cell reports resourcewe generated a rac activity reporter mouse strain by intro-ducing the...
TRANSCRIPT
![Page 1: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/1.jpg)
Cell Reports
Resource
The Rac-FRET Mouse RevealsTight Spatiotemporal Control of Rac Activityin Primary Cells and TissuesAnna-Karin E. Johnsson,1,4 Yanfeng Dai,1,4,5 Max Nobis,2 Martin J. Baker,1 Ewan J. McGhee,2 Simon Walker,1
Juliane P. Schwarz,2 Shereen Kadir,2 Jennifer P. Morton,2 Kevin B. Myant,2 David J. Huels,2 Anne Segonds-Pichon,1
Owen J. Sansom,2 Kurt I. Anderson,2 Paul Timpson,2,3,* and Heidi C.E. Welch1,*1Signalling Programme, Babraham Institute, Babraham Research Campus, Cambridge CB22 3AT, UK2Beatson Institute for Cancer Research, Switchback Road, Bearsden, Glasgow G61 1BD, UK3Garvan Institute of Medical Research and Kinghorn Cancer Centre, Cancer Research Program, St. Vincent’s Clinical School,Faculty of Medicine, University of New South Wales, NSW, 2010 Sydney, Australia4These authors contributed equally to this work5Present address: Research Centre for Animal Genetic Resources of the Mongolia Plateau, Inner Mongolia University,235 West University Road, 010021 Hohhot, China
*Correspondence: [email protected] (P.T.), [email protected] (H.C.E.W.)
http://dx.doi.org/10.1016/j.celrep.2014.02.024
This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/3.0/).
SUMMARY
The small G protein family Rac has numerous regula-tors that integrate extracellular signals into tightspatiotemporal maps of its activity to promote spe-cific cell morphologies and responses. Here, wehave generated a mouse strain, Rac-FRET, whichubiquitously expresses the Raichu-Rac biosensor.It enables FRET imaging and quantification ofRac activity in live tissues and primary cells with-out affecting cell properties and responses. Weassessed Rac activity in chemotaxing Rac-FRETneutrophils and found enrichment in leading-edgeprotrusions and unexpected longitudinal shifts andoscillations during protruding and stalling phases ofmigration. We monitored Rac activity in normal ordisease states of intestinal, liver, mammary, pancre-atic, and skin tissue, in response to stimulation or in-hibition and upon genetic manipulation of upstreamregulators, revealing unexpected insights into Racsignaling during disease development. The Rac-FRET strain is a resource that promises to fundamen-tally advance our understanding of Rac-dependentresponses in primary cells and native environments.
INTRODUCTION
The small G protein family Rac is an essential controller of actin
cytoskeletal dynamics and hence cell shape, adhesion, motility,
regulated secretion, and phagocytosis, as well as of gene
expression and reactive oxygen species (ROS) formation (Heas-
man and Ridley, 2008; Wennerberg et al., 2005). Rac is active
(i.e., able to bind downstream effectors) when guanosine
triphosphate (GTP)-bound and inactive when guanosine diphos-
Ce
phate (GDP)-bound. Its activation is catalyzed by at least 20
different DBL- or DOCK-type guanine nucleotide exchange fac-
tors (GEFs) (Rossman et al., 2005) and its inhibition by an equally
large number of Rac-GTPase-activating proteins (GAPs). Rac
downstream signaling specificity and the ensuing Rac-depen-
dent cell responses are largely conferred through the types of
GEFs and GAPs that couple Rac to any given upstream signal
(Rossman et al., 2005).
Forster resonance energy transfer (FRET) technology is widely
used to monitor protein/protein interactions, coupling fluoro-
phore pairs such as cyan fluorescent protein (CFP) and yellow
fluorescent protein (YFP) to two proteins of interest. Inter- and in-
tramolecular FRET probes have been used for a decade to visu-
alize Rac activity (Aoki andMatsuda, 2009; Hodgson et al., 2010;
Itoh et al., 2002; Kraynov et al., 2000). Intermolecular Rac FRET
reporters measure the interaction between separate molecules
that must be expressed to comparable levels and subcellular
distributions (Kraynov et al., 2000), which can be technically diffi-
cult, and they are prone to interfere with endogenous GTPase
signaling (Aoki andMatsuda, 2009; Hodgson et al., 2010). The in-
tramolecular ‘‘Raichu’’ (Ras superfamily and interacting protein
chimeric unit) Rac-FRET probe contains RAC1 as the signal
sensor and Pak-CRIB as the effector, CRIB being the CDC42/
Rac interactive binding motif of Pak, a Rac target that binds to
GTP-bound, but not GDP-bound, Rac. In Raichu-Rac, RAC1-
GTP binding to Pak-CRIB causes FRET from CFP to YFP (Itoh
et al., 2002). The probe is anchored into the plasma membrane
via a KRAS CAAX motif and hence monitors the balance of
endogenous Rac-GEF and Rac-GAP activities at the physiolog-
ically relevant subcellular localization of active RAC1 (Itoh et al.,
2002).
Rac-FRET biosensors have largely been used in transfection-
based experiments in order to correlate the localization of
Rac activity with cellular function. Rac is required for cell motility,
and use of Rac-FRET probes showed that active Rac localizes to
extending cell protrusions during many fundamental processes,
ll Reports 6, 1153–1164, March 27, 2014 ª2014 The Authors 1153
![Page 2: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/2.jpg)
including the leading edge of migrating cells (Itoh et al., 2002;
Kraynov et al., 2000; Machacek et al., 2009; Ouyang et al.,
2008), forming phagosomal cups during phagocytosis of
apoptotic cells (Nakaya et al., 2008), distal poles of daughter
cells during cell division (Yoshizaki et al., 2003), or developing
neurites during neurogenesis (Aoki et al., 2004). Combining
Raichu-Rac expression with downregulation of Vav-family
Rac-GEFs showed that phosphatidylinositol 3-kinase-driven
GEFmembrane targeting localizes Rac activity during neurogen-
esis (Aoki et al., 2005). Expression of an intermolecular Rac-
FRET reporter combined with downregulation of the Rac-GEF
TIAM1 showed that TIAM1 association with distinct scaffolding
proteins directs localized Rac activity depending on extracellular
stimulus (Rajagopal et al., 2010). Similarly, overexpression of a
Raichu-Rac-like probe combined with membrane-targeting of
TIAM1 or the Rac-GAP chimaerin in Madin-Darby canine kidney
(MDCK) cell cysts showed mislocalization of Rac activity to suf-
fice for luminal invasion (Yagi et al., 2012a, 2012b). Finally, use of
Raichu-Rac demonstrated apicobasal Rac activity gradients
at epithelial cell junctions driven by differential regulation of
TIAM1 through b2-syntrophin and Par-3 (Mack et al., 2012).
Raichu-Rac-derived probes are also beginning to be used for
monitoring Rac activity in whole tissues. Reporter expression in
Xenopus and zebrafish embryos showed localized RAC1 activity
in migrating cells during organ development (Kardash et al.,
2010; Matthews et al., 2008; Xu et al., 2012). A limitation of these
studies was that biosensor expression was transient. The
first transgenic Rac-FRET biosensor organism was generated
recently, a fly that conditionally expresses modified Raichu-
Rac in border cells. This revealed Rac activity gradients not
only inside cells, but between cell clusters, being highest in cells
leading in the direction of migration (Wang et al., 2010). First use
of Raichu-Rac-like probes inmammals was recently achieved by
transplantation of biosensor-expressing glioblastoma cells into
rat brain, thus enabling correlation of Rac activity with the
mode of tumor cell migration during invasion (Hirata et al.,
2012). Whereas this study was limited by biosensor expression
in cultured rather than primary cells, it clearly demonstrated
that the mammalian tissue microenvironment controls Rac
activity (Hirata et al., 2012).
There is therefore a need for measuring Rac activity in primary
mammalian cells and tissues for assessing its regulation by
physiologically and functionally relevant organ- or disease-spe-
cific environmental cues. Here, we report the development of a
Rac-FRET mouse strain, which ubiquitously expresses the orig-
inal intramolecular Raichu-Rac reporter to allow spatiotemporal
quantification of Rac activity in living primary mammalian cells
and tissues.
RESULTS
Generation of the Rac-FRET MouseWe generated a Rac activity reporter mouse strain by intro-
ducing the extensively validated intramolecular Raichu-Rac
FRET biosensor (Itoh et al., 2002) into the ROSA26 locus to
confer ubiquitous expression from the endogenous promoter.
To this end, we first generated Rac-FRETfl/fl, a strain in which
Raichu-Rac expression was conditionally prevented by a tran-
1154 Cell Reports 6, 1153–1164, March 27, 2014 ª2014 The Authors
scriptional stop and crossed this with ‘‘deleter,’’ a strain with
X-chromosomalCre recombinase, to excise the stop and enable
constitutive Raichu-Rac expression before breeding out Cre
again (Figure S1). Homozygous knockin mice of the resulting
Rac-FRET strain were born at expected Mendelian ratio,
appeared healthy and fertile, lived normal life-spans, and ex-
hibited no untoward behaviors.
Raichu-Rac Expression Levels in Rac-FRETMouse Cellsand TissuesRaichu-Rac expression was detected in all tissues tested, at
approximately 20–25 ng/mg of tissue, although expression in
muscle tissue (heart, stomach, and skeletal muscle) was some-
what lower, at 2–10 ng/mg (Figure 1A). In primary Rac-FRET neu-
trophils, which express equal amounts of ubiquitous RAC1 and
hematopoietic RAC2, expression of the biosensor was 0.6% of
endogenous RAC1 and RAC2 (Figure 1B), and in primary E13.5
Rac-FRET mouse embryonic fibroblasts (MEFs), it was 8% of
endogenous RAC1 (Figure 1C). Therefore, Raichu-Rac protein
levels are low compared to endogenous Rac, as we had aimed
for, in order to prevent possible dominant-negative effects. As
Raichu-Rac expression did not cause obvious defects and
Rac-FRET mice appeared healthy, we continued to characterize
properties and responses of primary Rac-FRET MEFs and neu-
trophils in detail to determine if it affected cell function.
Primary Rac-FRET MEFs Function Normally and ShowHighly Localized Rac Activity upon PDGF or InsulinStimulationWe investigated proliferation, lifespan, and morphology of pri-
mary Rac-FRET MEFs. They showed normal proliferation rates,
low cell death (2%–4%) in culture, and normal cell morphologies
upon serum starvation and platelet-derived growth factor
(PDGF) stimulation (Figures S2A–S2C). Pak-CRIB pull-down
assays showed that endogenous RAC1 activity was normal in
serum-starved and PDGF-stimulated Rac-FRET MEFs, as was
the activity of the Rac target p38MAPK (Figures S2D and S2E).
Rac-FRET MEFs were assessed by ratiometric FRET imaging,
where increases in YFP/CFP fluorescence ratio induced by FRET
reflect increased Rac activity. Treatment with 50 ng/ml PDGF
stimulated the formation of lamellipodial protrusions and periph-
eral membrane ruffles, which showed significantly higher Rac
activity (FRET ratio of 1.25) than cell edges without protrusions
(FRET ratio of 1.1), and Rac activity remained high throughout
lamellipodia formation and ruffling (Figures 2A and 2B; Movie
S1). Therefore, Rac activity correlated spatially and temporally
with lamellipodia and ruffles, as expected from studies in
fibroblast-like cell lines (Itoh et al., 2002). Stimulation with
100 mg/ml insulin, which caused larger lamellipodia but fewer
dorsal ruffles, gave similar results (Figure 2C; Movie S2).
Rac-FRETNeutrophils FunctionNormally andShowHighRac Activity during Spreading and PolarizationWe and others have previously shown that Rac and its upstream
regulators play crucial roles in ROS formation, adhesion,
spreading, and chemotaxis of neutrophils (Deng et al., 2011;
Gu et al., 2003; Lawson et al., 2011; Roberts et al., 1999; Welch
et al., 2002, 2005), but analysis of Rac activity in these cells has
![Page 3: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/3.jpg)
Figure 1. Raichu-Rac Expression Level in
Tissues and Primary Cells of the Rac-FRET
Mouse Strain
(A) Whole-tissue lysates were prepared from adult
Rac-FRET mice and blotted with anti-GFP anti-
body alongside recombinant CFP standards to
reveal the CFP portion of Raichu-Rac. a.u., arbi-
trary units; WT, wild-type.
