characterization and induction kinetics of a putative candidate … · 2016. 10. 26. ·...

216 E u r o p e a n J o u r n a l o f H o r t i c u l t u r a l S c i e n c e

Eur. J. Hortic. Sci. 80(5), 216–224 | ISSN 1611-4426 print, 1611-4434 online | http://dx.doi.org/10.17660/eJHS.2015/80.5.3 | © ISHS 2015

Characterization and induction kinetics of a putative candidate gene associated with downy mildew resistance in grapevineC. Liang, L. Liu, C. Zang, K. Zhao and C. LiuInstitute of Plant Protection, Liaoning Academy of Agricultural Sciences, Shenyang, China

Original articleGerman Society for Horticultural Science

IntroductionDowny mildew, caused by the oomycete Plasmopara viti-

cola, is the most economically important fungal disease of grapes (Vitis spp.). This devastating disease causes partial or total crop losses and has a severe secondary environmental impact due to the repeated fungicide applications required as a control measure. To achieve sustainable grapevine pro-duction, the isolation and incorporation of genes into grape-vine that confer resistance to downy mildew would be of considerable economic and environmental benefit.

Recently, genes that confer resistance (R) to different types of pathogens, including viruses, bacteria, fungi, and nematodes, have been cloned by map-based cloning and transposon tagging procedures (Dangl and Jones, 2001; McDowell and Woffenden, 2003; Martin et al., 2003; Mey-ers et al., 2005). Apart from Hm1 and Mlo (Johal and Briggs, 1992; Buschges et al., 1997), amino acid sequence compari-son analyses of cloned R genes revealed that they are highly structurally conserved, such as the previously reported

conserved domains, leucine zipper (LZ), protein nucleotide binding site (NBS), leucine rich repeat (LRR), transmem-brane (TM), and serine/threonine protein kinases (PKs) (Hammond-Kosack and Jones, 1997; Dangl and Jones, 2001). Of these cloned R genes, the largest group consists of the NBS-LRR family, which is characterized by the presence of an N-terminal coiled-coil (CC) or Toll-interleukin receptor type (TIR) domain, a nucleotide binding site (NBS) domain, and an extended domain of leucine-rich repeats (LRR) (Bent and Mackey, 2007; McDowell and Simon, 2008).

The products of R genes act as immune receptors that directly or indirectly sense the presence of a pathogen and trigger strong defense responses, which frequently result in cell death (Jones and Dangl, 2006) and completely stop further pathogen growth. R gene-mediated resistance op-erates through a few conserved signaling pathways and or-chestrates a coordinated activation of defense genes. Within each species, diverse R genes may require distinct signaling pathways and recruit particular subclasses of pathogenesis related (PR) genes (Hammond-Kosack and Jones, 1996).

SummaryDowny mildew in cultivated grapevines (Vitis

spp.), caused by Plasmopara viticola, is a devastating disease that results in considerable economic losses as well as environmental damage due to the re-peated application of fungicides. The molecular role of the NBS-LRR family is highly related to plant im-mune-activity against various pathogens and pests. In this study, the 5′ and 3′ ends of the resistance gene homology fragment, designated as RGA23, were obtained by rapid amplification of cDNA ends PCR (RACE-PCR), and a 2,789 bp full-length cDNA was obtained using the gene-specific primers based on the spliced sequence. The deduced 892 amino acid sequence of this cDNA contains a characteris-tic NBS-LRR domain of plant resistance genes and a coiled-coil (CC) region. We analyzed the expres-sion of RGA23 under P. viticola infection and abi-otic stress at different time points using real-time quantitative polymerase chain reaction (RT-qPCR). The results showed that P. viticola treatment and four tested abiotic stimuli, including SA, MeJA, ABA, and H2O2, triggered significant inductions of RGA23 within 12 d of inoculation. The results indicate that RGA23 may play a critical role in protecting grape-vines against P. viticola through a signaling pathway triggered by P. viticola and these molecules.

Keywordscoiled-coil region, NBS-LRR, RACE-PCR, RT-qPCR, signaling pathway, Vitis spp.

Significance of this studyWhat is already known on this subject?• To identify grapevine RGAs that are potentially in-

volved in host defense against Plasmopara viticola infection, we previously characterized RGAs of the NBS-LRR family and studied their transcript expres-sion. We then selected the Vitis RGA gene RGA23 for further analysis.

What are the new findings?• In this study, the resistance gene homology fragment,

designated as RGA23, were obtained by RACE-PCR. We analyzed the expression of RGA23 under P. viticola infection and abiotic stress at different time points using RT-qPCR. The results showed that P. viticola treatment and four tested abiotic stimuli, including SA, MeJA, ABA, and H2O2, triggered significant inductions of RGA23 within 12 d of inoculation.

What is the expected impact on horticulture?• Downy mildew, caused by the oomycete Plasmopara

viticola, is the most economically important fungal disease of grapes (Vitis spp.). To achieve sustainable grapevine production, the isolation and incorpora-tion of genes into grapevine that confer resistance to downy mildew would be of considerable economic and environmental benefit. The results indicate that RGA23 may play a critical role in protecting grape-vines against P. viticola through a signaling pathway triggered by P. viticola and these molecules.

eJHS Magazine Vol 80-6.indd 216 12-10-15 15:19

V o l u m e 8 0 | I s s u e 5 | O c t 0 b e r 2 0 1 5 217

Three main phytohormones, salicylic acid (SA), jasmonic acid (JA), and ethylene (ET), have been classically recognized as essential components of responses triggered by patho-gens. The SA-dependent signaling pathways usually converge to execute a cell death-like hypersensitive response (HR) and synthesize PR-1 proteins, which effectively halt biotrophs such as P. viticola (Feys et al., 2001; McDowell et al., 2000; Shirasu and Schulze-Lefert, 2003). The JA/ET defense path-ways are more commonly associated with resistance to ne-crotrophs and response to wounding, general elicitors, and non-host pathogens (Zimmerli et al., 2004). However, this is not necessarily true for grapevine, as methyl-jasmonate (MeJA) levels in grapevine increase in response to P. viticola, and the application of exogenous MeJA to the leaf lamina alone can trigger cysteine protease-associated cell death (Polesani et al., 2010). In fact, the persistence of defense re-sponses and the disease outcome are determined by complex networks of interactions between multiple hormone signal-ing pathways (Santner and Estelle, 2009). SA- and JA/ET-mediated signaling pathways are more tightly connected than initially thought and are not necessarily antagonistic (Mur et al., 2006).

