86

CHAPTER VI

ABSTRACT: Replicon typing of Plasmids harbouring ESBL gene.

The bacterial resistance to beta-lactam antibiotics is mediated by plasmids containing

ESBL genes which are horizontally transferred across species since we analyzed the

plasmids harboring the resistance genes by replicon typing. For this study we screened

twenty three isolates collected during the period 2009-2010 and screened by the

antimicrobial susceptibility test. It was found that all the isolates showed resistance to

cefoxitin, a second generation cephalosporin and twenty two isolates showed resistance to

amoxyclav. One of the isolate UT1644, was taken for further analysis. The amplicon for

blaCTX-M from this isolate was sequenced and found to be the blaCTX-M-15 allele. Two of the

isolates were resistant to imipenem, a carbapenem antibiotic. One of the carbapenem

resistant isolate P23 was further screened for the presence of metallo beta-lactamase.

Subsequently, it was found to contain a metallo-beta-lactamase but it did not harbor the

NDM-1 gene. Another isolate was found to be a metallo beta-lactamase as confirmed by

Imipenem –EDTA test. However, the carpabenem resistance was not transferrable into

E.coli JM109 indicating that it may be chromosomal. PCR were performed for the four

types of ESBL genes blaTEM, blaSHV, blaCTX-M, and blaOXA from the isolated plasmids.

Analysis of the ESBL genotype by specific PCR showed the presence of the blaSHV allele

(n = 15) followed by blaOXA (n = 7) and blaCTX-M (n = 7) in the isolates. One of the

amplified product of blaSHV was sequenced and it was found to be the blaSHV-5 allele.

Further, we analyzed the replicon pattern for the resistant isolates and found that plasmids

containing ESBL genes from Chennai predominantly belong to IncFIC and IncFIA

replicons.

87

CHAPTER VI: Results and Discussion – Replicon typing of Plasmids

harbouring ESBL genes.

6.1Antimicrobial Susceptibility profile of Klebsiella pneumoniae isolates

In order to identify the replicon associated with ESBL gene, we undertook an analyses of

23 Klebsiella pneumoniae isolates from Madras Medical College, Chennai. First,

antimicrobial susceptibility pattern of the clinical isolates of Klebsiella pneumoniae

collected from Chennai in Oct 2009 against seven commonly used antibiotics was analysed

and data was represented in figure 6.1. All the isolates were resistant to cephoxitin, a

second generation cephalosporin. Cephotaxime, a third generation cephalorsporin was

effective only on two isolates (8.6 %). Amoxyclav is an inhibitor of Class A beta

lactamases and is usually recommended for isolates carrying Class A ESBL genes.

Alternatively these isolates might contain the AmpC beta-lactamases. Many strains of K.

pneumoniae also harbor AmpC beta lactamases in the plasmids which confer resistance to

clavulanic acid. AmpC beta lactamases are active on cephalosporins and can hydrolyze

cephamycins such as cefoxitin and cefotetan; oxyimino-cephalosporins such as

ceftazidime, cefotaxime, and ceftriaxone; and monobactams such as aztreonam. Inhibitors

of class A enzymes such as clavulanic acid, sulbactam, and tazobactam have much less

effect on AmpC β-lactamases [Tan, T. Y et al 2009].

It is significant that 22 isolates showed resistance to clavulanic acid and only one isolate

was sensitive to clavulanic acid (95%). The most effective antibiotic was found to be

imipenem, a carbapenem antibiotic. In addition, in two carbapenem resistant isolates (9%)

were observed in this study. Intermediate resistance to imipenem was observed in three

isolates (13 %).

88

Since many of these antibiotic resistance genes are clustered, we analyzed the resistance to

other group of drugs. It was found that 12 isolates (52 %) were resistant to amikacin, an

aminoglycoside inhibitor and levofloxacin, a quinolone antibiotic. Intermediate resistance

was high for levofloxacin, with 9 isolates (39 %). Resistance to Trimethoprim a

sulphonamide antibiotic was high with 22 isolates resistant to the drug.

Figure 6.1 The Antimicrobial susceptibility of the 23 clinical isolates against 7

commonly used antibiotics is shown. The isolates were classified as Resistant,

Intermediate or Sensitive according to the CLSI Performance Standards for the

Antimicrobial Disk Susceptibility Tests, CLSI Vol 30, No. 1 , Jan 2010. The number on

top of each bar represents the number of isolates.