(B) Raichu-Rac expression levels in total lysates
of the indicated numbers of diisopropyl fluo-
rophosphate-treated Rac-FRET neutrophils were
determined by western blotting alongside recom-
binant RAC1 and CFP standards using anti-RAC1
AB (green) and anti-GFP AB (red) to compare
biosensor expression with endogenous RAC1.
(C) Raichu-Rac expression levels in total lysates of
the indicated numbers of Rac-FRET MEFs were
determined by western blotting alongside recom-
binant RAC1 and CFP standards with antibodies
as in (B).
been hampered by the facts that they are short-lived and cannot
easily be transfected. Here, we determined if Rac-dependent
neutrophil responses are affected by Raichu-Rac expression.
Rac-FRET neutrophils developed normally in the bone marrow
(not shown), mounted normal ROS responses to the G protein
coupled receptor ligand N-formyl-methionyl-leucyl-phenylala-
nine (fMLP) and to phorbol myristate acetate (PMA), adhered
normally to glass or the integrin ligand poly-Arg-Gly-Asp, spread
normally, and underwent normal basal migration and fMLP-
stimulated chemotaxis in transwell assays, whereas Rac2�/�
cells showed the expected defects (Figures S3A–S3D; Lawson
et al., 2011; Roberts et al., 1999). Furthermore, the basal and
fMLP-stimulated activities of endogenous RAC1 and RAC2 (by
Pak-CRIB pull-down assays) and of the Rac target p38MAPK
were normal (Figures S3E–S3G). Therefore, Rac-FRET neutro-
phil responses were normal by all measures tested.
Rac is required for neutrophil spreading and polarization (Gu
et al., 2003; Roberts et al., 1999). We assessed Rac activity
during these responses in Rac-FRET neutrophils in the presence
or absence of the Rac inhibitor NSC23766. Upon first contact
Cell Reports 6, 1153–1164
with the coverslip (time 0), Rac activity
(normalized FRET ratio) was lower in
NSC23766-treated than control cells,
but increased initially in both upon adhe-
sion, reaching a maximal value of 1.23
within 8 min in control cells compared to
1.04 in NSC23766-treated cells, and
remained high throughout in control
cells whereas decreasing to 0.87 with
NSC23766 (Figures 3A and 3B). Control
cells spread from 90 to 130 mm2 within
8 min and remained spread, whereas
spreading was significantly dampened
by NSC23766 (Figure 3C). Rac activity re-
mained high in control cells, correlating
with their ability to start polarizing twice
as fast as NSC23766-treated cells, to
fully polarize and to maintain polarity (Fig-
ure 3D). Hence, combined use of NSC23766 and ratiometric
FRET imaging showed that Rac activity is required for Rac-
FRET neutrophil spreading and polarization, that it increases
globally throughout the cell during spreading, and that it remains
elevated during polarization.
Rac Activity in Chemotaxing Rac-FRET NeutrophilsChemotaxing primary murine neutrophils are fast-migrating cells
(up to 20 mm/min) that extend transient probing lamellipodial pro-
trusions at their front and sides that typically last for 1 s and
longer-lived protrusions (several seconds), mostly at the leading
edge, that result in translocation. Here, we assayed Rac activity
during chemotaxis of Rac-FRET neutrophils in fMLP gradients
(Figure 4A; Movie S3). Ratiometric FRET imaging at 1 s frame
intervals showed that high Rac activity correlated spatially with
lamellipodial protrusions and low Rac activity with membrane re-
tractions. Temporally, Rac activity was as transient as the protru-
sions (Figures 4A and 4B). We used polar plots to visualize the
localization of Rac activity over time. Comparison with rubber
band plots (which depict cell outlines over time) and cell path
, March 27, 2014 ª2014 The Authors 1155
![Page 4: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/4.jpg)
Figure 2. High Rac Activity in Lamellipodial Protrusions and Membrane Ruffles of PDGF-Stimulated Primary Rac-FRET MEFs
(A) Rac activity in PDGF-stimulated (50 ng/ml) Rac-FRET MEFs determined by ratiometric FRET live imaging. Frames were taken every 10 s (left: generation of
ratiometric image) and analyzed at protruding (top) and nonprotruding sections (bottom) along the cell edge (magnifications of boxes in the FRET image on the
left). Note that, for ratiometric FRET measurements, increase in FRET ratio equals increase in Rac activity.
(B) Quantification of mean Rac activity (FRET ratio ± SEM) in 88 basal and protruding sections along the cell edge of PDGF-stimulated Rac-FRET MEFs as in (A)
from 20 cells and three independent experiments. **p < 0.01 by paired Student’s t test.
(C) Rac activity in insulin-stimulated (100 mg/ml) Rac-FRETMEFs determined by ratiometric FRET imaging. Consecutive frames taken every 10 s, shown from 80 s
after addition of insulin (left: YFP/FRET and CFP images used to generate first ratiometric image). Arrow shows Rac activity at membrane ruffles.
plots showed that Rac activity is highest at the leading edge and
that bursts of high Rac activity typically last for 3–5 s (Figures 4C,
S4A, and S4B). In addition to the leading edge, average polar
plots showed bursts of Rac activity at the periphery and trailing
edge (Figures S4C and S4D). Detailed analysis of the time
dependence of Rac activity and the speed of movement of the
cell edge by Pearson’s correlation showed a direct correlation
(height of peak) between the extent of Rac activity (FRET ratio)
and speed of protrusion formation, without any time lag in the
order of seconds (alignment of peak with lag = 0 s; Figures 4D
and S4E). Therefore, high Rac activity is spatially, temporally,
and inmagnitude tightly correlated with lamellipodial protrusions
at the leading edge of chemotaxing neutrophils.
Oscillations of Rac Activity between the Front and Backof Chemotaxing Rac-FRET NeutrophilsTo investigate the bursts of Rac activity at the front versus back
of chemotaxing neutrophils further, we line-scanned Rac activ-
ity along the central longitudinal axis at 1 s intervals and dis-
played it as a function of time in kymographs (Figure 4E). This
revealed that Rac activity (normalized FRET ratio) is higher at
the front of chemotaxing cells than at the back, as expected,
but furthermore that the bulk of Rac activity shifts by 1.6 mm
toward the posterior of the cell during stalling phases (Figures
4F and S4F). Plotting the location of peak Rac activity on the
longitudinal axis against time revealed unexpected oscillations
1156 Cell Reports 6, 1153–1164, March 27, 2014 ª2014 The Authors
of Rac activity between the front and back of chemotaxing neu-
trophils, and albeit these oscillations being noisy, they tended
toward periodicity. Oscillations of peak Rac activity occurred
in all cells analyzed and ranged from 6 to 12 s (mean ± SEM =
8.7 ± 0.4 s), with R2 values (fit of oscillations to periodicity)
ranging from 0.4 to 0.9 (mean = 0.7; Figure 4G). The oscillating
peak Rac activity was significantly greater than mean whether
localized at the front or the back (Figure S4G). To assess
whether the oscillations of Rac activity are characteristic of
chemotaxis, we compared control and NSC23766-treated
neutrophils. As expected, NSC23766 inhibited chemotaxis (Fig-
ure S4Hi), and both mean and peak Rac activity along the cen-
tral longitudinal axis were lower in NSC23766-treated cells than
in control cells (Figure S4Hii). We categorized NSC23766-
treated cells that retained some form of movement into those
migrating directionally (toward the chemoattractant) and those
which had lost directionality (moving nondirectionally, antidirec-
tionally, or without translocation). Oscillations of Rac activity
were significantly perturbed in both categories compared to
control cells but more so in cells that had lost directionality,
as seen by the significant decreases in R2 value from 0.71 to
0.51 and 0.36, respectively (Figure S4Hiii). These results
confirmed that oscillations of Rac activity along the central lon-
gitudinal axis of the cell are a hallmark of directional migration in
primary mouse neutrophils. Therefore, the use of ratiometric
FRET imaging in primary Rac-FRET neutrophils has allowed
![Page 5: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/5.jpg)
A B
C D
Figure 3. High Rac Activity during Spreading and Polarization of Rac-FRET Neutrophils
(A) Spatiotemporal distribution of Rac activity in Rac-FRET neutrophils during spreading and polarization on glass coverslips was determined by ratiometric FRET
live imaging in the presence or absence of 75 mM NSC23766 (without preincubation), starting from the first point of contact of the cells with the coverslip.
Representative FRET ratio images are shown.
(B) Quantification of Rac activity (average cellular FRET ratio, normalized to control cells) in 69 control and 59 NSC23766-treated cells as in (A) from six inde-
pendent experiments ± SEM p < 0.0001 by ANOVA.
(C) Surface area of the cells in (B).
(D) Polarization of the cells in (B) was analyzed as: time to start polarizing (i), % of fully polarized cells (as defined by their ability to locomote) (ii), and % of cells
reverting to nonpolarized morphology over the 30 min of imaging (iii). *p < 0.05 by unpaired Student’s t test.
us to reveal unexpected insights into the complexities of Rac
signaling during chemotaxis.
Spatiotemporal Regulation of Rac Activity in MouseIntestinal Crypt CulturesTo examine the spatiotemporal control of Rac activity in a multi-
cellular environment, we generated primary three-dimensional
(3D)-intestinal crypt cultures (Myant et al., 2013; Sato et al.,
2009) from the Rac-FRET mouse and analyzed them by fluores-
cence-lifetime imaging microscopy (FLIM)-FRET imaging, where
a decrease in CFP fluorescence lifetime due to FRET reflects
increased Rac activity. We could readily detect Raichu-Rac
expression and image Rac activity in these cultures, which re-
sponded to stimulation with 200 nM PMAwith a time-dependent
increase that peaked after 30min and subsided after 90min (Fig-
ures 5A and 5B). Rac activity was also spatially regulated. Basal
Rac activity was higher in cells at the base of the crypts than in
distal cells, and cells at the base of the crypts also responded
more strongly to PMA treatment than distal cells (Figures 5A
and 5B). This demonstrates reversible and spatial regulation of
Rac activity within multicellular mammalian environments, as
previously observed in Drosophila (Wang et al., 2010).
Ce
Effects of Drug Treatment, Genetic Manipulation, andDisease Development on Rac Activity In VivoWe recently demonstrated that multiphoton microscopy can be
used for ex vivo and in vivo FLIM-FRET imaging of murine tumors
formed by implanted Raichu-RhoA-expressing pancreatic carci-
noma cells (Timpson et al., 2011) and that RHOA activity at the tip
of invading tumors correlates with invasion efficiency (McGhee
et al., 2011; Timpson et al., 2011). Here, we used similar imaging
techniques with the Rac-FRET mouse to examine Rac activity in
native host tissue.
Our recent work suggested that increased Rac activity
following loss of the tumor suppressor adenomatous polyposis
coli (APC) facilitates stem cell hyperproliferation at the base of in-
testinal crypts and colorectal cancer initiation via enhanced ROS
and nuclear factor (NF)-kB production (Myant et al., 2013). To
investigate this here, we first evaluated ex vivo multiphoton
FLIM-FRET imaging of Rac activity in normal intestinal tissue of
the Rac-FRET mouse. Rac activity could be measured within a
range of 0–150 mm from the base of crypts toward the villi and
was stimulated at the crypt base upon treatment with 200 nM
PMA (Figures 5C and 5D; Movie S4). We crossed the Rac-
FRET mouse to Vil-Cre-ERT2 APCfl/fl mice and induced intestinal
ll Reports 6, 1153–1164, March 27, 2014 ª2014 The Authors 1157
![Page 6: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/6.jpg)
A
B C
D E
F G
Figure 4. High Rac Activity Correlates with Protrusion Formation at the Leading Edge and Oscillates between the Front and Back of
Chemotaxing Rac-FRET Neutrophils(A) Ratiometric FRET live imaging of a representative Rac-FRET neutrophil chemotaxing toward 3 mM fMLP in an Ibidi chamber; images taken at 1 s intervals over
20 s (chemoattractant source is due south). For comparison of Rac activity with cell protrusions and retractions, cell perimeters at consecutive time points T (blue)
and T+1 s (red) were plotted using ImageJ plugin QuimP.