Recent studies have indicated that other hormones such as abscisic acid (ABA) are also involved in plant defense sig-naling pathways. In addition, H2O2 has been confirmed as a second messenger in activating defense-gene expression (Orozco-Cardenas et al., 2001), and H2O2 production is one of the earliest plant responses in incompatible interactions between pathogens and plants (Zhu-Salzman et al., 2004).

The completion of Vitis vinifera genome sequencing in a highly homozygous genotype and in a heterozygous grape-vine variety has led to the identification of putative resis-tance genes and defense signaling elements (Jaillon et al., 2007; Casagrande et al., 2011). With the introduction of deep sequencing, a complex gene family encoding NBS-LRR proteins has been isolated and characterized in grapevine (Kortekamp et al., 2008; Hvarleva et al., 2009; Seehalak et al., 2011). However, functional characterization of Vitis RGAs remains unclear.

To identify grapevine RGAs that are potentially involved in host defense against P. viticola infection, we previously characterized RGAs of the NBS-LRR family and studied their transcript expression (Wang et al., 2013). We then selected the Vitis RGA gene RGA23 for further analysis. The objective of this study was to isolate the flanking sequence of RGA23 with specific primers designed based on known sequences

Liang et al. | Gene associated with downy mildew resistance in grapevine

using rapid amplification of cDNA ends PCR (RACE-PCR). The transcriptional expressions of RGA23 (associated with downy mildew resistance) in grapevine after infection with P. viticola and treatment with molecules including SA, MeJA, ABA, and H2O2 were further investigated by RT-qPCR.

Materials and methods

Plant materials, pathogen infection, and hormone treatments

Two different Vitis species, the resistant Vitis riparia × (labrusca × vinifera) ‘Beta’ and the susceptible Vitis vinifera ‘Thompson Seedless’, were used in this study. One-year-old grap evines obtained from a commercial nursery were grown in a greenhouse at 20–30°C and 70–85% relative humidity.

The P . viticola isolate used in this work, which was collected from a Kyoho grapevine at the experimental re-search station of the Liaoning Academy of Agricultural Sci-ences (China), was isolated from a single infect ed leaf. A de-tached leaf with “oil spots” was thoroughly washed under running tap water to remove the sporangia, and incubated in a humid chamber at room temperature overnight for sporulation. The following day, freshly formed sporangia were collected with a brush, inoculated, and maintained on the same cultivar under greenhouse conditions until spo-rulation.

For pathogen infection and hormone treatment, one-year-old grapevines were treated with P. viticola and sig-naling molecules including SA (2 mM), MeJA (100 μM), or ABA (100 μM) in sterile water. For the H2O2 treatment, the seedlings were sprayed with H2O2 (10 μM) in sterile water. Control plants were sprayed with sterile water o nly. To initiate P. viticola infection, the third and fourth grapevine leaves were sprayed with a suspension of 10,000 sporangia per milliliter. The leaves were covered for one night with plastic bags to increase the humidity level, and the plants were maintained in the same greenhouse at 23°C under a 16: 8 h (light: dark) photoperiod.

RNA extraction and cDNA synthesisTotal RNA was extracted from grapevine leaves using

an improved Trizol method (Que et al., 2008) and treated with DNase I to remove any genomic DNA contamination. Then, the DNase-treated RNA was reverse transcribed (RT) using the SuperScript First-Strand Synthesis System RT-PCR Kit (Invitrogen, France). RT-PCR without reverse transcriptase enzyme was performed during cDNA synthe-sis for each mRNA sample to determine whether the sample contained genomic DNA contamination.

RACE-PCRThe 3′- and 5′-ends of RGA23 were elucidated by RACE-

PCR using a SMART™ RACE cDNA amplification kit (Clon-tech , USA) according to the manufacturer’s instructions.

Oligonucleotide primers, which were designed based on the sequence of RGA23 (Wang et al., 2013) (Table 1) , and the adaptor included in the kit were used for amplification and sequencing. Forward primers RGA23F1 and RGA23F2 were used as gene-specific primers in the 3′-RACE-PCR. Primer pair RGA23F1 + adaptor was used to produce the first amplicons, followed by semi-nested PCR with the primer pair RGA23F2 + adaptor. Reverse primers RGA23R1 and RGA23R2 were used as gene-specific primers in the 5′-RACE-PCR. Primer pair RGA23R1 + adaptor was used

Table 1 . Sequence of primers used for RACE and full-length sequence.

Primer name 5′ → 3′ sequence Sequence length (bp)

F1 TCCCACCTTGGTCTCAAACAT 21F2 GTGTCTGCTCCCACCTT 21R1 GATCGACAATGACCTCCTCAA 17R2 AGTTCAGCGAGTTCTTTT 18RGA23F1 GGCTGGCCTGGACAGAAT 18RGA23F2 CCCAAATCACTGCTTCAA 18RGA23R1 CGATATGGAAGTTACAGAG 19RGA23R2 AGCCTTTATGTGAATTGTCTCC 22RGA23FullF GTTTACATCCGTCACCTC 18RGA23FullR ACAACCTAATTGCACCC 17




to produce the first amplicons, followed by semi-nested PCR with the primer pair RGA23R2 + adaptor. Specific full-length primers were designed based on the split full-length sequence of the open reading frame (Table 1). All oligonucleotide primers were designed using Primer 3.0 soft-ware (http://primer3.ut.ee/).