23

17

22

2

22

12 12

0

2

0

3

0

2

9

0

4

1

18

1

9

2

0

5

10

15

20

25

Resistant

Intermediate

Sensitive

No

. o

f I

sola

tes

89

6.2 Analysis of PCR Detection for ESBL genes

In order to identify the genes conferring the beta-lactam resistance in these isolates, PCR

typing for ESBL genes blaCTX-M , blaTEM, blaSHV and blaOXA-1 was done. The frequency of

the presence ESBL gene among the 23 isolates is given in Table 6.1 .Table 6.1 shows that

among the 23 isolates of this study, there is a higher frequency of the blaSHV allele

followed by blaCTX-M and blaOXA-1.

Table 6. 1 The frequency of occurrence of each ESBL gene in the isolates is

given here (n=23). More than one ESBL gene was observed in some isolates.

ESBL gene No. of isolates

Frequency of

occurrence

CTX-M 7 0.3

TEM 3 0.13

SHV 15 0.65

OXA-1 7 0.3

Since more than one ESBL gene is present in some isolates, we analyzed the distribution of

the ESBL combination in figure 6.2. This data indicates the occurrence of recombination

or plasmid transfer leading more than one ESBL gene in the isolates.

90

Figure 6.2 Distribution of ESBL genotypes in the clinical isolates (n=23).

Plasmids were extracted from each isolate and PCR was performed with ESBL specific

primers. Isolates were scored for specific PCR amplification by agarose gel

electrophoresis. The X- axis shows the ESBL gene combinations observed.

Based on the data from the 23 isolates of K. pneumoniae collected from Chennai, the

blaCTX-M and blaSHV recombination is more frequent than any other type of recombination.

In summary, the data shows the higher frequency of blaSHV followed by blaOXA-1 and

blaCTX-M in plasmid mediated ESBL in Klebsiella pneumoniae isolates in Chennai. This is

similar to a recent study by [Manoharan A et al. 2011] who showed that more than one

ESBL gene was present and this was correlated with increased resistance levels in

Enterobacteriaceae.

10

4

1 1

3

1 1 1 1

0

2

4

6

8

10

12

Nu

mb

er o

f Is

ola

tes

91

In addition the data also indicates high frequency of recombination leading to transfer and

accumulation of ESBL genes in Klebsiella isolates. The spread of ESBL could be due to

cross-infection from a single isolate or alternatively due to the conjugative transfer of

resistant plasmids. In order to find out the relatedness between resistant isolates, we

performed replicon typing of plasmids.

6.3 Plasmid based Replicon typing of MDR isolates

Having analysed the patterns of antibiotic resistance and the frequency of ESBL genes in

the 23 clinical isolates, we wondered if these data could be correlated with phylogenetic

relatedness amongst the ESBL carrying MDR plasmids. Therefore, we investigated the

phylogenetic relatedness among these plasmids by carrying out plasmid based replicon

typing [Carattoli et al 2006] .This method can identify 24 different types of plasmid

incompatibility groups among Enterobacteriaceae. The replicon typing of the isolates in

this study showed the presence of only seven types out of the 24 different Incompatibility

groups analyzed. Figures 6.3 and 6.4 show the PCR amplified products of replicon pattern

for 23 isolates were IncFIA, IncFIB, IncFIC, IncP and IncW. Thus, figures 6.3 and 6.4

shows the amplification of the 462 bp IncFIA product, 702 bp IncFIB product, 262 bp

IncFIC product, 532 bp IncP and 242 bp IncW product and one of each Inc group was

sequenced and compared to confirm of the authenticity of the replicon typing [Carattoli A

et al. 2005].

92

Figure 6.3 PCR based replicon typing of clinical isolates of Klebsiella

pneumoniae: The figure 6.3 panel A shows the specific amplification of the

Incompatibility groups for the isolates UT1 to UT10 while figure 6.3 panel B shows the

same for isoaltes P12 to P25. Panel A shows amplifications for IncFIA, IncFIB and IncP;

Panel B shows the amplification for IncFIC.

93

Figure 6.4 Panel A shows amplifications for IncFIA, IncFIB and IncW. Panel

B shows the amplification for IncFIC. The amplified replicon and its size is

indicated in the picture. The lane WC represents water control. One of the amplified

products was sequenced and analyzed to identify the authenticity of the PCR amplification.

Out of the 23 isolates, Inc groups belonging to the 7 groups listed above were identified in

19 isolates. Table 6.2 shows the relative frequencies of the 7 Inc groups amongst the 19

isolates. The frequency of the IncFIC replicon was highest at 52 %, followed by IncFIA

(47 %), and IncFIB (30 %). The data show that the plasmids containing ESBL genes

(blaSHV, blaCTX-M, blaTEM and blaOXA ) predominantly belong to IncFIC and IncFIA

replicons. This result is consistent with a similar and recent report from Germany[ Mshana

94

et al. 2009]. IncF plasmids are frequently encountered in clinical enterobacterial strains

associated with the dissemination of relevant antimicrobial resistance and virulence genes

[ Villa et al. 2010].