(legend continued on next page)
1158 Cell Reports 6, 1153–1164, March 27, 2014 ª2014 The Authors
![Page 7: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/7.jpg)
APC loss by tamoxifen treatment (Myant et al., 2013) to assess
the APC dependence of Rac activity in crypts by in vivo FLIM-
FRET imaging. APC loss led to increased Rac activity at the
base of crypts in Vil-Cre-ERT2 APCfl/fl Rac-FRET mice (Figures
5E and 5F), thus demonstrating the utility of the Rac-FRET
mouse as a tool for examining the regulation of Rac during dis-
ease initiation.
Next, we examined Rac activity in the pancreas in the context
of the stromal extracellular matrix (ECM) at depth. Upon stimula-
tion of Rac-FRET mouse pancreas with 200 nM PMA ex vivo,
increased Rac activity was observed (Figures 6A and 6B; Movie
S5). We crossed the Rac-FRET mouse to the Kras+/G12D
Trp53+/R172HPdx1-Cre (KPC) model of pancreatic ductal adeno-
carcinoma, in which gain-of-function p53R172H drives metastasis
on a KRASG12D background (Morton et al., 2010; Muller et al.,
2009). In vivo FLIM-FRET imaging of pancreatic tumors in KPC
Rac-FRET mice compared to normal pancreas in Rac-FRET
mice revealed that Rac activity was significantly upregulated in
tumors (Figures 6C and 6D). Such deregulated Rac activity
may partially explain the disruption of cell-cell and cell-matrix
adhesion and tumor dissociation, which characterize this inva-
sive and highly metastatic model (Morton et al., 2010; Muller
et al., 2009, 2013).
We also crossed the Rac-FRET mouse to the locally invasive
Polyoma-middle T (PyMT) breast cancer model. Rac activity
could readily be detected in isolated primary mammary tumors
of PyMT Rac-FRET mice and inhibited by NSC23766 treatment
(Figures 7A and 7B; Movie S6). In vivo FLIM-FRET imaging of
exposed tumor tissue of PyMT Rac-FRET mice injected with
NSC23766 showed that Rac was inactivated within 60 min of
NSC23766 administration and began to revert to control level
after 90 min (Figures 7C and 7D). This highlights the utility of
the Rac-FRET mouse for monitoring drug target activity and
clearance rates, which could be applied to guide the scheduling
and dosing of therapeutic intervention.
Finally, we have recently shown that the Rac-GEF PREX1 is
deregulated in melanoma and drives Rac-dependent invasion
(Li et al., 2011; Lindsay et al., 2011). To assess whether the
Rac-FRET mouse is useful for examining Rac activity in the
skin, while at the same time trialling tissue-specific expression,
(B) Enlargement of boxed sections shown in (A). The green-framed box shows
trailing edge.
(C) Polar plot of Rac activity (FRET ratio) around the perimeter of the cell shown i
starting in the center (1 s) and growing eccentrically outward over time.
(D) Pearson’s correlation between Rac activity (FRET ratio) at nodes around the ce
and cell edge velocity. FRET intensities were evaluated against edge speeds be
membrane protrusion/retraction speed. Red line shows average correlation from
3 mM fMLP over 100–120 s with images acquired every 1 s; gray traces show m
(E) Rac-FRET neutrophils chemotaxing toward 3 mM fMLP in an Ibidi chamber w
gitudinal axis, and Rac activity (FRET ratio) over time plotted as kymographs. Pro
achieved by averaging line scans for each segment (as detailed in Supplemental E
4.2 mm/min during stalling phases of migration.
(F) Average Rac activity (FRET ratio) in central longitudinal line scans of 25 cells fro
of the peak Rac activity from the front edge during protruding and stalling phases o
(mean of 25 cells; five experiments; paired t test p = 0.02).
(G) Rac activity oscillates between the front and the back of chemotaxing neu
representative chemotaxing neutrophil was plotted for each 1 s time frame in ord
activity over time, and best fit periodicity curves (purple) were applied to evaluate t
green, that of the back in red. Data shown are from one cell representative of 19
Ce
we crossed Rac-FRETfl/fl to K14-Cre mice to induce selective
Raichu-Rac expression in keratinocytes. Rac activity could
readily be detected by FLIM-FRET imaging of E15.5 K14-Cre
Rac-FRETfl/fl embryonic skin explants and stimulated by PMA
treatment (Figure S5; Movie S7). Combined with PREX1 defi-
ciency, this may be useful for examining PREX1 in melanoma
metastasis. Collectively, the assessment of Rac activity within
these and other organs, such as the liver (Figure S6; Movie
S8), emphasizes the general utility and scope of the Rac-FRET
mouse as a tool for monitoring the intricate mechanisms of regu-
lation of Rac signaling in amyriad of physiological processes and
disease states.
DISCUSSION
Here, we report the development of a Rac-FRET mouse that
ubiquitously expresses Raichu-Rac. We examined Rac activity
in primary MEFs, neutrophils, and intestinal crypts, as well as in
intact tissues (intestine, liver, mammary, pancreas, and skin), in
response to genetic or drug intervention. This revealed unex-
pected insights into Rac signaling during neutrophil chemotaxis,
tissue homeostasis, disease initiation, and disease progression.
We chose the Raichu-Rac reporter over other Rac-FRET bio-
sensors as the probe most likely to provide best signal-to-noise
ratio without affecting cell survival. A similar Raichu-Rac probe
with a RAC1 instead of a KRAS membrane-targeting cassette
gives higher background (Yoshizaki et al., 2003); another probe
that uses CRIB between CFP and YFP, measuring FRET inhibi-
tion upon binding of endogenous Rac (Graham et al., 2001), is
neither as sensitive as Raichu-Rac nor specific for Rac, as it
also binds CDC42-GTP; and finally a Raichu-like probe in which
YFP is replaced with more sensitive YPet (Ouyang et al., 2008)
suggested nonnegligible cytotoxicity in our hands. Recently,
progress in the development of Raichu sensors involving longer
linkers in the reporter molecule has been made, reducing basal
FRET further and thus increasing signal-to-noise (Komatsu
et al., 2011). A next step in reporter mouse development could
be the use of such an improved construct.
The ROSA26 locus was chosen for its ubiquitous expression,
and the endogenous ROSA26 promoter, rather than stronger
a protrusion at the leading edge of the cell, the red box a retraction at the
n (A) over time; perimeters depicted as perfect circles, 1 circle/1 s time frame,
ll perimeter and 0.4 mm from the cell edge (schematic example shown in insert)
tween T�5 s and T+5 s to test for time dependence between Rac activity and
seven independent experiments with a total of 133 cells chemotaxing toward
eans of individual experiments.
ere live imaged at 1 s intervals, line scans performed through the central lon-
filing of steep (protruding) versus flat (stalling) sections of the kymograph was
xperimental Procedures). Average speedwas 15 mm/min during protruding and
m five independent experiments. Gray and black dotted lines show the distance
f migration. The extent of the retrograde shift was 1.6 mmduring stalling phases
trophils. Maximum Rac activity (blue) along the central longitudinal axis of a
er to allow an assessment of the spatial localization of the point of highest Rac
he oscillations. The position of the front of the cell at each time point is traced in
cells analyzed.
ll Reports 6, 1153–1164, March 27, 2014 ª2014 The Authors 1159
![Page 8: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/8.jpg)
Figure 5. Spatiotemporal Distribution of Rac Activity in Intestinal Tissue
(A) PMA stimulation of Rac activity at the base is stronger than in distal cells of Rac-FRET duodenal crypt cultures. Representative fluorescence image of an
intestinal crypt culture (left) with Raichu-Rac (blue) and corresponding FLIM-FRET fluorescence lifetimemaps of Rac activity before (middle) or after (right) 200 nM
PMA treatment. In the FLIM-FRET images, arrows highlight the crypt base and insets show enlarged boxed sections. Note that, for FLIM-FRET measurements,
decrease in fluorescence lifetime equals increase in Rac activity.
(B) Quantification of Rac activity in intestinal crypt cultures as in (A) upon stimulation with 200 nM PMA for 0–90 min. Mean fluorescence lifetime ± SEM of 21–31
cells at varying positions in the base (black) or the distal section of the crypt (gray), as indicated by the schematics, for each time point and location. *p < 0.05,
***p < 0.001, and ****p < 0.0001 by unpaired Student’s t test between indicated time and 0-time control.
(C) Rac activity at the base of Rac-FRET intestinal crypts is stimulated by PMA ex vivo. Representative FLIM-FRET images before (left) and after (right) stimulation
of freshly isolated intestinal crypt tissue with 200 nM PMA for 15 min. For each pair of images, the left-hand panel shows a representative fluorescence image of
intestinal crypts expressing Raichu-Rac (blue), the right-hand one a corresponding fluorescence lifetime map.
(D) Quantification of Rac activity (fluorescence lifetime; mean ± SEM) at the base of 20 intestinal Rac-FRET mouse intestinal crypts before and after PMA
stimulation ex vivo as in (C).
(E) Rac activity at the base of intestinal crypts is increased upon tissue-specific APC loss in vivo. Representative FLIM-FRET images at the base of intestinal crypts
of live Vil-Cre-ERT2 Rac-FRET control mice (left) and Vil-Cre-ERT2 APCfl/fl Rac-FRET mice with intestinal tissue-specific APC deletion (right). For each pair of
images, the left-hand panel shows a representative fluorescence image of intestinal crypts expressing Raichu-Rac (blue) and the second harmonic generation
(SHG) signal from host ECM components (white), the right-hand one a corresponding fluorescence lifetime map.
(F) Quantification of Rac activity (fluorescence lifetime; mean ± SEM) from 206 cells at the base of intestinal crypts in control mice and 197 cells in APC-deleted
mice as in (E); three independent regions each. **p < 0.05 by unpaired Student’s t test.
exogenous promoters, to deliberately aim for low expression
levels to prevent conceivable dominant-negative effects. We
introduced Raichu-Rac with a floxed stop cassette for either
ubiquitous or conditional expression, depending on the choice
of Cre-recombinase strain. The Rac-FRET mouse expresses
Raichu-Rac constitutively and ubiquitously. Our assessment
of MEFs and neutrophils showed that we gauged expression
level well, high enough for detection, but not affecting cell
1160 Cell Reports 6, 1153–1164, March 27, 2014 ª2014 The Authors
properties or responses. However, particularly in neutrophils,
signal strength is limiting, so development of a strain with
stronger inducible expression may be useful. Crossing of Rac-
FRETfl/fl to K14-Cre mice demonstrated that the conditional
Rac-FRETfl/fl strain is useful for tissue-specific expression of
Raichu-Rac. Such targeted expression of the reporter will allow
the assessment of Rac activity in specific cell types within het-
erogeneous tissues. For example, Lgr5-Cre mice (Barker et al.,
![Page 9: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/9.jpg)
A
C
B
D
Figure 6. High Rac Activity in Pancreatic Tumors
(A) Rac activity is stimulated by PMA in Rac-FRETmouse pancreas ex vivo. From the left, panels show a fluorescence image of freshly isolated pancreatic tissue,
an enlargement of the region analyzed, with Raichu-Rac expression in blue and SHG signal from host ECM in white, a corresponding Rac activity (fluorescence
lifetime) map, and images of Rac activity before (top) and after (bottom) treatment with 200 nM PMA for 15 min.
(B) Quantification of pancreatic Rac activity (fluorescence lifetime;mean ±SE) as in (A) from 30 cells in three regions before and after stimulation with 200 nMPMA
for 15 min. *p < 0.05 by unpaired Student’s t test. ns, not significant.