Cloning and sequence analysisPCR products were resolved on a 1.5% agarose gel

stained with ethidium bromide. The target bands were excised and purified using a QIAquick Gel Extraction Kit (Qiagen, Valencia, CA, USA), cloned into pGEM-T Easy vec-tor (Promega, Madison, USA) individually and transformed into the Escherichia coli DH5α host strain. Positive clones identified by PCR and enzyme digestion were sequenced (Sangon Biotech, Shanghai, China).

Full-length cDNAs were assembled and Blasted (BLASTx) against all nucleotide sequences in the NCBI database to localize all sequences in the contig showing similarity to characterized sequences. The genomic DNA sequence of the RGA23 clones was scanned for putative pro-tein coding regions by searching the Genoscope database of grapevine genome sequences. ORF predictions were then performed with FGENESH 2.6 software (Salamov and Solovyev, 2000) and GENSCAN (Burge and Karlin, 1997). The obtained ORF sequences were Blasted (BLASTX) against sequences in the NCBI database and analyzed using the conserved domain tools of NCBI. Pairwise comparisons and multiple alignments of nucleotide and deduced amino acid sequences were performed using ClustalX software (Thompson et al., 1997).

Design of specific primers for expression analysisAccording to the RGA nucleotide sequences, gene-spe-

cific primer pairs were designed using Primer 3.0 software. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH; XM_002263109) was validated and used as a reference gene for data normalization (Reid et al., 2006; Selim et al., 2012) (Table 2).

Real-time quantitative PCR and data analysisFor RT-qPCR, reactions were carried out in 96-well

plates in a Bio-Rad CFX96 Real-Time PCR System with Bio-Rad CFX96 Manager Software (Bio-Rad, USA) using a SYBR Green-based PCR assay. Each reaction mix contained 5 μl diluted cDNAs, 10 μl of 2×SYBR Green PCR MasterMix (TaKaRa, China), and 0.25 μM of each primer to a final volume of 20 μl. The reactions were performed under the following conditions: 95°C for 3 min, followed by 40 cycles of 95°C for 15 s, 60°C for 30 s, and 72°C for 15 s. The melt-ing curves were analyzed at 55–95°C after 40 cycles. The grape GAPDH gene was used to normalize the samples. In addition, a reverse transcription negative control was in-cluded to check for potential genomic DNA contamination. Each RT-qPCR analysis was performed in triplicate and the mean was used for RT-qPCR analysis. The relative expres-

sion of R gene was calculated according to the 2-ΔΔCt method (Livak and Schmittgen, 2001). The threshold cycle (CT) val-ues for both the target and internal control genes were the means of triplicate independent PCRs. Data were analyzed using Bio-Rad CFX96 Manager Software and Microsoft Ex-cel 2007.

Results

RACE-PCR productDegenerate oligonucleotides were utilized to clone the

full-length cDNA of RGA23 in grapevine. PCR with the primer pairs F1 + R1 using genomic DNA led to amplicons approxi-mately 350 bp in length. The PCR product was identified by direct sequencing using the primer pair F2 + R2. The 3′- and 5′-termini were elucidated by RACE-PCR using RNA from in-fected leaves as a template for full-length cDNA synthesis.

Sequence comparison of the two RACE-PCR amplicons with the internal amplicon showed 100% identity in the overlapping regions. In addition, the 3′-RACE-PCR amplicon contained a poly-A motif at the 3′-terminus. Alignment of the three amplicons revealed an ORF of 2,789 bp (Figure 1).

Structure and characterization of the full-length sequence of RGA23

Sequence comparison of the full-length cDNA with data from the grapevine genome sequencing project indicated that the transcribed portion of RGA23 is 4,295 bp in length, including a 1.2 kb region containing the promoter sequence upstream of the ATG start codon, a 412 bp 3′-untranslated region (UTR), and a 2,679 bp coding sequence (CDS). The 2,679 bp CDS encodes a protein of 892 amino acids. The predicted RGA23 protein shows all of the characteristic domains of NBS-LRR protein (Figure 2). The conserved NBS motifs (P-loop, Kinase-2, Kinase-3, GLPL, and LHD) are highly similar to those of other NBS-LRR-resistance proteins (Traut, 1994; Grant et al., 1995). A coiled-coil (CC) region is located between residues 8 and 97, indicating that RGA23 belongs to the CC subfamily of NBS-LRR resistance proteins. The LRR domain consists of 13 repeats, which complies well with the consensus motif LxxLxLxx (Kobe and Deisenhofer, 1994).

Expression patterns of RGA23 during compatible and incompatible interactions with P. viticola

To understand the nature of RGA23 transcripts, we ex-amined the induction of RGA23 expression in response to P. viticola infection using RT-qPCR. Grapevine and related species exhibit a wide spectrum of resistance to the bio-trophic pathogen P. viticola, the downy mildew agent. Two different Vitis species, the resistant Vitis riparia × (labrusca × vinifera) ‘Beta’ and the susceptible Vitis vinifera ‘Thomp-son Seedless’, were challenged with P. viticola or water as a control. The expression levels are relative to no inoculation (0 d) in ‘Beta’ after normalization of the RT-qPCR outputs with the grape GAPDH gene output.

Table 2. Sequence of primers used for RT-qPCR in grapevine.

Gene Forward primer (5′ to 3′)

Reverse primer (5′ to 3′)

Amplicon length (bp)

Tm (°C)

Accession numbers

RGA23GAPDH

ATATCTATCCACCTTACAAGTATCAAGGAGGAGTCAGAG

ATACGCTCACAACCTAAT GTTGTCACCGATGAAGTC

101238

6160

KC176794XM_002263109




Figure 1. Scheme of PCR experiments. The alignment shows the three amplicons, which led to the ORF and untranslated re-gions (UTRs) of the RGA23 protein. The internal amplicon was revealed with the primer pairs F1 + R1 and F2 + R2 (nested PCR). The 3′-RACE-PCR amplicon was revealed with the gene-specific primers RGA23F1 and RGA23F2 (semi-nested PCR). The 5′-RACE-PCR amplicon was revealed with the gene-specific primers RGA23R1 and RGA23R2 (semi-nested PCR). In all RACE experiments, the adaptor primer provided in the SMART™ RACE cDNA amplification kit was used.