Table 6.2 Shows the frequency of occurrence of the Incompatibility groups in

the isolates (n=23). Some isolates showed more than one replicon.

Inc Group No. of isolates

Frequency of

presence

FIA 11 0.47

FIB 7 0.30

FIC 12 0.52

I1 2 0.08

HI1 1 0.04

P 1 0.04

W 5 0.22

In order to analyze the phylogenetic relatedness of the plasmids, the data from

ESBL and replicon typing for each isolate is represented pictorially in figure 6.5.

95

Figure 6.5 The replicon typing (upper panel) and ESBL typing (lower panel)

results are given for 19 clinical isolates. The amplification is represented by a

horizontal bar against the isolate. The Imipenem resistant isolates are marked IM-R.

The four isolates in which no replicons were identified though ESBL genes had been

identified from plasmid preparations. They are not represented in figure 6.5. It has been

reported that Klebsiella pneumoniae can contain more than one plasmid with multiple beta-

lactamases [ Wei et al. 2005] or alternatively it may be a mosaic plasmid with mosaic

replicons [Osborn et al. 2000] .The mosaic nature of the plasmid replicon and mutations

could be the reason that no replicons could be detected in four isolates. From the replicon

data, it is seen that there are only 8 isolates which contain a single replicon amplification

suggesting a single MDR plasmid. In the other isolates, more than one plasmid is expected

to be present.

From figure 6.5, six isolates which contain only the IncFIC can be seen.These however

contain different combinations of the ESBL genes. The IncFIA containing isolates (11 out

of 19 isolates) are frequently found in combination with other replicons. In the 19 isolates

which showed an amplifiable replicon, there was either an IncFIA or IncFIC replicon. In a

IncFIA

IncFIB

IncFIC

IncW

IncP

IncI1

IncH1

CTX-M

TEM

SHV

OXA-1

96

study carried out in Tunisia [Elhani et al 2010], in K. pneumoniae in Tunisia, the plasmids

carrying the blaSHV-2a or blaCTX-M-15 genes were assigned to IncFII replicon and more

rarely, to IncL/M types. The highly successful blaCTX-M-15 type-carrying plasmids which is

believed to have originated in India is a member of member of the IncF2 broad host range

plasmids [Karisik et al. 2006]. In a study in China, three plasmids large (140 kb), medium

(90 kb) and small (70 kb) have been found to be prevalent in the ESBL Klebsiella

pneumoniae isolates [Yi et al. 2010]. One of them, pKF3-70 has been sequenced

completely and found to belong to IncFII plasmid. In a study of E.coli ESBL isolates in

Germany, a conjugative IncFI plasmid of 145.5 kb carrying blaCTX-M-15 has been

identified [Mshana et al. 2009]. There are only two isolates which have only IncFIA (UT5

and UT6).These two isolates contain the blaOXA-1 ESBL allele. It is possible that these are

highly related to each other. There were four isolates which contained the IncW replicon

but in combination with either IncFIA or IncFIC. The IncW replicons were observed only

in the pus samples. The relative frequency of the IncI1, IncP and IncHI1 are much lower

as when compared with other replicon pattern as can be seen in table 6.2.

We identified two carbapenem resistant isolates P23 and UT10. The isolate P23 has two

replicons IncFIC and IncW and also amplified the blaTEM and blaOXA-1 ESBL. The isolate

UT10 has five different replicons namely FIA, FIB, FIC, I1 and HI1 and contains the

blaSHV ESBL gene. From this data it would appear that the carbapenem resistant isolates

are not phylogenetically related. They might have acquired the carbapenem resistance

either by a point mutation of an existing ESBL gene or might have acquired a new gene

independently.

97

6.3.1. Identification of the blaSHV and blaCTX-M alleles

In order to identify the SHV and CTX-M alelle, we sequenced one of the isolates for each

gene.The blaSHV amplified product from isolate P22 was sequenced using the same primers

used for PCR amplification. The partial coding region was obtained and the S130G

mutation was seen in ESBL isolates of blaSHV gene. (GenBank Accession number-

JX452829). This sequence also had the G238S and E240K mutations in blaSHV-5 figure

6.6. The BLAST analysis of the sequence also showed the highest sequence similarity with

the blaSHV-5 sequences.

Figure 6.6 Translation of the partial coding region of the SHV-5 sequence from

the isolate P22. The presence of the amino acid Leucine at position 35, Serine at

position 238 and Lysine at position 239 (in bold face and marked by an asterisk) confirm

that this sequence is the SHV-5 allele. GenBank Accession number - JX452829.