(C) Increased Rac activity in pancreatic tumors in vivo. Representative FLIM-FRET images comparing normal pancreas in live Rac-FRET mice and pancreatic
tumors in live KPC Rac-FRETmice. For each pair of images, the left-hand panel shows a representative fluorescence image of Raichu-Rac (blue) and SHG signal
from host ECM (white), the right-hand one a corresponding FLIM-FRET fluorescence lifetime map.
(D) Quantification of Rac activity in Rac-FRET and KPC Rac-FRET pancreas in vivo as in (C). Mean fluorescence lifetime ± SEM of 222 Rac-FRET and 461 KPC
Rac-FRET cells from three to four regions/mouse, three mice/genotype. ***p < 0.001 by unpaired Student’s t test.
2007) could be used in the future to express Raichu-Rac specif-
ically in stem cells of the small intestine to investigate further the
increased Rac activity we observed upon deletion of the tumor
suppressor APC. Alternatively, the Rac-FRET mouse could be
crossed to a strain expressing a red fluorescent protein specif-
ically in a cell type of interest, for in vivo colabeling and
comparing Rac activity between specific cell types within com-
plex tissues. We also crossed Rac-FRETfl/fl with Cre-ERT2 mice
for drug-inducible expression (Feil et al., 1996). Cre-ER+/T2
Rac-FRET+/fl neutrophils expressed similar levels of Raichu-
Rac upon tamoxifen treatment than Rac-FRET neutrophils and
showed normal cell responses. Thus, inducible Raichu-Rac
expression is another useful feature of the Rac-FRETfl/fl strain.
Crossing the Rac-FRET mouse to various models of disease
has demonstrated its utility for assessing the effects ofmutations
that recapitulate human disease etiology on Rac activity in a
time- and tissue-specific manner, even in organs and tissues
that contain complex mixtures of cell types, without affecting tis-
sue homeostasis. For example, in colorectal cancer, APC loss
often leads to hyperproliferation of intestinal stem cells, and
RAC1 is a critical mediator of this process through its roles in
ROS production and NF-kB signaling (Myant et al., 2013). There-
fore, it is unsurprising that we found the Rac pathway to be active
upon APC loss. We suspect that, in normal intestinal tissue, the
basal and PMA-stimulated Rac activities were also higher in cells
at the base of crypts than in distal cells because the highly pro-
liferative intestinal stem cells are located there. As another
Ce
example for possible future applications, crossing the Rac-
FRET mouse with Tyr-Cre strain for melanoblast-specific
expression (Delmas et al., 2003), with Prex1�/� mice or with mu-
rine models of melanoma, could provide insights into the cell-
type- and stage-specific roles of Rac deregulation during mela-
noma progression (Li et al., 2011; Lindsay et al., 2011).
Ratiometric FRET microscopy was useful for measurement of
Rac activity in isolated primary Rac-FRET neutrophils andMEFs.
Similarly, ratiometric FRET was chosen in Rac-FRET reporter-
expressing zebrafish embryos, because of their optical transpar-
ency (Kardash et al., 2010; Xu et al., 2012). In thick tissue or
organ sections, multiphoton FLIM-FRET imaging allowed us to
monitor tissues at depth and with high resolution, both ex vivo
and in vivo, in the context of the host tissue and environmental
cues. Considering recent advances in imaging and image
analysis, which allow millisecond resolution of spatiotemporal
dynamics (Hinde et al., 2013), it should be possible to adapt
imaging systems to analyze Rac activity alongside Rac-depen-
dent cell responses in any type of tissue.
Use of the Rac-FRET mouse allowed us to observe the exqui-
site spatiotemporal regulation of Rac activity in primary neutro-
phils, which are very different from even their closest model
cell lines, e.g., in their formation of more-transient and probing
lamellipodial protrusions during chemotaxis, which we show
here to be accompanied by equally transient and locally
restricted bursts of Rac activity. During the initial phase of
neutrophil spreading, we observed some increase in Rac
ll Reports 6, 1153–1164, March 27, 2014 ª2014 The Authors 1161
![Page 10: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/10.jpg)
Figure 7. Rac Activity in Mammary Tumors Is Inhibited by NSC23766
(A) Rac activity in PyMT Rac-FRET mouse mammary tumors is inhibited by NSC23766 ex vivo. Representative FLIM-FRET images of freshly isolated mammary
tumors of PyMTRac-FRETmice without (left) or with (right) treatment with 50 mMNSC23766 for 60min ex vivo. For each pair of images, the left-hand panel shows
a representative fluorescence image of tissue expressing Raichu-Rac (blue) and SHG signal from host ECM (white), the right-hand one a corresponding Rac
activity (fluorescence lifetime) map.
(B) Quantification of Rac activity in PyMT mammary tumors as in (A). Mean fluorescence lifetime ± SEM of 144 control cells and 74 NSC23766-treated cells from
two to three different regions/group. ***p < 0.001 by unpaired Student’s t test.
(C) Rac activity inmammary tumors is inhibited by treatment with NSC23766 in vivo. Representative FLIM-FRET images of Rac activity in mammary tumors of live
PyMT Rac-FRET mice before (left) and 60 min after (right) intraperitoneal (i.p.) injection of NSC23766 (4 mg/kg). Order of images as in (A).
(D) Quantification of Rac activity (fluorescence lifetime; mean ± SEM) in 210 cells within mammary tumors of PyMT Rac-FRET mice in vivo 0–90 min after i.p.
injection of NSC23766. **p < 0.01 and ***p < 0.001 by unpaired Student’s t test.
activity, even in NSC23766-treated cells (though lower than in
controls). This could simply be due to incomplete inhibition, but
it is also possible that NSC23766-insensitive Rac-GEFs might
contribute to this phase. Rac-GEFs from the Vav family, for
example, are nonresponsive to NSC23766 (Gao et al., 2004)
and known to be required for neutrophil spreading (Lawson
et al., 2011). This possibility could be investigated in the future
by analysis of Rac-FRET neutrophils with added Rac-GEF
deficiencies. During neutrophil chemotaxis, we observed unex-
pectedbehaviors ofRacactivity in addition to theexpected accu-
mulation at the leading edge, including a retrograde shift during
stalling phases and a yo-yoing between the front and back of
the cell. It is unsurprising that these phenomena have not been
observed previously, as only a combination of FRET technology
and the use of primary cells affords sufficient spatiotemporal res-
olution. Wider and slower waves of Rac activity had previously
been observed in HL60 cells (Weiner et al., 2007), and it seems
possible that the oscillations in primary cells are mechanistically
related. It will be interesting to determine if specific upstream reg-
ulators mediate these oscillations and if these Rac-GEFs are
required for the fast migration mode of neutrophils.
Different types of small G proteins of the Rho family are
activated dependently of each other. Combined use of Rac,
CDC42, or RHOA activity probes and high-resolution imaging
of single-membrane protrusions showed that RhoA is activated
at the tip of forming cell protrusions whereas Rac and CDC42
1162 Cell Reports 6, 1153–1164, March 27, 2014 ª2014 The Authors
activity patterns are wider (Machacek et al., 2009). Furthermore,
transplantation of glioblastoma cells expressing Rac, CDC42, or
RHOA reporters into rat brain suggested that the balance of Rac,
CDC42, and RHOA activities dictates modes of cancer cell inva-
sion (Hirata et al., 2012). Transgenic biosensormice for a number
of different types of small G proteins are currently being gener-
ated (Goto et al., 2013), although not as conditional alleles and
at much higher expression levels. Such GTPase reporter mice
will facilitate future comparisons between different small G pro-
teins tremendously, and different strains will doubtless prove
appropriate for different applications.
In conclusion, the Rac-FRET mouse strain has enabled us to
monitor the intricate and dynamic regulation of the small G pro-
tein Rac, an essential controller of distinct biological responses
depending on timing, location, and signaling context. Future
use of the Rac-FRET mouse as a tool, alone or in combination
with deficiencies in Rac-GEFs, Rac-GAPs, or other upstream
regulators, should fundamentally advance our insight into the
signaling networks that drive Rac-dependent cell responses
and enable us to expand our knowledge of Rac signaling in pri-
mary cells and complex multicellular physiological and disease
states.
EXPERIMENTAL PROCEDURES
Detailed protocols can be found in Supplemental Experimental Procedures.
![Page 11: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/11.jpg)
Generation of the Rac-FRET Reporter Mouse Strain
Modified Raichu-1011X plasmid (Itoh et al., 2002) was introduced into stop-
eGFP-ROSA26TV (Addgene 11739) to generate the Rac-FRET targeting
vector. Upon germline transmission, Rac-FRETfl/fl strain was crossed with
deleter to induce ubiquitous expression of Raichu-Rac. The resulting homozy-
gous Rac-FRETKi/Ki knockin mouse strain was called Rac-FRET for brevity.
Raichu-Rac expression in cells and tissues of the Rac-FRETmousewas deter-
mined by western blotting.
Rac-FRET MEF and Neutrophil Isolation and Responses
Primary E13.5 MEFs were isolated upon timed mating of Rac-FRETKi/fl mice
and cultured for up to 15 days. Proliferation assays were done by cell counting,
cell cycle assays by propidium iodide staining, and morphology assays by
image analysis of tetramethylrhodamine isothiocyanate-phalloidin-stained
cells. Primary neutrophils were freshly isolated from bone marrow for each
experiment. Adhesion and spreading were assayed on glass or integrin-ligand
surfaces, ROS formation by luminol assay, and chemotaxis by transwell
assays using 3 mm pore filters (Lawson et al., 2011; Welch et al., 2005) or Ibidi
chamber assays using Ibidi sticky slide IV0.4. Endogenous Rac activity was
determined in Rac-FRET MEF and neutrophil lysates by Pak-CRIB pull-
down and p38MAPK phosphorylation by western blotting.
Tissues and Mouse Strains for Analysis of Rac Activity in Live
Tissues and Organs
Intestinal crypt cultures (Sato et al., 2009) and skin explants (Mort et al., 2010)
were prepared as described. Vil-Cre-ERT2 APCfl/fl Rac-FRET mice for imaging
of Rac activity in intestinal crypts following APC loss, KPC Rac-FRET mice for
imaging of Rac activity in pancreatic tumors, PyMT Rac-FRET mice for
imaging of Rac activity in mammary tumors, and K14-Cre Rac-FRETfl/fl mice
for tissue-specific expression of Raichu-Rac and imaging of Rac activity in
embryonic skin were generated as detailed in Supplemental Experimental
Procedures.
Imaging
Rac activity was assessed in Rac-FRET MEFs and neutrophils by ratiometric
FRET imaging using an Olympus Cell R imaging system. Pairs of images
were acquired sequentially every 15 s for spreading neutrophils and every
10 s for MEFs. For chemotaxing neutrophils, both channels were acquired
simultaneously at 1 frame/s and cells tracked using ImageJ plugin QuimP11.
Pearson’s correlation was used to analyze the time dependence between
Rac activity and speed of cell edge movement and polar plots (Ferguson
et al., 2007) for the spatiotemporal representation of Rac activity at the cell
perimeter. In addition, line scans of Rac activity were performed along the
central longitudinal axis.
Imaging of Rac activity in various intact tissues and organs was done using
multiphoton FLIM-FRET imaging. Crypt cultures were imaged at depths of
0–100 mm and freshly isolated ex vivo crypts (Myant et al., 2013) at
0–150 mm. For in vivo imaging of intestinal, pancreas, or mammary tissue,
mice were terminally anesthetized. Multiphoton FLIM-FRET imaging was car-
ried out on a Nikon Eclipse TE2000-U inverted microscope with an Olympus
long working distance 20 3 0.95 numerical aperture water immersion lens
using a scan head specifically designed for multiphoton excitation. Data
were analyzed using the time-correlated single-photon counting fluorescence
lifetime analysis functionality of ImSpectorPro (LaVison Biotec).
SUPPLEMENTAL INFORMATION
Supplemental Information includes Supplemental Experimental Procedures,
six figures, and eight movies and can be found with this article online at
http://dx.doi.org/10.1016/j.celrep.2014.02.024.