Figure 2. Predicted amino acid sequence from the full-length transcript of RGA23. The amino acid sequence is divided into three domains: A, coiled-coil (CC) conserved domain with corresponding amino acids at the N-terminus (underlined); B, nucleotide binding site (NBS), P-loop, GGIGKTT; kinase-2, LLVMDDMW; kinase-3a, GCMVLATTR; HD, GLPLAL (boxed); C, leucine-rich repeat (LRR), LxxLxxLxL (shaded).




Figure 3. Expression patterns of RGA23 mRNA in response to P. viticola infection for 0, 2, 4, 6, 8, 10, and 12 d in ‘Beta’ and ‘Thompson Seedless’. The expression levels are relative to no inoculation (0 d) in ‘Beta’ after normalization of the RT-qPCR outputs with the grape GAPDH gene output. The data are shown as values and standard errors (bars) of three independent RT-qPCR experiments.

Figure 4. Expression patterns of RGA23 in seedlings via RT-qPCR in response to exogenous application of hormones and H2O2. Seedlings were treated with (A) SA, (B) MeJA, (C) ABA, and (D) H2O2. The expression levels are relative to no inocula-tion (0 d) in ‘Beta’ after normalization of the RT-qPCR outputs with the grape GAPDH gene output. The data are shown as mean values and standard errors (bars) of three independent RT-qPCR experiments.

13

Fig.3

Figure 3.ExpressionpatternsofRGA23mRNAinresponseto P.viticolainfectionfor0,2,4,6,8,10,and12din‘Beta’and‘ThompsonSeedless’.Theexpressionlevelsarerelativetonoinoculation(0d)in‘Beta’afternormaliza-tionoftheRT-qPCRoutputswiththegrapeGAPDHgeneoutput.Thedataareshownasvaluesandstandarderrors(bars)ofthreeindependentRT-qPCRexperiments.

0123456

0d 2d 4d 6d 8d 10d 12d

Relativequ

antitiesof

RGA2

3mR

NA

Time(d)post-treatmentwithP.viticolaBeta ThompsonSeedless

0123456789

0 d 2 d 4 d 6 d 8 d 10 d 12 d

Relat

ive qu

antit

ies of

RGA2

3mR

NA

Time (d) post-treatment with SA Beta Thompson Seedless

Fig. 4

Figure 4. Expression patterns of RGA23 in seedlings via RT-qPCR in response to exogenous application of hormones and H2O2. Seedlings were treated with (A) SA, (B) MeJA, (C) ABA, and (D) H2O2. The expression levels are relative to no inoculation (0 d) in ‘Beta’ after normalization of the RT-qPCR outputs with the grape GAPDH gene output. The data are shown as mean values and standard errors (bars) of three independent RT-qPCR experiments.

0102030405060

Relat

ive q

uanti

ties o

f RGA

23

mRNA

0 d 2 d 4 d 6 d 8 d 10 d 12 d Time (d) post-treatment with MeJABeta Thompson Seedless

(A) (B)

05

101520253035404550

0 d 2 d 4 d 6 d 8 d 10 d 12 d

Relat

ive qu

antit

ies of

RGA2

3 mR

NA

Time (d) post-treatment with ABA Beta Thompson Seedless

(C)

01234567

0 d 2 d 4 d 6 d 8 d 10 d 12 d

Relat

ive qu

antit

ies of

RGA2

3 mR

NA

Time (d) post-treatment with H2O2

Beta Thompson Seedless

(D)




Twelve days after inoculation with P. viticola, a num-ber of “oil spots” were observed on leaves of the resistant species V. riparia × (labrusca × vinifera), whereas sporan-gia covered almost the entire leaf surface of the suscepti-ble V. vinifera (data not shown). Transcript accumulation of RGA23 was then quantified after P. viticola infection. Fol-lowing infection by P. viticola, the transcription of RGA23 in ‘Beta’ was 1.6-fold higher than that of the water control at 2 d after inoculation. The expression further increased to 3.6-fold at 6 d and peaked at 8 d (4.9-fold). Then, the level of RGA23 expression decreased to 3.7-fold at 10 d and to 1.8-fold at 12 d (Figure 3). However, the transcription of RGA23 in the susceptible ‘Thompson Seedless’ was 1.1-fold higher at 2 d, peaked at 4 d (2.6-fold) and decreased to 1.9-fold at 6 d. The observed differences suggest that RGA23 may be involved in the defense response against P. viticola.

Induction of RGA23 expression in response to defense signaling molecules

To evaluate whether expression of RGA23 is induced by the combination of P. viticola infection and various poten-tial resistance-inducing chemicals, we examined the lev-els of RGA23 transcript in ‘Beta’ and ‘Thompson Seedless’ leaves following exogenous application of SA, MeJA, ABA, and H2O2 using RT-qPCR analysis.

Following SA treatment, transcription of RGA23 in ‘Beta’ reached 3.2-fold at 2 d after treatment, increased to 6.6-fold at 8 d and peaked (7.7-fold) at 10 d. Subsequently, the expression level of this gene decreased but was still 4.9-fold at 12 d post-treatment, which was considerably higher than the background level. In ‘Thompson Seedless’, the value was 2.4-fold higher at 2 d, increased significantly to 4.2-fold at 6 d and decreased to 3.6-fold at 8 d (Figure 4A).

Exposure to MeJA caused RGA23 transcription to in-crease rapidly, with expression levels increasing to 31.3-fold at 2 d and peaking (54.5-fold) at 8 d in ‘Beta’. However, RGA23 transcription decreased clearly after 10 d 40.1-fold and falling to 22.9-fold at 12 d. Similarly, the expression of RGA23 in ‘Thompson Seedless’ showed a similar “up-down” pattern, although the highest value was only 36.7-fold at 4 d (Figure 4B).

