chapter 20
DESCRIPTION
Chapter 20. Initiation of transcription. - PowerPoint PPT PresentationTRANSCRIPT
![Page 1: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/1.jpg)
Chapter Chapter 2020
Initiation of Initiation of transcriptiontranscription
![Page 2: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/2.jpg)
20.1 Introduction20.2 Eukaryotic RNA polymerases consist of many subunits20.3 Promoter elements are defined by mutations and footprinting20.4 RNA polymerase I has a bipartite promoter20.5 RNA polymerase III uses both downstream and upstream promoters20.6 The startpoint for RNA polymerase II20.7 TBP is a universal factor20.8 TBP binds DNA in an unusual way20.9 The basal apparatus assembles at the promoter20.10 Initiation is followed by promoter clearance20.11 A connection between transcription and repair20.12 Promoters for RNA polymerase II have short sequence elements20.13 Some promoter-binding proteins are repressors20.14 Enhancers contain bidirectional elements that assist initiation20.15 Independent domains bind DNA and activate transcription20.16 The two hybrid assay detects protein-protein interactions20.17 Interaction of upstream factors with the basal apparatus
![Page 3: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/3.jpg)
Enhancer element is a cis-acting sequence that increases the utilization of (some) eukaryotic promoters, and can function in either orientation and in any location (upstream or downstream) relative to the promoter.
20.1 Introduction
![Page 4: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/4.jpg)
Figure 20.1 A typical gene transcribed by RNA polymerase II has a promoter that extends upstream from the site where transcription is initiated. The promoter contains several short (<10 bp)sequence elements that bind transcription factors, dispersed over >200 bp. An enhancer containing a more closely packed array of elements that also bind transcription factors may be located several kb distant. (DNA may be coiled or otherwise rearranged so that transcription factors at the promoter and at the enhancer interact to form a large protein complex.)
20.1 Introduction
![Page 5: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/5.jpg)
Amanitin (more fully a-amanitin)is a bicyclic octapeptide derived from the poisonous mushroom Amanita phalloides; it inhibits transcription by certain eukaryotic RNA polymerases, especially RNA polymerase II.
20.2 Eukaryotic RNA polymerases consist of many subunits
![Page 6: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/6.jpg)
Figure 20.2 Eukaryotic RNA polymerase II has >10 subunits.
20.2 Eukaryotic RNA polymerases consist of many subunits
![Page 7: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/7.jpg)
Cotransfection is the simultaneous transfection of two markers.
20.3 Promoter elements are defined by mutations and footprinting
![Page 8: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/8.jpg)
Figure 20.3 Promoter boundaries can be determined by making deletions that progressively remove more material from one side. When one deletion fails to prevent RNA synthesis but the next stops transcription, the boundary of the promoter must lie between them.
20.3 Promoter elements are defined by mutations and footpri
nting
![Page 9: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/9.jpg)
Figure 20.4 Transcription units for RNA polymerase I have a core promoter separated by ~70 bp from the upstream control element. UBF1 binds to both regions, after which SL1 can bind. RNA polymerase I then binds to the core promoter. The nature of the interaction between the factors bound at the upstream control element and those at the core promoter is not known.
20.4 RNA polymerase I has a
bipartite promoter
![Page 10: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/10.jpg)
Preinitiation complex in eukaryotic transcription describes the assembly of transcription factors at the promoter before RNA polymerase binds.
20.5 RNA polymerase III uses both downstream and upstream promoters
![Page 11: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/11.jpg)
Figure 20.5 Deletion analysis shows that the promoter for 5S RNA genes is internal; initiation occurs a fixed distance (~55 bp) upstream of the promoter.
20.5 RNA polymerase III uses both downstream
and upstream promoters
![Page 12: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/12.jpg)
Figure 20.6 Promoters for RNA polymerase III may consist of bipartite sequences downstream of the startpoint, with boxA separated from either boxC or boxB. Or they may consist of separated sequences upstream of the startpoint (Oct, PSE, TATA).
20.5 RNA polymerase III uses both downstream and upstream promoters
![Page 13: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/13.jpg)
Figure 20.7 Initiation via the internal pol III promoters involves the assembly factors TFIIIA and TFIIIC, the initiation factor TFIIIB, and RNA polymerase III.
20.5 RNA polymerase III uses both downstream and upstream promoters
![Page 14: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/14.jpg)
TATA box is a conserved A·T-rich septamer found about 25 bp before the startpoint of each eukaryotic RNA polymerase II transcription unit; may be involved in positioning the enzyme for correct initiation.
20.6 The startpoint for RNA polymerase II
![Page 15: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/15.jpg)
Figure 20.8 RNA polymerases are positioned at all promoters by a factor that contains TBP.
20.7 TBP is a universal factor
![Page 16: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/16.jpg)
Figure 20.9 A view in cross-section shows that TBP surrounds DNA from the side of the narrow groove. TBP consists of two related (40% identical) conserved domains, which are shown in light and dark blue. The N-terminal region varies extensively and is shown in green. The two strands of the DNA double helix are in light and dark grey. Photograph kindly provided by Stephen Burley.