ACKNOWLEDGMENTS
We are extremely grateful to Miki Matsuda for allowing us to generate the Rac-
FRET mouse with the Raichu-Rac construct and for constructively discussing
the choice of construct with us at the beginning of the project. We acknowl-
Ce
edge the great skill of the people from the Babraham and Beatson animal
facilities and the passionate care they take in looking after our mice. We also
thank James Conway for critical reading of the manuscript. The project was
funded by BBSRC core funding, BBSRC grant BB/I02154X/1, CRUK core
funding, and NHMRC and ARC funding. Work in the O.J.S. lab was funded
through European Union PRIMES project grant FP7-HEALTH-2011-278568.
Received: November 20, 2013
Revised: February 5, 2014
Accepted: February 15, 2014
Published: March 13, 2014
REFERENCES
Aoki, K., and Matsuda, M. (2009). Visualization of small GTPase activity with
fluorescence resonance energy transfer-based biosensors. Nat. Protoc. 4,
1623–1631.
Aoki, K., Nakamura, T., and Matsuda, M. (2004). Spatio-temporal regulation of
Rac1 and Cdc42 activity during nerve growth factor-induced neurite
outgrowth in PC12 cells. J. Biol. Chem. 279, 713–719.
Aoki, K., Nakamura, T., Fujikawa, K., and Matsuda, M. (2005). Local phospha-
tidylinositol 3,4,5-trisphosphate accumulation recruits Vav2 and Vav3 to
activate Rac1/Cdc42 and initiate neurite outgrowth in nerve growth factor-
stimulated PC12 cells. Mol. Biol. Cell 16, 2207–2217.
Barker, N., van Es, J.H., Kuipers, J., Kujala, P., van den Born, M., Cozijnsen,
M., Haegebarth, A., Korving, J., Begthel, H., Peters, P.J., and Clevers, H.
(2007). Identification of stem cells in small intestine and colon by marker
gene Lgr5. Nature 449, 1003–1007.
Delmas, V., Martinozzi, S., Bourgeois, Y., Holzenberger, M., and Larue, L.
(2003). Cre-mediated recombination in the skin melanocyte lineage. Genesis
36, 73–80.
Deng, Q., Yoo, S.K., Cavnar, P.J., Green, J.M., and Huttenlocher, A. (2011).
Dual roles for Rac2 in neutrophil motility and active retention in zebrafish he-
matopoietic tissue. Dev. Cell 21, 735–745.
Feil, R., Brocard, J., Mascrez, B., LeMeur, M., Metzger, D., and Chambon, P.
(1996). Ligand-activated site-specific recombination in mice. Proc. Natl. Acad.
Sci. USA 93, 10887–10890.
Ferguson, G.J., Milne, L., Kulkarni, S., Sasaki, T., Walker, S., Andrews, S.,
Crabbe, T., Finan, P., Jones, G., Jackson, S., et al. (2007). PI(3)Kgamma has
an important context-dependent role in neutrophil chemokinesis. Nat. Cell
Biol. 9, 86–91.
Gao, Y., Dickerson, J.B., Guo, F., Zheng, J., and Zheng, Y. (2004). Rational
design and characterization of a RacGTPase-specific small molecule inhibitor.
Proc. Natl. Acad. Sci. USA 101, 7618–7623.
Goto, A., Sumiyama, K., Kamioka, Y., Nakasyo, E., Ito, K., Iwasaki, M., Eno-
moto, H., and Matsuda, M. (2013). GDNF and endothelin 3 regulate migration
of enteric neural crest-derived cells via protein kinase A and Rac1. J. Neurosci.
33, 4901–4912.
Graham, D.L., Lowe, P.N., and Chalk, P.A. (2001). A method to measure the
interaction of Rac/Cdc42 with their binding partners using fluorescence reso-
nance energy transfer between mutants of green fluorescent protein. Anal.
Biochem. 296, 208–217.
Gu, Y., Filippi, M.D., Cancelas, J.A., Siefring, J.E., Williams, E.P., Jasti, A.C.,
Harris, C.E., Lee, A.W., Prabhakar, R., Atkinson, S.J., et al. (2003). Hematopoi-
etic cell regulation by Rac1 and Rac2 guanosine triphosphatases. Science
302, 445–449.
Heasman, S.J., and Ridley, A.J. (2008). Mammalian Rho GTPases: new in-
sights into their functions from in vivo studies. Nat. Rev. Mol. Cell Biol. 9,
690–701.
Hinde, E., Digman, M.A., Hahn, K.M., and Gratton, E. (2013). Millisecond
spatiotemporal dynamics of FRET biosensors by the pair correlation function
and the phasor approach to FLIM. Proc. Natl. Acad. Sci. USA 110, 135–140.
Hirata, E., Yukinaga, H., Kamioka, Y., Arakawa, Y., Miyamoto, S., Okada, T.,
Sahai, E., and Matsuda, M. (2012). In vivo fluorescence resonance energy
ll Reports 6, 1153–1164, March 27, 2014 ª2014 The Authors 1163
![Page 12: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/12.jpg)
transfer imaging reveals differential activation of Rho-family GTPases in glio-
blastoma cell invasion. J. Cell Sci. 125, 858–868.
Hodgson, L., Shen, F., and Hahn, K. (2010). Biosensors for characterizing the
dynamics of rho family GTPases in living cells. In Current Protocols in Cell
Biology, Chapter 14, J.S. Bonifacino, M. Dasso, J.B. Harford, J. Lippincott-
Schwartz, and K.M. Yamada, eds. (New York: John Wiley & Sons), pp. 11–26.
Itoh, R.E., Kurokawa, K., Ohba, Y., Yoshizaki, H., Mochizuki, N., and Matsuda,
M. (2002). Activation of rac and cdc42 video imaged by fluorescent resonance
energy transfer-based single-molecule probes in the membrane of living cells.
Mol. Cell. Biol. 22, 6582–6591.
Kardash, E., Reichman-Fried, M., Maıtre, J.L., Boldajipour, B., Papusheva, E.,
Messerschmidt, E.M., Heisenberg, C.P., and Raz, E. (2010). A role for Rho
GTPases and cell-cell adhesion in single-cell motility in vivo. Nat. Cell Biol.
12, 47–53, 1–11.
Komatsu, N., Aoki, K., Yamada, M., Yukinaga, H., Fujita, Y., Kamioka, Y., and
Matsuda, M. (2011). Development of an optimized backbone of FRET biosen-
sors for kinases and GTPases. Mol. Biol. Cell 22, 4647–4656.
Kraynov, V.S., Chamberlain, C., Bokoch, G.M., Schwartz, M.A., Slabaugh, S.,
and Hahn, K.M. (2000). Localized Rac activation dynamics visualized in living
cells. Science 290, 333–337.
Lawson, C.D., Donald, S., Anderson, K.E., Patton, D.T., and Welch, H.C.
(2011). P-Rex1 and Vav1 cooperate in the regulation of formyl-methionyl-
leucyl-phenylalanine-dependent neutrophil responses. J. Immunol. 186,
1467–1476.
Li, A., Ma, Y., Yu, X., Mort, R.L., Lindsay, C.R., Stevenson, D., Strathdee, D.,
Insall, R.H., Chernoff, J., Snapper, S.B., et al. (2011). Rac1 drives melanoblast
organization during mouse development by orchestrating pseudopod- driven
motility and cell-cycle progression. Dev. Cell 21, 722–734.
Lindsay, C.R., Lawn, S., Campbell, A.D., Faller, W.J., Rambow, F., Mort, R.L.,
Timpson, P., Li, A., Cammareri, P., Ridgway, R.A., et al. (2011). P-Rex1 is
required for efficient melanoblast migration and melanoma metastasis. Nat.
Commun. 2, 555.
Machacek, M., Hodgson, L., Welch, C., Elliott, H., Pertz, O., Nalbant, P., Abell,
A., Johnson, G.L., Hahn, K.M., and Danuser, G. (2009). Coordination of Rho
GTPase activities during cell protrusion. Nature 461, 99–103.
Mack, N.A., Porter, A.P., Whalley, H.J., Schwarz, J.P., Jones, R.C., Khaja,
A.S., Bjartell, A., Anderson, K.I., and Malliri, A. (2012). b2-syntrophin and
Par-3 promote an apicobasal Rac activity gradient at cell-cell junctions by
differentially regulating Tiam1 activity. Nat. Cell Biol. 14, 1169–1180.
Matthews, H.K., Marchant, L., Carmona-Fontaine, C., Kuriyama, S., Larraın, J.,
Holt, M.R., Parsons, M., and Mayor, R. (2008). Directional migration of neural
crest cells in vivo is regulated by Syndecan-4/Rac1 and non-canonical Wnt
signaling/RhoA. Development 135, 1771–1780.
McGhee, E.J., Morton, J.P., Von Kriegsheim, A., Schwarz, J.P., Karim, S.A.,
Carragher, N.O., Sansom, O.J., Anderson, K.I., and Timpson, P. (2011).
FLIM-FRET imaging in vivo reveals 3D-environment spatially regulates
RhoGTPase activity during cancer cell invasion. Small GTPases 2, 239–244.
Mort, R.L., Hay, L., and Jackson, I.J. (2010). Ex vivo live imaging of melano-
blast migration in embryonic mouse skin. Pigment Cell Melanoma Res. 23,
299–301.
Morton, J.P., Timpson, P., Karim, S.A., Ridgway, R.A., Athineos, D., Doyle, B.,
Jamieson, N.B., Oien, K.A., Lowy, A.M., Brunton, V.G., et al. (2010). Mutant
p53 drivesmetastasis and overcomes growth arrest/senescence in pancreatic
cancer. Proc. Natl. Acad. Sci. USA 107, 246–251.
Muller, P.A., Caswell, P.T., Doyle, B., Iwanicki, M.P., Tan, E.H., Karim, S., Lu-
kashchuk, N., Gillespie, D.A., Ludwig, R.L., Gosselin, P., et al. (2009). Mutant
p53 drives invasion by promoting integrin recycling. Cell 139, 1327–1341.
Muller, P.A., Trinidad, A.G., Timpson, P., Morton, J.P., Zanivan, S., van den
Berghe, P.V., Nixon, C., Karim, S.A., Caswell, P.T., Noll, J.E., et al. (2013).
1164 Cell Reports 6, 1153–1164, March 27, 2014 ª2014 The Authors
Mutant p53 enhances MET trafficking and signalling to drive cell scattering
and invasion. Oncogene 32, 1252–1265.
Myant, K.B., Cammareri, P., McGhee, E.J., Ridgway, R.A., Huels, D.J., Cor-
dero, J.B., Schwitalla, S., Kalna, G., Ogg, E.L., Athineos, D., et al. (2013).
ROS production and NF-kB activation triggered by RAC1 facilitate WNT-
driven intestinal stem cell proliferation and colorectal cancer initiation. Cell
Stem Cell 12, 761–773.
Nakaya, M., Kitano, M., Matsuda, M., and Nagata, S. (2008). Spatiotemporal
activation of Rac1 for engulfment of apoptotic cells. Proc. Natl. Acad. Sci.
USA 105, 9198–9203.
Ouyang, M., Sun, J., Chien, S., and Wang, Y. (2008). Determination of hierar-
chical relationship of Src and Rac at subcellular locations with FRET biosen-
sors. Proc. Natl. Acad. Sci. USA 105, 14353–14358.
Rajagopal, S., Ji, Y., Xu, K., Li, Y., Wicks, K., Liu, J., Wong, K.W., Herman, I.M.,
Isberg, R.R., and Buchsbaum, R.J. (2010). Scaffold proteins IRSp53 and
spinophilin regulate localized Rac activation by T-lymphocyte invasion and
metastasis protein 1 (TIAM1). J. Biol. Chem. 285, 18060–18071.
Roberts, A.W., Kim, C., Zhen, L., Lowe, J.B., Kapur, R., Petryniak, B., Spaetti,
A., Pollock, J.D., Borneo, J.B., Bradford, G.B., et al. (1999). Deficiency of the
hematopoietic cell-specific Rho family GTPase Rac2 is characterized by ab-
normalities in neutrophil function and host defense. Immunity 10, 183–196.
Rossman, K.L., Der, C.J., and Sondek, J. (2005). GEF means go: turning on
RHO GTPases with guanine nucleotide-exchange factors. Nat. Rev. Mol.