Strong induction of RGA23 was detected after treat-ment with ABA. The expression level of RGA23 in ‘Beta’ in-creased 18.1-fold at 2 d, peaked at 8 d (43.6-fold), and then decreased to 31.1-fold at 10 d. The transcription of RGA23 in ‘Thompson Seedless’ was 10.8-fold at 2 d, peaked at 4 d (34.8-fold) and decreased to 22.7-fold at 6 d (Figure 4C).

In response to H2O2 treatment, the expression of RGA23 in ‘Beta’ peaked at a level of 6.3-fold higher at 4 d than that at 0 d. The expression of this gene decreased steadily thereafter. In ‘Thompson Seedless’, the value significantly increased to a level 3.6-fold at 2 d and decreased to 2.1-fold at 4 d (Figure 4D).

Taken together, these data show that RGA23 was strongly induced by exogenous application of SA, MeJA, ABA, H2O2, and observed P. viticola infection, suggesting that RGA23 may be involved in defense responses via a sig-naling pathway activated by these molecules.

DiscussionMost resistance genes that have been cloned over the

past two decades belong to the NBS-LRR family, and pro-teins with NBS and LRR domains are associated exclusively with plant disease resistance (Lukasik and Takken, 2009).

The domain architecture of NBS-LRR is consistent with its role in pathogen recognition and defense response signal-ing (Ameline-Torregrosa et al., 2008). NBS-encoding genes are widely distributed in diverse plant genomes. For in-stance, approximately 341 NBS genes (84 CC-NBS-LRR and 37 TIR-NBS-LRR genes) have been identified in the grape genome (Velasco et al., 2007).

Using homology cloning technology, we previously ob-tained a number of incomplete homologous sequences of disease resistance genes (Wang et al., 2013). Two meth-ods can be used to obtain full-length gene sequences. One method is to screen a gene library and the other is to use RACE-PCR. RACE-PCR is the most simple and effective technique for amplifying the 5′ and 3′ ends of the target fragment from low abundance transcripts, and it is used widely to elongate or clone target fragments to obtain the full-length gene or to find additional genes.

In this study, the full-length sequence of RGA23 was obtained, and the NB-ARC domains including the P-loop, Kinase 2, Kinase 3, GLPLAL, and LHD conserved motifs were found using the conserved domain tools from NCBI. The two major NBS-LRR subfamilies can be distinguished by the presence or absence of an amino-terminal Toll/in-terleukin-1 receptor-like domain (Meyers et al., 1999). There are many genes in the non-TIR subgroup of NBS-LRR genes, most of which carry a CC structure or a leucine zip-per (Bai et al., 2002). The RGA23 gene encodes a CC struc-ture located between amino acids 8 and 97 similar to that of the CC-NBS-LRR family. The LRR domain consists of 13 repeats, which complies well with the consensus motif Lxx-LxLxx. These sequences were found within the N-terminus of RGA23 (Figure 2). Based on this structural conservation, we deduced that RGA23 belongs to the CC-NBS-LRR class of resistance-related genes.

Most plant resistance genes are transcriptionally regu-lated in response to pathogen attacks. In the present study, we investigated the expression patterns of RGA23 to gain insight into its involvement in the plant defense response (Figure 3). The expression level of RGA23 in the resistant V. riparia × (labrusca × vinifera) ‘Beta’ infected with P. viti-cola are higher than that of susceptible V. vinifera ‘Thomp-son Seedless’ in the same periods, excepting the level of ‘Thompson Seedless’ reached 2.6-fold in the fourth day. Moreover the peak of expression level of RGA23 in ‘Beta’ is twice as that of ‘Thompson Seedless’ , which suggest that a correlation exists between activating this gene and resis-tance to P. viticola. Thus, RGA23 may be involved in P. vitico-la-induced defense responses. Similar expression patterns have been observed for Pib and Hs1pro-1, a blast resistance gene in rice (Wang et al., 1999, 2001), and for a downy mil-dew resistanc e gene in Cucumis (Wan et al., 2010).

Previous studies have demonstrated that signaling mol-ecules not only function as critical signals for downstream resistance events, but they also up-regulate the expression of R genes. For example, in Arabidopsis, SA treatment in-duces the expression of SSI4, encoding a putative protein belonging to the TIR-NBS-LRR class of R proteins, as well as the closely related TIR-NBS-LRR genes RPP1 and RPS4 (Shirano et al., 2002). In grapevine, of the VvMLO genes tested, VvMLO4, VvMLO6, and VvMLO10 displayed the most marked responses to SA treatment (Feechan et al., 2008). Several studies also report that SA and MeJA act antagonis-tically in defense reactions (Cipollini et al., 2004; Mur et al., 2006). However, more recent studies indicate that they act




synergistically (Bari and Jones, 2008).In this study, the P. viticola-inducible RGA23 gene was

activated not only by SA but also by other defense-signaling molecules (MeJA, ABA, and H2O2; Figures 4A–D), suggest-ing that these stimuli induce the expression of RGA23 and that RGA23 may play a role in mediating crosstalk between defense-signaling pathways. Expression of RGA23 was in-duced by SA and MeJA, suggesting that the two stimuli have synergistic roles in mediating defense responses in ‘Beta’ and ‘Thompson Seedless’. However, the induced RGA23 gene transcript patterns were distinct. In ‘Beta’, the SA-in-duced RGA23 transcript levels peaked at 10 d and increased 7.7-fold over the level observed at 0 d, whereas the MeJA-in-duced transcript levels peaked (54.5-fold increase over 0 d) at 8 d, suggesting that RGA23 may be mainly involved in the defense responses through the signaling pathway activated by these two molecules at different time points.