20.7 TBP is a universal factor
![Page 17: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/17.jpg)
Figure 20.10 The cocrystal structure of TBP with DNA from -40 to the startpoint shows a bend at the TATA box that widens the narrow groove where TBP binds. Photograph provided by Stephen Burley.
20.7 TBP is a universal factor
![Page 18: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/18.jpg)
Figure 20.11 An initiation complex assembles at promoters for RNA polymerase II by an ordered sequence of association with transcription factors.
20.8 The basal apparatus assembles at the promoter
![Page 19: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/19.jpg)
Figure 20.12 Two views of the ternary complex of TFIIB-TBP-DNA show that TFIIB binds along the bent face of DNA. The two strands of DNA are green and yellow, TBP is blue, and TFIIB is red and purple. Photograph kindly provided by Stephen Burley.
20.8 The basal apparatus assembles at the promoter
![Page 20: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/20.jpg)
Figure 20.13 Phosphorylation of the CTD by the kinase activity of TFIIH may be needed to release RNA polymerase to start transcription.
20.8 The basal apparatus assembles at the promoter
![Page 21: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/21.jpg)
Figure 20.14 Mfd recognizes a stalled RNA polymerase and directs DNA repair to the damaged template strand.
20.9 A connection between transcription and repair
![Page 22: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/22.jpg)
Figure 14.28 The Uvr system operates in stages in which UvrAB recognizes damage, UvrBC nicks the DNA, and UvrD unwinds the marked region.
20.9 A connection between
transcription and repair
![Page 23: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/23.jpg)
Figure 20.15 The TFIIH core may associate with a kinase at initiation and associate with a repair complex when damaged DNA is encountered.
20.9 A connection between
transcription and repair
![Page 24: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/24.jpg)
Figure 14.37 A helicase unwinds DNA at a damaged site, endonucleases cut on either side of the lesion, and new DNA is synthesized to replace the excised stretch.
20.9 A connection between
transcription and repair
![Page 25: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/25.jpg)
CAAT box is part of a conserved sequence located upstream of the startpoints of eukaryotic transcription units; it is recognized by a large group of transcription factors.
20.10 Promoters for RNA polymerase II have short sequence elements
![Page 26: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/26.jpg)
Figure 20.16 Saturation mutagenesis of the upstream region of the -globin promoter identifies three short regions (centered at -30, -75, and -90) that are needed to initiate transcription. These correspond to the TATA, CAAT,
20.10 Promoters for RNA polymerase II have short sequence elements
![Page 27: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/27.jpg)
Figure 20.17 Promoters contain different combinations of TATA boxes, CAAT boxes, GC boxes, and other elements.
20.10 Promoters for RNA polymerase II have short sequence elements
![Page 28: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/28.jpg)
Table 20.17 Upstream transcription factors bind to sequence elements that are common to mammalian RNA polymerase II promoters.
20.10 Promoters for RNA polymerase II have short sequence elements
ModuleModule ConsnesusConsnesus DNA boundDNA bound FactorFactor
TATA boxTATA box TATAAAATATAAAA ~10bp~10bp TBPTBP
CAAT boxCAAT box GGCCAATCTGGCCAATCT ~22bp~22bp CTF/NF1CTF/NF1
GC boxGC box GGGCGGGGGCGG ~20bp~20bp SP1SP1
OctamerOctamer ATTTGCATATTTGCAT ~20bp~20bp Oct-1Oct-1
OctamerOctamer ATTTGCATATTTGCAT ~23bp~23bp Oct-2Oct-2
kBkB GGGACTTTCCGGGACTTTCC ~10bp~10bp NF kBNF kB
ATFATF GTGACGTGTGACGT ~20bp~20bp ATFATF
![Page 29: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/29.jpg)
Table 20.17 Upstream transcription factors bind to sequence elements that are common to mammalian RNA polymerase II promoters.
20.10 Promoters for RNA polymerase II have short sequence elements
ModuleModule ConsnesusConsnesus DNA boundDNA bound FactorFactor
TATA boxTATA box TATAAAATATAAAA ~10bp~10bp TBPTBP
CAAT boxCAAT box GGCCAATCTGGCCAATCT ~22bp~22bp CTF/NF1CTF/NF1
GC boxGC box GGGCGGGGGCGG ~20bp~20bp SP1SP1
OctamerOctamer ATTTGCATATTTGCAT ~20bp~20bp Oct-1Oct-1
OctamerOctamer ATTTGCATATTTGCAT ~23bp~23bp Oct-2Oct-2
kBkB GGGACTTTCCGGGACTTTCC ~10bp~10bp NF kBNF kB
ATFATF GTGACGTGTGACGT ~20bp~20bp ATFATF
![Page 30: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/30.jpg)
Figure 20.18 A transcription complex involves recognition of several elements in the sea urchin H2B promoter in testis. Binding of the CAAT displacement factor in embryo prevents the CAAT-binding factor from binding, so an active complex cannot form.
20.10 Promoters for RNA polymerase II have short sequence elements
![Page 31: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/31.jpg)
Enhancer element is a cis-acting sequence that increases the utilization of (some) eukaryotic promoters, and can function in either orientation and in any location (upstream or downstream) relative to the promoter.