Cell Biol. 6, 167–180.
Sato, T., Vries, R.G., Snippert, H.J., van de Wetering, M., Barker, N., Stange,
D.E., van Es, J.H., Abo, A., Kujala, P., Peters, P.J., and Clevers, H. (2009).
Single Lgr5 stem cells build crypt-villus structures in vitro without a mesen-
chymal niche. Nature 459, 262–265.
Timpson, P., McGhee, E.J., Morton, J.P., von Kriegsheim, A., Schwarz, J.P.,
Karim, S.A., Doyle, B., Quinn, J.A., Carragher, N.O., Edward, M., et al.
(2011). Spatial regulation of RhoA activity during pancreatic cancer cell inva-
sion driven by mutant p53. Cancer Res. 71, 747–757.
Wang, X., He, L., Wu, Y.I., Hahn, K.M., and Montell, D.J. (2010). Light-medi-
ated activation reveals a key role for Rac in collective guidance of cell move-
ment in vivo. Nat. Cell Biol. 12, 591–597.
Weiner, O.D., Marganski, W.A., Wu, L.F., Altschuler, S.J., and Kirschner, M.W.
(2007). An actin-based wave generator organizes cell motility. PLoS Biol. 5,
e221.
Welch, H.C., Coadwell, W.J., Ellson, C.D., Ferguson, G.J., Andrews, S.R.,
Erdjument-Bromage, H., Tempst, P., Hawkins, P.T., and Stephens, L.R.
(2002). P-Rex1, a PtdIns(3,4,5)P3- and Gbetagamma-regulated guanine-
nucleotide exchange factor for Rac. Cell 108, 809–821.
Welch, H.C., Condliffe, A.M., Milne, L.J., Ferguson, G.J., Hill, K., Webb, L.M.,
Okkenhaug, K., Coadwell, W.J., Andrews, S.R., Thelen, M., et al. (2005).
P-Rex1 regulates neutrophil function. Curr. Biol. 15, 1867–1873.
Wennerberg, K., Rossman, K.L., and Der, C.J. (2005). The Ras superfamily at a
glance. J. Cell Sci. 118, 843–846.
Xu, H., Kardash, E., Chen, S., Raz, E., and Lin, F. (2012). Gbg signaling controls
the polarization of zebrafish primordial germ cells by regulating Rac activity.
Development 139, 57–62.
Yagi, S., Matsuda, M., and Kiyokawa, E. (2012a). Chimaerin suppresses Rac1
activation at the apical membrane to maintain the cyst structure. PLoS ONE 7,
e52258.
Yagi, S., Matsuda, M., and Kiyokawa, E. (2012b). Suppression of Rac1 activity
at the apical membrane of MDCK cells is essential for cyst structure mainte-
nance. EMBO Rep. 13, 237–243.
Yoshizaki, H., Ohba, Y., Kurokawa, K., Itoh, R.E., Nakamura, T., Mochizuki, N.,
Nagashima, K., andMatsuda,M. (2003). Activity of Rho-family GTPases during
cell division as visualized with FRET-based probes. J. Cell Biol. 162, 223–232.
![Page 13: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/13.jpg)
Cell Reports, Volume 6
Supplemental Information
The Rac-FRET Mouse Reveals
Tight Spatiotemporal Control of Rac Activity
in Primary Cells and Tissues
Anna-Karin E. Johnsson, Yanfeng Dai, Max Nobis, Martin J. Baker, Ewan J. McGhee,
Simon Walker, Juliane P. Schwarz, Shereen Kadir, Jennifer P. Morton, Kevin B. Myant,
David J. Huels, Anne Segonds-Pichon, Owen J. Sansom, Kurt I. Anderson, Paul
Timpson, and Heidi C.E. Welch
![Page 14: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/14.jpg)
Figure S1, related to Figure 1 Johnsson et al. Generation of the Rac-FRET mouse strain
B
fl/+ +/+
1.5 2.0 2.5 3.0
0.6
0.8 1.0
0.4
floxed allele
C D
6.5
9.4
23
4.3
floxed allele
Wt allele
fl/+ +/+
9.4
23
6.5
floxed allele
Wt allele
fl/+ +/+
E floxed allele
Cre-deleted Rac-FRET Ki allele
0.6 0.8 1.0
0.4
0.6 0.8 1.0
0.4
fl/fl Ki/fl Ki/Ki
A
![Page 15: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/15.jpg)
Supplemental p3
Legend for Figure S1, related to Figure 1. Generation of the Rac-FRET mouse strain.
(A) Schematic of Rac-FRET mouse strain generation. Raichu-Rac, consisting of YFP, the CRIB domain of
Pak, Rac1, CFP, and the K-Ras CAAX box, was modified to introduce a Kozak translation initiation
sequence at its 5’ end and cloned into the STOP-eGFP-ROSA26TV targeting vector. The vector backbone
was removed and the targeting insert consisting of the 5’ recombination arm, a splicing acceptor site
(SA, white diamond), the loxP-flanked (black triangles) Neomycin resistance (Neo, N)/STOP cassette
(STOP, S), Raichu-Rac, and the 3’ recombination arm was electroporated into ES cells. Neomycin-
resistant ES clones were submitted to a PCR screen (B) and positive clones subjected to Southern
blotting (C and D) to confirm the correct insertion into the ROSA26 genomic locus, using 5’ and 3’
Southern probes outside of the targeted region and making use of the fact the targeting introduced new
EcoR1 and EcoR5 sites. The position of the 5’ and 3’ probes (white boxes) and sizes of restriction
fragments are to scale. Once germline transmission had been achieved, the resulting Rac-FRETfl/fl strain
was crossed with ‘deleter’, a Cre recombinase expressing strain for ubiquitous deletion of loxP-flanked
sequences. After excision of the Neomycin resistance/STOP cassette, which was monitored by PCR (E),
the Cre recombinase allele was crossed out again through selective breeding, resulting in the Rac-Fret
mouse strain.
(B) PCR screen of ES cells. Neomycin-resistant ES clones were submitted to a PCR screen for the
presence of the floxed allele using a forward primer upstream of the 5’ recombination arm and a reverse
primer within the splice acceptor site. Clones that yielded the expected 1356 bp PCR product were
further subjected to Southern blotting.
(C) Southern blot of EcoR1-digested Wt and targeted ES cell genomic DNA with 5’ probe.
(D) Southern blot of EcoR5-digested Wt and targeted ES cell genomic DNA with 3’ probe.
![Page 16: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/16.jpg)
Supplemental p4
(E) PCR screen of mouse biopsies for the presence of floxed and cre-deleted Rac-FRET Ki alleles. Primers
are listed in Supplemental Experimental Procedures.
![Page 17: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/17.jpg)
Figure S2, related to Figure 2 Johnsson et al. Normal function and morphology of Rac-FRET MEFs
A B
C
D E
24 48 72 96 Hours in culture
0
5
10
15
20 M
EFs
/ ml (
x 10
5 )
ME
Fs (%
)
Rac-FRETfl/fl
Rac-FRET
Rac-FRETfl/fl Rac-FRET
- + - + PDGF 0
20
40
60
80
100
ME
Fs /
cate
gory
(%)
a
b
c d
GTP- Rac1
Rac1
Rac-FRETfl/fl Rac-FRET
- + - + PDGF
Rac
-GTP
(% o
f tot
al)
0
0.2
0.4
0.6 p=0.06 p=0.04
phospho-p38MAPK
p38MAPK
Rac-FRETfl/fl Rac-FRET
- + - + PDGF
Pho
spho
-p38
MA
PK
(AU
)
0
20
40
60
80
100 p=0.04 p=0.08
i ii b a
10 µm
10 µm
10 µm
10 µm
d c
![Page 18: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/18.jpg)
Supplemental p6
Legend for Figure S2, related to Figure 2. Normal function and morphology of Rac-FRET MEFs.
(A) Rac-FRET MEF numbers increase during culture at the same rate as those from Rac-FRETKi/fl and Rac-
FRETfl/fl littermates, and cell death is low throughout. Numbers of living (filled symbols) and dead MEFs
(open symbols) from Rac-FRET (circle), Rac-FRETfl/fl (triangle) and Rac-FRETKi/fl (crosses) littermate E13.5
embryos after culture for the indicated periods of time. Data are mean ± SEM of n>6 embryos/genotype
from 3 timed matings. Statistics are 2-way Anova.
(B) Proliferation rates and proportions of apoptotic cells in exponentially growing cultures of Rac-FRET
and Rac-FRETfl/fl littermate MEFs are comparable. Rac-FRET (gray) or Rac-FRETfl/fl (black) MEFs from
littermate E13.5 embryos were propidium-idodine stained and their stages in cell cycle analysed by flow
cytometry. n≥5 embryos/genotype from 5 matings. Paired t-test showed non-significance.
(C) Serum-starved Rac-FRET MEFs display normal morphologies (lamellipodia, peripheral or dorsal
ruffles and spreading) and normal PDGF-dependent stimulation of dorsal ruffling. Serum-starved Rac-
FRET or Rac-FRETfl/fl MEFs were stimulated with or without 50 ng/ml PDGF for 5 min, fixed, TRITC-
phalloidin stained, and their basal or ‘active Rac’ morphologies assessed by fluorescence microscopy. (i)
Photos show representative cell morphologies (a) basal, (b) lamellipodia and edge ruffles, (c) dorsal
ruffles and (d) spreading. (ii) Scoring of >1000 cells per condition for morphologies as in (i).
(D) Raichu-Rac expression does not affect endogenous Rac1 activity in Pak-CRIB pull down assays with
Rac-FRET MEFs. GTP-loading of endogenous Rac1 is normal in Rac-FRET MEFs. Pak-CRIB pull down assays
in total lysates of Rac-FRET (Rac-FRETKi/Ki) and Rac-FRETfl/fl MEFs from littermate E13.5 embryos grown on
glass slides, serum-starved and stimulated with 50 ng/ml PDGF for 5 min. 20 % of the pull down and 2%
of the total lysate samples loaded per lane. Data are mean Rac activity ± SEM of 4 independent
experiments. Statistics are paired two-tailed t-test.
![Page 19: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/19.jpg)
Supplemental p7
(E) Basal and PDGF-stimulated p38MAPK phosphorylation is normal in Rac-FRET MEFs. Total lysates from
Rac-FRET (Rac-FRETKi/Ki) or Rac-FRETfl/fl MEFs prepared as in (D) were western blotted for phospho- and
total p38MAPK. Data are mean p38MAPK phosphorylation ± SEM relative to unstimulated Rac-FRETfl/fl from 3
independent experiments. Statistics are paired two-tailed t-test.
![Page 20: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/20.jpg)
Figure S3, related to Figures 3 and 4 Johnsson et al. Normal Rac-FRET neutrophil responses
B D C
E F G
A i ii iii iv
RO
S pr
oduc
tion
(AU)
Time (min)
Unprimed TNFα-primed
**
***
No. o
f cel
ls p
er fi
eld
of v
iew
![Page 21: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/21.jpg)
Supplemental p9
Figure S3, related to Figures 3 and 4. Normal Rac-FRET neutrophil responses.
(A) Isolated Rac-FRET neutrophils mount a normal ROS response to the GPCR ligand fMLP, both with or
without prior TNFα priming, and to PMA, whereas Rac2-/- neutrophils, used as controls, showed the
expected defects. (i), Representative kinetic traces of ROS production by fMLP-stimulated WT and Rac-
FRET neutrophils. (ii-iv), Total ROS production, determined as area under the curve, upon stimulation
with 10 µM fMLP (ii), priming with 500U/ml TNFα for 45 min prior to fMLP stimulation (iii), or
stimulation with 500 nM PMA (iv). Data are mean % of the stimulated WT response. For WT and Rac-
FRET, n = mean ± SEM of 4 individual experiments in (ii) and (iii) and 3 in (iv). For Rac2-/-, n = mean ± SEM
of 3 experiments in (ii) and (iii) and 2 (± range) in (iv). Difference from WT was calculated by one-sample
t-test and considered significant at *p<0.05.
