Unusual transcriptionaland translational features of the aminoglycoside phosphotransferase gene(aph) from Streptomyces fradiae. Genes Dev. 3:415–429.

9. Kim, H. S., T. Nihira, H. Tada, M. Yanagimoto, and Y. Yamada. 1989.

Identification of binding protein of virginiae butanolide C, an autoregulatorin virginiamycin production, from Streptomyces virginiae. J. Antibiot. 42:769–778.

10. Kinoshita, H., H. Ipposhi, S. Okamoto, H. Nakano, T. Nihira, and Y.Yamada. 1997. Butyrolactone autoregulator receptor protein (BarA) as atranscriptional regulator in Streptomyces virginiae. J. Bacteriol. 179:6986–6993.

11. Kisker, C., W. Hinrichs, K. Tovar, W. Hillen, and W. Saenger. 1995. Thecomplex formed between Tet repressor and tetracycline-Mg21 reveals mech-anism of antibiotic resistance. J. Mol. Biol. 247:260–280.

12. Kitani, S., H. Kinoshita, T. Nihira, and Y. Yamada. 1999. In vitro analysis ofthe butyrolactone autoregulator receptor protein (FarA) of Streptomyceslavendulae FRI-5 reveals that FarA acts as a DNA-binding transcriptionalregulator that controls its own synthesis. J. Bacteriol. 181:5081–5084.

13. Kleiner, E. M., S. A. Pliner, V. S. Soifer, V. V. Onoprienko, T. A. Blashova,B. V. Rosynov, and A. S. Khokhlov. 1976. The structure of A-factor, abioregulator from Streptomyces griseus. Bioorg. Khim. 2:1142–1147.

14. Kondo, K., Y. Higuchi, S. Sakuda, T. Nihira, and Y. Yamada. 1989. Newvirginiae butanolides from Streptomyces virginiae. J. Antibiot. 42:1873–1876.

15. Mizuno, K., S. Sakuda, T. Nihira, and Y. Yamada. 1996. Enzymatic resolu-tion of 2-acyl-3-hydroxymethyl-4-butanolide and preparation of optically ac-tive IM-2, the autoregulator from Streptomyces sp. FRI-5. Tetrahedron 50:10849–10858.

16. Mori, K. 1983. Revision of the absolute configuration of A-factor. Tetrahe-dron 39:3107–3109.

17. Murray, M. G. 1986. Use of sodium trichloroacetate and mung bean nucle-ase to increase sensitivity and precision during transcript mapping. Anal.Biochem. 158:165–170.

18. Nakano, H., E. Takehara, T. Nihira, and Y. Yamada. 1998. Gene replace-ment analysis of the Streptomyces virginiae barA gene encoding the butyro-lactone autoregulator receptor reveals that BarA acts as a repressor invirginiamycin biosynthesis. J. Bacteriol. 180:3317–3322.

19. Okamoto, S., K. Nakajima, T. Nihira, and Y. Yamada. 1995. Virginiaebutanolide binding protein from Streptomyces virginiae. J. Biol. Chem. 270:12319–12326.

20. Onaka, H., N. Ando, T. Nihira, Y. Yamada, T. Beppu, and S. Horinouchi.1995. Cloning and characterization of the A-factor receptor gene from Strep-tomyces griseus. J. Bacteriol. 177:6083–6092.

21. Onaka, H., and S. Horinouchi. 1997. DNA-binding activity of the A-factorreceptor protein and its recognition DNA sequences. Mol. Microbiol. 24:991–1000.

22. Sakuda, S., and Y. Yamada. 1991. Stereochemistry of butyrolactone auto-regulators from Streptomyces. Tetrahedron Lett. 32:1817–1820.

23. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold SpringHarbor, N.Y.

24. Sakuda, S., and Y. Yamada. 1991. Stereochemistry of butyrolactone auto-regulators from Streptomyces. Tetrahedron Lett. 32:1817–1820.

25. Sato, K., T. Nihira, S. Sakuda, M. Yanagimoto, and Y. Yamada. 1989.Isolation and structure of a new butyrolactone autoregulator from Strepto-myces sp. FRI-5. J. Ferment. Bioeng. 68:170–173.

26. Yamada, Y., T. Nihira, and S. Sakuda. 1992. Biosynthesis and receptorprotein of butyrolactone autoregulator of Streptomyces virginiae. Actinomy-cetologica 6:1–8.

27. Yamada, Y., K. Sugamura, K. Kondo, M. Yanagimoto, and H. Okada. 1987.The structure of inducing factors for virginiamycin production in Streptomy-ces virginiae. J. Antibiot. 40:496–504.

28. Yanagimoto, M., and T. Enatsu. 1983. Regulation of a blue pigment pro-duction by g-nonalactone in Streptomyces sp. J. Ferment. Technol. 61:545–550.

29. Yanagimoto, M., and G. Terui. 1971. Physiological studies staphylomycinproduction. II. Formation of a substance effective in inducing staphylomycinproduction. J. Ferment. Technol. 49:611–618.

30. Waki, M., T. Nihira, and Y. Yamada. Cloning and characterization of thegene (farA) encoding the receptor for an extracellular regulatory factor(IM-2) from Streptomyces sp. strain FRI-5. J. Bacteriol. 179:5131–5137.

5080 KINOSHITA ET AL. J. BACTERIOL.

on February 11, 2018 by guest

http://jb.asm.org/

Dow

nloaded from