VvMLO8 and VvMLO10 in grapevine showed over 50-fold higher transcript levels upon H2O2 treatment (Feechan et al., 2008). However, some researchers have also expressed opposite views. For example, expression of Ha-NTIR11g, an RGA related to downy mildew infection in sunflower (Rad-wan et al., 2004) was not induced by exogenous signaling molecules (i.e., ABA, H2O2). In our study, the expression level of RGA23 in ‘Beta’ was much higher than that observed in ‘Thompson Seedless’ with ABA and H2O2 treatments ex-cept the early periods (4 d in ABA treatment and 2 d in H2O2

treatment).Taken together, these results suggest that RGA23 is ac-

tivated in both the resistant V. riparia × (labrusca × vinifera) ‘Beta’ and the susceptible V. vinifera ‘Thompson Seedless’ during infection by P. viticola, and that this gene is induced by signal transduction pathways mediated by SA, MeJA, ABA, and H2O2. Given the prominent role of RGA23 proteins in grape defense responses, further examination of their function may be necessary.

AcknowledgmentsThis work was supported by Special Fund for Agro-

Scientific Research in the Public Interest of the People’s Republic of China (No. 201203035) and Innovation Team for Grape Breeding and Comprehensive Supporting Tech-nology (No. 2014204004). We appreciate the constructive suggestions from Dr. Mark I. McDermott (Texas A&M, USA) during the preparation of this manuscript.

ReferencesAmeline-Torregrosa, C., Wang, B.B., O’Bleness, M.S., Deshpande, S., Zhu, H., Roe, B., Young, N.D., and Cannon, S.B. (2008). Identification and characterization of nucleotide-binding site-leucine-rich repeat genes in the model plant Medicago truncatula. Plant Physiol. 146, 5–21. http://dx.doi.org/10.1104/pp.107.104588.

Bai, J., Pennill, L.A., Ning, J., Lee, S.W., Ramalingam, J., Webb, C.A., Zhao, B., Sun, Q., Nelson, J.C., Leach, J.E., and Hulbert, S.H. (2002). Diversity in nucleotide binding site-leucine-rich repeat genes in cereals. Genome Res. 12, 1871–1884. http://dx.doi.org/10.1101/gr.454902.

Bari, R., and Jones, J.D.G. (2008). Role of plant hormones in plant defence responses. Plant Mol. Biol. 69, 473–488. http://dx.doi.org/10.1007/s11103-008-9435-0.

Bent, A.F., and Mackey, D. (2007). Elicitors, effectors, and R genes: the new paradigm and a lifetime supply of questions. Annu. Rev. Phytopathol. 45, 399–436. http://dx.doi.org/10.1146/annurev.phyto.45.062806.094427.

Burge, C., and Karlin, S. (1997). Prediction of complete gene structures in human genomic DNA. J. Mol. Biol. 268, 78–94. http://dx.doi.org/10.1006/jmbi.1997.0951.

Buschges, R., Hollricher, K., Panstruga, R., Simons, G., Wolter, M., Frijters, A., Van Daelen, R., Van der Lee, T., Diergaarde, P., Groenendijk, J., Topsch, S., Vos, P., Salamini, F., and Schulze-Lefert, P. (1997). The barley Mlo gene: a novel control element of plant pathogen resistance. Cell 88, 695–705. http://dx.doi.org/10.1016/S0092-8674(00)81912-1.

Casagrande, K., Falginella, L., Castellarin, S.D., Testolin, R., and Di Gaspero, G. (2011). Defence responses in Rpv3-dependent resistance to grapevine downy mildew. Planta 234, 1097–1109. http://dx.doi.org/10.1007/s00425-011-1461-5.

Cipollini, D., Enright, S., Traw, M.B., and Bergelson, J. (2004). Salicylic acid inhibits jasmonic acid-induced resistance of Arabidopsis thaliana to Spodoptera exigua. Mol. Ecol. 13, 1643–1653. http://dx.doi.org/10.1111/j.1365-294X.2004.02161.x.

Dangl, J.L., and Jones, J.D. (2001). Plant pathogens and integrated defence responses to infection. Nature 411, 826–833. http://dx.doi.org/10.1038/35081161.

Feechan, A., Jermakow, A.M., Torregrosa, L., Panstruga, R., and Dry, I.B. (2008). Identification of grapevine MLO gene candidates involved in susceptibility to powdery mildew. Func. Plant Biol. 35, 1255–1266. http://dx.doi.org/10.1071/FP08173.

Feys, B.J., Moisan, L.J., Newman, M.A., and Parker, J.E. (2001). Direct interaction between the Arabidopsis disease resistance signaling proteins, EDS1 and PAD4. Embo. J. 20, 5400–5411. http://dx.doi.org/10.1093/emboj/20.19.5400.

Grant, M.R., Godiard, L., Straube, E., Ashfield, T., Lewald, J., Sattler, A., Innes, R.W., and Dangl, J.L. (1995). Structure of the Arabidopsis RPM1 gene enabling dual specificity disease resistance. Science 269, 843–846. http://dx.doi.org/10.1126/science.7638602.

Hammond-Kosack, K.E., and Jones, J.D. (1996). Resistance gene-dependent plant defense responses. Plant Cell 8, 1773–1791. http://dx.doi.org/10.1105/tpc.8.10.1773.

Hammond-Kosack, K.E., and Jones, J.D. (1997). Plant Disease Resistance Genes. Annu. Rev. Plant Physiol. Plant Mol. Biol. 48, 575–607. http://dx.doi.org/10.1146/annurev.arplant.48.1.575.

Hvarleva, T.Z., Bakalova, A., Rusanov, K., Diakova, G., Llieva, I., Atanassov, A., and Atanassov, I. (2009). Toward marker assisted selection for fungal disease resistance in grapevine. Biotechnol. Biotec. Eq. 23, 1431–1435. http://dx.doi.org/10.2478/V10133-009-0008-4.