(B) Rac-FRET neutrophils adhere normally to glass or the integrin ligand pRGD, whereas Rac2-/-
neutrophils show the expected defects. Mean number of WT or Rac-FRET cells per field of view that
adhered to uncoated or pRGD-coated glass coverslips within 15 min, determined by image analysis as
detailed in Supplemental Experimental Procedures, from n = 3 (± SEM) individual experiments for WT
and Rac-FRET, or 2 (± range) for Rac2-/-.
(C) Rac-FRET neutrophils spread normally under basal and fMLP-stimulated conditions, whereas Rac2-/-
neutrophils show the expected defects. Rac-FRET neutrophils spread normally on pRGD coated
coverslips. Mean cell area of neutrophils that had been spreading on pRGD-coated coverslips for 15 min,
determined by image analysis as detailed in Supplemental Experimental Procedures, from n = 3 (± SEM)
individual experiments for WT and Rac-FRET, or 2 (± range) for Rac2-/-.
(D) Rac-FRET neutrophils undergo normal basal migration and fMLP-stimulated chemotaxis in transwell
assays, whereas Rac2-/- cells show the expected lack of motility. Basal and 3µM fMLP stimulated
migration of WT, Rac-FRET or Rac2-/- bone marrow leukocytes through 3 µm transwell filters within 40
![Page 22: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/22.jpg)
Supplemental p10
min; number of migrated neutrophils determined post-assay by flow cytometry and expressed as % of
total neutrophils in n=2 experiments ± range. Statistics are one-way ANOVA with Dunnett’s post hoc
test; difference form Wt considered signify cant at p<0.05.
(E) Endogenous Rac1 activity (GTP-loading) is normal in fMLP-stimulated Rac-FRET neutrophils. WT and
Rac-FRET neutrophils were stimulated for 10s with 10 µM fMLP followed by pull down of active Rac
using Pak-CRIB sepharose and Rac1 western blotting. Top: GTP-loading of Rac1 was determined by
densitometric analysis of western blots and expressed as % of total Rac1; n = mean (± SEM) of 4
experiments. Statistics are Student’s t-test; difference from WT not significant. Bottom: representative
Rac1 western blots of pull down samples (GTP) and 2% of the total lysate controls (Total). GTPγS was
used as a positive control for GTP-loading.
(F) Endogenous Rac2 activity (GTP-loading) is normal in fMLP-stimulated Rac-FRET neutrophils.
Experiments as in (E), but with Rac2 western blotting.
(G) The Rac target p38MAPK shows normal levels of phosphorylation in fMLP-stimulated Rac-FRET
neutrophils. WT or Rac-FRET neutrophils were stimulated with 0.3 or 1 µM fMLP and total cell lysates
subjected to phospho-p38MAPK and total p38 western blots. Levels of phospho-p38 were determined by
densitometry and compared to total p38 for loading. Top: Phospho-p38MAPK as % of unstimulated WT.
N=mean (± SEM) of 3 experiments. Statistics are Student’s t-test; difference from WT not significant.
![Page 23: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/23.jpg)
Figure S4, related to Figure 4 Johnsson et al. High Rac activity correlates with protrusion formation at the leading edge and oscillates between the front and back of chemotaxing Rac-FRET neutrophils.
A B D
Inac
tive
Act
ive
C
G
Time (s)
Rac
act
ivity
(bac
kgro
und-
ad
just
ed F
RE
T ra
tio)
Max intensity Mean intensity
Rac
act
ivity
(%
diff
eren
ce fr
ont/b
ack)
F E 1.9
1.8
1.7
1.6
1.5
1.4
1.3
1.2
15
10
5
0 100 80 60 40 20 0 120
Control NSC23766
Mig
ratio
n m
ode
(%)
H 100
80
60
40
20
0
Non- directional
non-trans- locating
anti- directional
directional
directional
*
****
2.0
1.5
1.0
0
Rac
act
ivity
(FR
ET ra
tio)
Control NSC23766 Max Mean Max Mean
0.8
0.6
0.4
0.2
0 Perio
dici
ty o
f Rac
act
ivity
os
cilla
tions
(R2 )
Control NSC23766 Directed Other Directed Other
Not applic.
*
***
i ii iii
![Page 24: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/24.jpg)
Supplemental p12
Figure S4, related to Figure 4. High Rac activity correlates with protrusion formation at the leading
edge and oscillates between the front and back of chemotaxing Rac-FRET neutrophils.
(A) Rubber band plot of the cell outline (dark green = start; bright yellow = end) of the 20 time frames of
neutrophil chemotaxis shown in Figure 4A.
(B) Migration path (centre = start) of the 20 time frames shown in Figure 4A.
(C) Polar plot of the average Rac activity (FRET ratio; red = high, blue = low) around the cell perimeter of
41 cells from 4 independent chemotaxis experiments over 120s. For ratiometric FRET measurements:
increase in FRET ratio = increase in Rac activity.
(D) Average migration path of 41 cells as in (C) from 4 independent experiments over 120s.
(E) Schematic of QuimP nodes around the cell perimeter and 0.4 µm from the cell edge used to calculate
Pearson correlation between Rac activity and cell edge velocity of cells analysed in Figure 4D.
(F) Difference in Rac activity (FRET ratio) between the front and back of chemotaxing neutrophils as in
Figure 4F during stalling and protruding migration (paired T-test Rac activity at the front versus the back,
**p<0.005). No significant change in front/back ratio of Rac activity between protruding and stalling
phases of migration, despite the retrograde shift of peak Rac activity during stalling phases (Figure 4F).
(G) Rac activity oscillates between the front and the back of chemotaxing neutrophils. The maximum
and mean Rac activities (FRET ratios) along the central longitudinal axis of chemotaxing neutrophils as in
Figure 4G are plotted for each time-frame to allow a comparison of the spatial localization of the point
of highest Rac activity (Figure 4G) with the intensity of Rac activity for each 1s time frame.
(H) Chemotaxis, Rac activity and oscillations of Rac activity between the front and the back of migrating
neutrophils are inhibited by NSC23766 treatment. Rac-FRET neutrophils were subjected to chemotaxis
assays as in Figure 4 and above, except that they were pretreated for 5 min either in the presence or
absence of 75 µm NSC23766 and then assayed with or without the inhibitor. (i) NSC23766 inhibits
directional migration towards the chemoattractant. Migration of cells which showed any movement at
![Page 25: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/25.jpg)
Supplemental p13
all was categorised as directional migration towards the chemoattractant, non-directional, anti-
directional or non-translocating migration. Data is from 29 control and 47 NSC23766-treated cells. (ii)
The maximum and mean Rac activities (FRET ratios) along the central longitudinal axis of chemotaxing
neutrophils was assessed as in Figure S4G and the average of all time-frames plotted for the same
control and NSC23766-treated cells as in (i). (iii) The oscillations of Rac activity (FRET ratio) along the
central longitudinal axis of chemotaxing neutrophils are perturbed by NSC23766 treatment. Cells were
categorised into directionally migrating cells and cells without directional migration towards the
chemoattractant (non-directional, anti-directional or non-translocating) and analysed as in Figure 4G for
oscillations of Rac activity along the central longitudinal axis. Plotted are mean R2 values ± SEM which
depict the periodicity of these oscillations from 13 control cells, 4 directionally migrating NSC23766-
treated cells and 8 non-directionally migrating NSC23766-treated cells. Statistics are unpaired t-test.
![Page 26: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/26.jpg)
Figure S5, related to Figures 5-7 Johnsson et al. PMA stimulates Rac activity in skin explants of E15.5 K14-Cre Rac-FRETfl/fl mice
B
Fluo
resc
ence
life
time
(ns)
Time after PMA (min)
1.95
2.00
2.05
2.10
2.15
2.20
2.25
2.30
0 5 10 15 20 25 30
***
***
E15.5 K14-Cre Rac-FRETfl/fl skin ex vivo pre-PMA
E15.5 K14-Cre Rac-FRETfl/fl skin ex vivo post-PMA
Activ
e
In
activ
e 3.0
2.5
2.0
1.5
1.0
Activ
e
In
activ
e
3.0
2.5
2.0
1.5
1.0 50 μm
50 μm
A
![Page 27: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/27.jpg)
Supplemental p15
Figure S5, related to Figures 5-7. PMA stimulates Rac activity in skin explants of E15.5 K14-Cre Rac-
FRETfl/fl mice.
(A) Representative FLIM-FRET images of Rac activity in skin explants of E15.5 embryos from K14-Cre Rac-
FRETfl/fl mice which express Raichu-Rac selectively in keratinocytes, shown before (top panels) and after
(bottom panels) stimulation with 400 nM PMA for 30 min. For each pair of images, the left-hand panel
shows a representative fluorescence image of the skin explants expressing Raichu-Rac (blue), and the
right-hand panel shows a corresponding Rac activity (fluorescence lifetime) map. Insets show
enlargements of the cells in the boxed sections.
(B) Quantification of Rac activity in keratinocytes as in (A) upon PMA stimulation for up to 30 min. Mean
fluorescence lifetime ± SEM for 150 cells before and 40-60 cells for each time-point of PMA stimulation
in 4 different regions. *** p<0.001 by unpaired Student t- test.
![Page 28: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/28.jpg)
B
Fluo
resc
ence
life
time
(ns)
PMA
2.1
1.9
1.7
1.5
1.6
1.8
2.0
1.4 - +
*
Figure S6, related to Figures 5-7 Johnsson et al. Stimulation of Rac activity in in the liver by PMA treatment ex vivo.
Rac-FRET liver ex vivo post-PMA
Activ
e
In
activ
e
3.0
2.5
2.0
1.5
1.0
Rac-FRET liver ex vivo pre-PMA
Activ
e
In
activ
e
3.0
2.5
2.0
1.5
1.0 40 µm
40 µm
A
![Page 29: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/29.jpg)
Supplemental p17
Figure S6, related to Figures 5-7. Stimulation of Rac activity in in the liver by PMA treatment ex vivo.
(A) Representative FLIM-FRET images of Rac activity in the liver of Rac-FRET mice before (top panels) or
after (bottom panels) stimulation with 200 nM PMA for 15 min ex vivo. For each pair of images, the left-
hand panel shows a representative fluorescence image of the Rac-FRET mouse liver expressing Raichu-
Rac (blue) and the right-hand panel shows a corresponding Rac activity (fluorescence lifetime) map.
(B) Quantification of Rac activity (fluorescence lifetime; mean of 302 cells ± SEM before or after
treatment of the liver with PMA ex vivo. * p < 0.05, by unpaired Student t- test.
![Page 30: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/30.jpg)
Supplemental p18
Supplemental Movie Legends
Movie S1, related to Figure 2. Ratiometric FRET live-imaging of PDGF-stimulated primary Rac-FRET
MEFs. Ratiometric FRET live-imaging of Rac activity at lamellipodial protrusions and membrane ruffles of
PDGF stimulated (50 ng/ml) Rac-FRET MEFs; frames taken every 10s. The left panel shows the YFP-FRET
movie (CFP excitation, YFP emission filter), the middle panel the CFP movie, and the right panel the
resulting FRET ratio movie. The time of PDGF addition is denoted by an empty frame. The cell shown is
representative of 20 imaged under these conditions from 3 independent experiments. For ratiometric
FRET measurements: increase in FRET ratio = increase in Rac activity.
Movie S2, related to Figure 2. Ratiometric FRET live-imaging of Insulin-stimulated primary Rac-FRET
MEFs. Ratiometric FRET live-imaging of Rac activity at lamellipodial protrusions and membrane ruffles of
a section from a representative Insulin stimulated (100 µg/ml) Rac-FRET MEF; frames taken every 10s.
The left panel shows the YFP-FRET movie (CFP excitation, YFP emission filter), the middle panel the CFP
movie, and the right panel the resulting FRET ratio movie. The time of Insulin addition is denoted by an
empty frame. The cell shown is representative of 11 imaged under these conditions from 2 independent
experiments.