98

The blaCTX-M amplified product from the isolate UT1644 was sequenced and analyzed by

BLAST. From figure 6.7 the partial coding sequence showed the D240G mutation which

is critical for identification of blaCTX-M-15 allele [ Novais et al. 2010]. Since we did not

have the N terminal sequence we were not able to observe the A77V mutation to

differentiate between the blaCTX-M-15 and blaCTX-M-28 allele.

Figure 6.7 The partial coding region of the CTX-M amplified product from

UT1644 is shown. The critical amino acid positions which distinguish between the

alleles are shown in boldface. This allele has the D240G mutation only, in the region

sequenced. (GenBank Accession number- KC143066)

gaaagcgaaccgaatctgttaaatcagcgagttgagatcaaaaaatctgaccttgttaac

85 E S E P N L L N Q R V E I K K S D L V N

tataatccgattgcggaaaagcacgtcaatgggacgatgtcactggctgagcttagcgcg

105 Y N P I A E K H V N G T M S L A E L S A

*114

gccgcgctacagtacagcgataacgtggcgatgaataagctgattgctcacgttggcggc

125 A A L Q Y S D N V A M N K L I A H V G G

*140

ccggctagcgtcaccgcgttcgcccgacagctgggagacgaaacgttccgtctcgaccgt

145 P A S V T A F A R Q L G D E T F R L D R

accgagccgacgttaaacaccgccattccgggcgatccgcgtgataccacttcacctcgg

165 T E P T L N T A I P G D P R D T T S P R

*167

gcaatggcgcaaactctgcggaatctgacgctgggtaaagcattgggcgacagccaacgg

185 A M A Q T L R N L T L G K A L G D S Q R

gcgcagctggtgacatggatgaaaggcaataccaccggtgcagcgagcattcaggctgga

205 A Q L V T W M K G N T T G A A S I Q A G

ctgcctgcttcctgggttgtgggggataaaaccggcagcggtggctatggcaccacc

225 L P A S W V V G D K T G S G G Y G T T

240٭

99

6.4 Analysis of the Carbapenem resistant isolates

Carbapenems are the drugs of choice for treating MDR infections and can be mediated by

Class D oxacillanases or by class B metallo-beta-lactamases. Resistance to carbapenems

can be mediated by some alleles of blaOXA and metallo-β-lactamase class B enzymes

including the IMP, VIM, GIM, SPM, and the recently identified NDM-1 β-

lactamases.[Walsh et al. 2005, Kumarasamy et al. 2010].These can be identified by the

inhibition of the metallo beta lactamases by EDTA. Two out of 23 isolates were found to

be carbapenem resistant. The beta lactamase activity of the clinical isolate P23 was found

to be inhibited by a increase of 6mm in the presence of 0.5M EDTA as seen in figure 6.8.

A significant decrease in the inhibition zone with the absence of EDTA indicates that the

strain has an active MBL which was seen in both the original Klebsiella pneumoniae

isolate and the E.coli JM109 transformed with the plasmid from this resistance isolate

shown in table 6.3

Table 6.3 Detection of Metallo beta-lactamase with the parent and a

transformed colony. (NZ-No Zone)

Culture IMP IMP+EDTA EDTA CAZ C

P 23 12mm 18mm NZ NZ NZ

Transformed in

E.coliJM109

20mm 26mm NZ NZ NZ

100

Figure 6.8 Detection of Carbapenem metallo-ß-lactamase. A – ceftazidime disc;

B – Imipenem disc; C Imipenem and EDTA; D-only EDTA. The isolate Pus 23 showed an

increase in the clearing zone with IP+EDTA.

The plasmid isolated from this isolate did not amplify the blaNDM-1 gene although a positive

control did amplify the blaNDM-1 product (data not shown). This plasmid was found to have

an IncFIC replicon (Data not shown). Therefore Carpabenem resistance was found to be

transferrable. In the other resistant isolate P10, carbapenem resistance was not transferable.

The plasmid isolated from the isolate P23 was found to be carbapenem resistant and also it

had an IncFIC replicon.

Since this isolate did not harbor the blaNDM – 1 gene, it remains to be established whether

the carbapenem resistance is mediated by any other metallocarbapenemase. The complete

sequencing of some of the plasmids conferring MDR from Indian isolates is very important

and should be a focus of further research.

A A

A B

C

D

101

In summary, our study is significant because these results represent the first report of

replicon typing of ESBL plasmids of Klebsiella pneumoniae from Chennai. Plasmids

containing ESBL genes were predominantly belong to IncFIC and IncFIA replicon pattern.

However, further analysis of these plasmids and sequencing the genetic context of the

resistance genes will assist to understanding the mechanism of transfer of the resistance

genes.