Jaillon, O., Aury, J.M., Noel, B., Policriti, A., Clepet, C., Casagrande, A., Choisne, N., Aubourg, S., Vitulo, N., Jubin, C., Vezzi, A., Legeai, F., Hugueney, P., Dasilva, C., Horner, D., Mica, E., Jublot, D., Poulain, J., Bruyere, C., Billault, A., Segurens, B., Gouyvenoux, M., Ugarte, E., Cattonaro, F., Anthouard, V., Vico, V., Del Fabbro, C., Alaux, M., Di Gaspero, G., Dumas, V., Felice, N., Paillard, S., Juman, I., Moroldo, M., Scalabrin, S., Canaguier, A., Le Clainche, I., Malacrida, G., Durand, E., Pesole, G., Laucou, V., Chatelet, P., Merdinoglu, D., Delledonne, M., Pezzotti, M., Lecharny, A., Scarpelli, C., Artiguenave, F., Pe, M.E., Valle, G., Morgante, M., Caboche, M., Adam-Blondon, A.F., Weissenbach, J., Quetier, F., and Wincker, P. (2007). French-Italian Public Consortium for Grapevine Genome. The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla. Nature 449, 463–467. http://dx.doi.org/10.1038/nature06148.

Johal, G.S., and Briggs, S.P. (1992). Reductase activity encoded by the HM1 disease resistance gene in maize. Science 258, 985–987. http://dx.doi.org/10.1126/science.1359642.

Jones, J.D., and Dangl, J.L. (2006). The plant immune system. Nature 444, 323–329. http://dx.doi.org/10.1038/nature05286.




Kobe, B., and Deisenhofer, J. (1994). The leucine-rich repeat: a versatile binding motif. Trends Biochem. Sci. 19, 415–421. http://dx.doi.org/10.1016/0968-0004(94)90090-6.

Kortekamp, A., Welter, L., Vogt, S., Knoll, A., Schwander, F., Töpfer, R., and Zyprian, E. (2008). Identification, isolation and characterization of a CC-NBS-LRR candidate disease resistance gene family in grapevine. Mol. Breeding 22, 421–432. http://dx.doi.org/10.1007/s11032-008-9186-2.

Livak, K.J., and Schmittgen, T.D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408. http://dx.doi.org/10.1006/meth.2001.1262.

Lukasik, E., and Takken, F.L. (2009). STANDing strong, resistance proteins instigators of plant defence. Curr. Opin. Plant Biol. 12, 427–436. http://dx.doi.org/10.1016/j.pbi.2009.03.001.

Martin, G.B., Bogdanove, A.J., and Sessa, G. (2003). Understanding the functions of plant disease resistance proteins. Annu. Rev. Plant Biol. 54, 23–61. http://dx.doi.org/10.1146/annurev.arplant.54.031902.135035.

McDowell, J.M., Cuzick, A., Can, C., Beynon, J., Dangl, J.L., and Holub, E.B. (2000). Downy mildew (Peronospora parasitica) resistance genes in Arabidopsis vary in functional requirements for NDR1, EDS1, NPR1 and salicylic acid accumulation. Plant J. 22, 523–529. http://dx.doi.org/10.1046/j.1365-313x.2000.00771.x.

McDowell, J.M., and Woffenden, B.J. (2003). Plant disease resistance genes: recent insights and potential applications. Trends Biotechnol. 21, 178–183. http://dx.doi.org/10.1016/S0167-7799(03)00053-2.

McDowell, J.M., and Simon, S.A. (2008). Molecular diversity at the plant-pathogen interface. Dev. Comp. Immunol. 32, 736–744. http://dx.doi.org/10.1016/j.dci.2007.11.005.

Meyers, B.C., Dickerman, A.W., Michelmore, R.W., Sivaramakrishnan, S., Sobral, B.W., and Young, N.D. (1999). Plant disease resistance genes encode members of an ancient and diverse protein family within the nucleotide-binding superfamily. Plant J. 20, 317–332. http://dx.doi.org/10.1046/j.1365-313X.1999.t01-1-00606.x.

Meyers, B.C., Kaushik, S., and Nandety, R.S. (2005). Evolving disease resistance genes. Curr. Opin. Plant Biol. 8, 129–134. http://dx.doi.org/10.1016/j.pbi.2005.01.002.

Mur, L.A., Kenton, P., Atzorn, R., Miersch, O., and Wasternack, C. (2006). The outcomes of concentration-specific interactions between salicylate and jasmonate signaling include synergy, antagonism, and oxidative stress leading to cell death. Plant Physiol. 140, 249–262. http://dx.doi.org/10.1104/pp.105.072348.

Orozco-Cardenas, M.L., Narvaez-Vasquez, J., and Ryan, C.A. (2001). Hydrogen peroxide acts as a second messenger for the induction of defense genes in tomato plants in response to wounding, systemin, and methyl jasmonate. Plant Cell 13, 179–191. http://dx.doi.org/10.1105/tpc.13.1.179.

Polesani, M., Bortesi, L., Ferrarini, A., Zamboni, A., Fasoli, M., Zadra, C., Lovato, A., Pezzotti, M., Delledonne, M., and Polverari, A. (2010). General and species-specific transcriptional responses to downy mildew infection in a susceptible (Vitis vinifera) and a resistant (V. riparia) grapevine species. BMC Genomics 11, 117. http://dx.doi.org/10.1186/1471-2164-11-117.

Que, Y.X., Li, W., Xu, J.S., Xu, L.P., Zhang, M.Q., and Chen, R.K. (2008). A simple and versatile protocol for isolation of RNA from plant, fungi and animal. J. Agr. Sci. Tech-Iran. 2, 63–65.

Radwan, O., Mouzeyar, S., Nicolas, P., and Bouzidi, M.F. (2004). Induction of a sunflower CC-NBS-LRR resistance gene analogue during incompatible interaction with Plasmopara halstedii. J. Exp. Bot. 56, 567–575. http://dx.doi.org/10.1093/jxb/eri030.

Reid, K.E., Olsson, N., Schlosser, J., Peng, F., and Lund, S.T. (2006). An optimized grapevine RNA isolation procedure and statistical determination of reference genes for real-time RT-PCR during berry development. BMC Plant Biol. 6, 27. http://dx.doi.org/10.1186/1471-2229-6-27.