20.11 Enhancers contain bidirectional elements that assist initiation
![Page 32: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/32.jpg)
Figure 19.39 Indirect end-labeling identifies the distance of a DNAase hypersensitive site from a restriction cleavage site. The existence of a particular cutting site for DNAase I generates a discrete fragment, whose size indicates the distance of the DNAase I hypersensitive site from the restriction site.
20.11 Enhancers contain bidirectional elements that assist initiation
![Page 33: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/33.jpg)
Figure 19.40 The SV40 minichromosome has a nucleosome gap. Photograph kindly provided by Moshe Yaniv.
20.11 Enhancers contain bidirectional elements that assist initiation
![Page 34: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/34.jpg)
Figure 20.19 An enhancer contains several structural motifs. The histogram plots the effect of all mutations that reduce enhancer function to <75% of wild type. Binding sites for proteins are indicated below the histogram.
20.11 Enhancers contain bidirectional elements that assist initiation
![Page 35: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/35.jpg)
Figure 20.16 Saturation mutagenesis of the upstream region of the -globin promoter identifies three short regions (centered at -30, -75, and -90) that are needed to initiate transcription. These correspond to the TATA, CAAT,
20.11 Enhancers contain bidirectional elements that assist initiation
![Page 36: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/36.jpg)
Figure 20.20 An enhancer may function by bringing proteins into the vicinity of the promoter. An enhancer does not act on a promoter at the opposite end of a long linear DNA, but becomes effective when the DNA is joined into a circle by a protein bridge. An enhancer and promoter on separate circular DNAs do not interact, but can interact when the two molecules are catenated.
20.11 Enhancers contain bidirectional elements that assist initiation
![Page 37: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/37.jpg)
Figure 20.21 DNA-binding and activating functions in a transcription factor may comprise independent domains of the protein.
20.12 Independent domains bind DNA and activate transcription
![Page 38: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/38.jpg)
Figure 20.22 The GAL4 protein has independent regions that bind DNA, activate transcription (2 regions), dimerize, and bind the regulator GAL80.
20.12 Independent domains bind DNA and activate transcription
![Page 39: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/39.jpg)
Figure 20.23 The ability of GAL4 to activate transcription is independent of its specificity for binding DNA. When the GAL4 DNA-binding domain is replaced by the LexA DNA-binding domain, the hybrid protein can activate transcription when a LexA operator is placed near a promoter.
20.12 Independent domains bind DNA and activate transcription
![Page 40: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/40.jpg)
Figure 20.24 The activating domain of the tat protein of HIV can stimulate initiation if it is tethered in the vicinity by binding to the RNA product of a previous round of transcription. Activation is independent of the means
20.12 Independent domains bind DNA and activate transcription
![Page 41: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/41.jpg)
Figure 20.25 The two hybrid technique tests the ability of two proteins to interact by incorporating them into hybrid proteins where one has a DNA-binding domain and the other has a transcription-activating domain.
20.12 Independent domains bind DNA and activate transcription
![Page 42: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/42.jpg)
Figure 20.21 DNA-binding and activating functions in a transcription factor may comprise independent domains of the protein.
20.13 Interaction of upstream factors with the basal apparatus
![Page 43: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/43.jpg)
Figure 20.26 An upstream transcription factor may bind a coactivator that contacts the basal apparatus.
20.13 Interaction of upstream factors with the basal apparatus
![Page 44: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/44.jpg)
Figure 20.24 The activating domain of the tat protein of HIV can stimulate initiation if it is tethered in the vicinity by binding to the RNA product of a previous round of transcription. Activation is independent of the means
20.13 Interaction of upstream factors with the basal apparatus
![Page 45: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/45.jpg)
Figure 20.11 An initiation complex assembles at promoters for RNA polymerase II by an ordered sequence of association with transcription factors.
20.13 Interaction of upstream factors with the basal apparatus
![Page 46: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/46.jpg)
Figure 20.27 Upstream activators may work at different stages of initiation, by contacting the TAFs of TFIID or contacting TFIIB.
20.13 Interaction of upstream factors with the basal apparatus
![Page 47: Chapter 20](https://reader036.vdocuments.us/reader036/viewer/2022081520/568151cd550346895dc00901/html5/thumbnails/47.jpg)
1. Of the three eukaryotic RNA polymerases, RNA polymerase I transcribes rDNA and accounts for the majority of activity, RNA polymerase II transcribes structural genes for mRNA and has the greatest diversity of products, and RNA polymerase III transcribes small RNAs. 2. None of the three RNA polymerases recognize their promoters directly. 3. The TATA box (if there is one) near the startpoint, and the initiator region immediately at the startpoint, are responsible for selection of the exact startpoint at promoters for RNA polymerase II.4. RNA polymerase is found as part of much larger complexes that contain factors that interact with activators and repressors. 5. Promoters for RNA polymerase II contain a variety of short cis-acting elements, each of which is recognized by a trans-acting factor. 6. Promoters may be stimulated by enhancers, sequences that can act at great distances and in either orientation on either side of a gene.
Summary