Salamov, A.A., and Solovyev, V.V. (2000). Ab initio gene finding in Drosophila genomic DNA. Genome Res. 10, 516–522. http://dx.doi.org/10.1101/gr.10.4.516.

Santner, A., and Estelle, M. (2009). Recent advances and emerging trends in plant hormone signalling. Nature 459, 1071–1078. http://dx.doi.org/10.1038/nature08122.

Seehalak, W., Moonsom, S., Metheenukul, P., and Tantasawat, P. (2011). Isolation of resistance gene analogs from grapevine resistant and susceptible to downy mildew and anthracnose. Sci. Hort. Amsterdam 128, 357–363. http://dx.doi.org/10.1016/j.scienta.2011.01.003.

Selim, M., Legay, S., Berkelmann-Lohnertz, B., Langen, G., Kogel, K.H., and Evers, D. (2012). Identification of suitable reference genes for real-time RT-PCR normalization in the grapevine-downy mildew pathosystem. Plant Cell Rep. 31, 205–216. http://dx.doi.org/10.1007/s00299-011-1156-1.

Shirano, Y., Kachroo, P., Shah, J., and Klessig, D.F. (2002). A gain-of-function mutation in an Arabidopsis Toll Interleukin1 receptor-nucleotide binding site-leucine-rich repeat type R gene triggers defense responses and results in enhanced disease resistance. Plant Cell 14, 3149–3162. http://dx.doi.org/10.1105/tpc.005348.

Shirasu, K., and Schulze-Lefert, P. (2003). Complex formation, promiscuity and multi-functionality: protein interactions in disease-resistance pathways. Trends Plant Sci. 8, 252–258. http://dx.doi.org/10.1016/S1360-1385(03)00104-3.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., and Higgins, D.G. (1997). The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882. http://dx.doi.org/10.1093/nar/25.24.4876.

Traut, T.W. (1994). The functions and consensus motifs of nine types of peptide segments that form different types of nucleotide-binding sites. Eur. J. Biochem. 222, 9–19. http://dx.doi.org/10.1111/j.1432-1033.1994.tb18835.x.

Velasco, R., Zharkikh, A., Troggio, M., Cartwright, D.A., Cestaro, A., Pruss, D., Pindo, M., Fitzgerald, L.M., Vezzulli, S., Reid, J., Malacarne, G., Iliev, D., Coppola, G., Wardell, B., Micheletti, D., Macalma, T., Facci, M., Mitchell, J.T., Perazzolli, M., Eldredge, G., Gatto, P., Oyzerski, R., Moretto, M., Gutin, N., Stefanini, M., Chen, Y., Segala, C., Davenport, C., Dematte, L., Mraz, A., Battilana, J., Stormo, K., Costa, F., Tao, Q., Si-Ammour, A., Harkins, T., Lackey, A., Perbost, C., Taillon, B., Stella, A., Solovyev, V., Fawcett, J.A., Sterck, L., Vandepoele, K., Grando, S.M., Toppo, S., Moser, C., Lanchbury, J., Bogden, R., Skolnick, M., Sgaramella, V., Bhatnagar, S.K., Fontana, P., Gutin, A., Van de Peer, Y., Salamini, F., and Viola, R. (2007). A high quality draft consensus sequence of the genome of a heterozygous grapevine variety. PLoS One 2, e1326. http://dx.doi.org/10.1371/journal.pone.0001326.

Wan, H., Zhao, Z., Malik, A.A., Qian, C., and Chen, J. (2010). Identification and characterization of potential NBS-encoding resistance genes and induction kinetics of a putative candidate gene associated with downy mildew resistance in Cucumis. BMC Plant Biol. 10, 186. http://dx.doi.org/10.1186/1471-2229-10-186.

Wang, P., Liu, C.Y., Wang, D.X., Liang, C.H., Zhao, K.H., and Fan, J.J. (2013). Isolation of resistance gene analogs from grapevine resistant to downy mildew. Sci. Hort. Amsterdam 150, 326–333. http://dx.doi.org/10.1016/j.scienta.2012.11.035.

Wang, Z.X., Yamanouchi, U., Katayose, Y., Sasaki, T., and Yano, M. (2001). Expression of the Pib rice-blast-resistance gene family is up-




regulated by environmental conditions favouring infection and by chemical signals that trigger secondary plant defences. Plant Mol. Biol. 47, 653–661. http://dx.doi.org/10.1023/A:1012457113700.

Wang, Z.X., Yano, M., Yamanouchi, U., Iwamoto, M., Monna, L., Hayasaka, H., Katayose, Y., and Sasaki, T. (1999). The Pib gene for rice blast resistance belongs to the nucleotide binding and leucine-rich repeat class of plant disease resistance genes. Plant J. 19, 55–64. http://dx.doi.org/10.1046/j.1365-313X.1999.00498.x.

Zhu-Salzman, K., Salzman, R.A., Ahn, J.E., and Koiwa, H. (2004). Transcriptional regulation of sorghum defense determinants against a phloem-feeding aphid. Plant Physiol. 134, 420–431. http://dx.doi.org/10.1104/pp.103.028324.

Zimmerli, L., Stein, M., Lipka, V., Schulze-Lefert, P., and Somerville, S. (2004). Host and non-host pathogens elicit different jasmonate/ethylene responses in Arabidopsis. Plant J. 40, 633–646. http://dx.doi.org/10.1111/j.1365-313X.2004.02236.x.

Received: Aug. 28, 2014Accepted: Mar. 10, 2015

Addresses of authors: Chunhao Liang, Li Liu, Chaoqun Zang, Kuihua Zhao and Changyuan Liu*Institute of Plant Protection, Liaoning Academy of Agricul-tural Sciences, Shenyang 110161, ChinaTel.: +86-024-88425875, Fax: +86-024-88425875* Corresponding author; E-mail: [email protected]


characterization and induction kinetics of a putative candidate … · 2016. 10. 26. ·...

Documents