Movie S3, related to Figures 4 and S4. Ratiometric FRET live-imaging of primary Rac-FRET neutrophils
chemotaxing in an fMLP gradient. Ratiometric FRET live-imaging movie of a representative Rac-FRET
neutrophil chemotaxing towards 3 µM fMLP in an Ibidi chamber. Images were taken at 1s intervals over
101s. The chemoattractant was added before the start of imaging, and the chemoattractant source is
due-South of the movie.
![Page 31: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/31.jpg)
Supplemental p19
Movie S4, related to Figure 5. Multiphoton imaging of Rac-FRET mouse intestine. Ex vivo multiphoton
z-stack imaging of Rac-FRET mouse intestine to visualize the 3D-space investigated from the base of the
crypts towards the villi (0-150 µm). Raichu-Rac expression within the crypt is shown in blue (signal in
intestine of non Rac-FRET mice is negligible) and the corresponding host ECM content in red.
Movie S5, related to Figure 6. Multiphoton imaging of Rac-FRET mouse pancreas. Ex vivo multiphoton
z-stack imaging of Rac-FRET mouse pancreas to show the 3D-space investigated. Raichu-Rac expression
is shown in blue (signal in pancreas of non Rac-FRET mice is negligible) and host ECM in white.
Movie S6, related to Figure 7. Multiphoton imaging of mammary tumors of PyMT Rac-FRET mice. Ex
vivo multiphoton z-stack imaging (maximum projection) of PyMT Rac-FRET mouse mammary tumors to
show the 3D-space investigated. Raichu-Rac expression in the tumor is shown in blue (signal in breast
tumours of non Rac-FRET mice is negligible) and host ECM in white.
Movie S7, related to Figures 5-7 and S5. Multiphoton imaging of embryonic skin from K14-Cre Rac-
FRETfl/fl mice. Ex vivo multiphoton z-stack imaging (maximum projection) of keratinocytes in embryonic
skin from K14-Cre Rac-FRETfl/fl mice to show the 3D-space investigated. Expression of Raichu-Rac is
shown in blue (signal in embryonic skin of non Rac-FRET mice is negligible) and host ECM in white.
Movie S8, related to Figures 5-7 and S6. Multiphoton imaging of Rac-FRET mouse liver. Ex vivo
multiphoton z-stack imaging of Rac-FRET mouse liver to show the 3D-space investigated. Raichu-Rac
expression in the liver is shown in blue (signal in liver of non Rac-FRET mice is negligible) and host ECM
in red.
![Page 32: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/32.jpg)
Supplemental Experimental Procedures
Generation of the Rac-FRET reporter mouse strain:
Raichu-1011X plasmid (Itoh et al., 2002) encoding the original intra-molecular FRET reporter for Rac
activity (a gift from Michiyuki Matsuda, Kyoto, Japan) was modified by PCR to introduce an AscI
restriction site and Kozak translation initiation consensus sequence 5’ of the Raichu-Rac cassette, using
primers CACGGCGCGCCACCATGGTGAGCAAGGGCGAG and CTCTTTCTCGAGGGCGGCGGTC. The resulting
PCR fragment was digested with XhoI and ligated into EcoRI-digested Raichu-1011X that had been
treated with Klenow DNA polymerase to generate a blunt end and then digested further with XhoI. The
resulting modified Raichu-1011X plasmid was verified by sequencing.
To generate the Rac-FRET targeting vector, the AscI/Kozak-modified Raichu-1011X plasmid was
digested with SalI, treated with Klenow to generate a blunt end and then digested further with AscI. The
AscI/blunt restriction fragment was ligated into AscI/XmaI-digested STOP-eGFP-ROSA26TV vector
(Addgene 11739), a targeting vector originally generated by the Rajewsky lab (Sasaki et al., 2006) which
is widely used for ubiquitous gene expression from the endogenous ROSA26 promoter on mouse
chromosome 6 (Zambrowicz et al., 1997) and works on the principle that floxed genes become
expressed after Cre recombinase-mediated deletion of a neomycin resistance/STOP cassette that is
flanked by two loxP sites. The Rac-FRET targeting vector was digested with ApaLI to remove the vector
backbone, yielding a targeting fragment consisting of the 5’ recombination arm, a splice acceptor site,
the loxP-flanked neomycin resistance/STOP cassette, Raichu-Rac, and the 3’ recombination arm. The
purified targeting fragment was electroporated by the Babraham Gene Targeting Facility into C57Bl/6
Bruce4 ES cells. Neomycin-resistant ES clones were screened by PCR using primers upstream of the 5’
recombination arm (CCCACCGCCCCACACTTATTG) and within the splice acceptor site
(GACCGCGAAGAGTTTGTCCTCAAC). Genomic DNA from clones that yielded the expected 1356 bp PCR
Supplemental p20
![Page 33: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/33.jpg)
product was digested with EcoRI or EcoRV and subjected to Southern blotting to confirm recombination,
using 1 kb 5’ and 3’ probes that hybridised outside of the targeted region, making use of the introduced
EcoRI and EcoRV restriction sites.
ES cells from one positive clone were injected into albino C57Bl/6 blastocysts and the resulting
chimeras crossed with C57Bl/6 mice. After germline transmission, the resulting strain, called Rac-
FRETfl/fl, was crossed with ‘deleter’ strain which expresses Cre recombinase from the X chromosome for
ubiquitous excision of loxP-flanked sequences (Schwenk et al., 1995), to induce the ubiquitous
expression of Raichu-Rac by removal of the floxed neomycin resistance/transcriptional STOP cassette.
Finally, the Cre recombinase allele was crossed out again by selective breeding. The resulting
homozygous Rac-FRETKi/Ki knock-in (Ki) mouse strain was called Rac-FRET for brevity. We also trialled
drug-inducible expression of Raichu-Rac by crossing Rac-FRETfl/fl with Cre-ERT2 strain (Feil et al., 1996),
which inducibly expresses Cre-recombinase from the ROSA26 locus upon tamoxifen treatment, for
analysis of F1 generation Cre-ERT2 Rac-FRETfl mice.
Genotyping:
Genotyping of Rac-FRETfl/fl was routinely done by PCR, with a forward primer targeted 5’ of the splice
acceptor (GTCGCTCTGAGTTGTTATCAGTAAGGGAGC) and reverse primers in the Neo cassette of the
mutated allele (TCGCCTTCTATCGCCTTCTTGA) or in the Wt allele (AACCCCAGATGACTACCTATCCTCC),
resulting in 453 bp and 393 bp fragments, respectively. Genotyping of Rac-FRETKi/Ki (after Cre-mediated
excision of the Neo/STOP cassette) was done using the Rac-FRETfl/fl forward primer and a reverse primer
within the Pak-CRIB domain (GAAGCACTGCAGGCCGTA), yielding a 585 bp band. Breeding-out of the Cre
recombinase allele after excision of the Neo/STOP cassette was monitored using primers
TACCTGGCCTGGTCTGGACACAGTG and ATGGCTAATCGCCATCTTCCAGCAG, testing for the absence of the
350 bp Cre band.
Supplemental p21![Page 34: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/34.jpg)
Mouse husbandry:
Rac-FRET, Rac-FRETfl/fl and Rac2-/- (Roberts et al., 1999) strains were bred and housed in specific
opportunistic pathogen free isolators. C57Bl/6 mice from our Biological Services Breeding Unit (used as
Wt controls), Cre-ErT2 (Feil et al., 1996), and Cre-ErT2 Rac-FRETfl mice were bred and housed in
individually vented cages in a shower-in barrier facility. Rac-FRET mice were bred either from
heterozygous pairs (Rac-FRETKi/fl x Rac-FRETKi/fl) for generating Rac-FRETKi/Ki (Rac-FRET), Rac-FRETKi/fl and
Rac-FRETfl/fl littermates, or from homozygous Rac-FRET pairs, and both bred equally well. Tamoxifen-
injected Cre-ErT2 Rac-FRETfl/fl animals were housed in individually vented cages in a shower-in barrier
experimental facility. Mice were used at between 8-14 weeks of age and were sex- and age-matched
where possible. For treatment of animals used in FLIM-FRET imaging experiments, see each relevant
section. All animal work was carried out under the control of the British Home Office and the local
Animal Welfare and Experimental Ethics Committee.
Quantification of Raichu-Rac expression in Rac-FRET cells and tissues:
The expression level of Raichu-Rac protein in cells and tissues of the Rac-FRET mouse was determined
using standard curves of recombinant CFP and/or Rac1, as available Rac1 antibodies did not recognize
the Rac1 protein within the biosensor, presumably due to the deletion of the 16 most C-terminal
residues of Rac1 in the biosensor molecule. For multiple-tissue comparison, 2% w/v whole-tissue lysates
from adult Rac-FRET mice were prepared by rinsing isolated tissues/organs in PBS, finely mincing with a
razor blade on ice, boiling in 1.3x Laemmli sample buffer and trituration through 19 and then 25-gauge
needles. For determination of Raichu-Rac expression in primary neutrophils, freshly prepared bone-
marrow derived mature neutrophils were incubated with 7 mM DFP for 10 min at RT to prevent
proteolysis, washed twice in DPBS and boiled in SDS-sample buffer. For measuring Raichu-Rac
Supplemental p22![Page 35: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/35.jpg)
expression in primary mouse embryonic fibroblasts (MEFs; see below), Rac-FRET MEFs were cultured for
12 days post-isolation, washed twice in PBS, lysed in ice-cold lysis buffer (50 mM Tris, pH 7.4, 100 mM
NaCl, 1.2% NP-40, 10% glycerol, 2 mM MgCl2, 1 mM DTT, 0.1 mM PMSF, 10 µg/ml antipain, 10 µg/ml
aprotinin and 10 µg/ml leupeptin) for 10 min on ice, and lysates boiled in SDS-sample buffer. Lysates
were subjected to SDS-PAGE alongside protein standards of recombinant purified EE-Rac1 (Welch et al.,
2002) and CFP (MBL International) and western blotted with Rac1 (Millipore, 053989) and GFP (Santa
Cruz, SC-8334) antibodies. To quantify Raichu-Rac, fluorescence detection with Licor Biosciences goat
anti-rabbit 680RD (926-68071) and goat anti-mouse 800RD (926-32210) or standard ECL coupled with
ImageJ were used and blots analysed on the basis that our GFP antibody recognized YFP and CFP to
equal extent and that Rac1 and Rac2 are expressed at equal levels in neutrophils (Li et al., 2002).
Rac-FRET neutrophil isolation and responses:
Isolated bone-marrow derived mature neutrophils were used unless otherwise indicated. Neutrophils
were freshly isolated by Percoll Plus gradient for each experiment as described, either at RT (Lawson et
al., 2011; Welch et al., 2005) or 4°C (Ferguson et al., 2007) depending on the subsequent assay, typically
to a purity of 80- 90% as determined by May-Gruen-Giemsa staining of cytospins. Neutrophils adhesion
and spreading assays were performed on glass or integrin-ligand surfaces (Lawson et al., 2011), and ROS
formation determined by luminol assay (Lawson et al., 2011; Welch et al., 2005), as previously
described. Transwell chemotaxis assays were done with crude bone marrow cells and neutrophils
identified post-assay by flow cytometry, as described (Lawson et al., 2011; Welch et al., 2005). Ibidi
chamber chemotaxis assays were performed with Ibidi sticky slide IV0.4 coated with 10% mouse serum in
HBSS+ (HBSS with Ca2+ and Mg2+, 15 mM Hepes, pH7.4, all endotoxin free) for 30 min at RT and then
washed three times in HBSS+. Neutrophils were added to the channel at 2.5x107 cells/ml and, without
letting cells settle, 5 µl of 3µM fMLP containing 5x106/ml latex beads was added to one well of the slide
Supplemental p23
![Page 36: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/36.jpg)
while the same volume was aspirated from the opposing well immediately thereafter, forming a steep
and short-lived gradient. The latex beads were allowed to settle and were used as an indicator for the
area of steepest gradient, according to the manufacturer’s instructions (Ibidi application note 01).
Rac-FRET MEF isolation, culture and responses:
Rac-FRETKi/fl mice were timed-mated and E13.5 MEFs isolated by incubating diced tissue with 0.05%
trypsin-EDTA at 37°C for 25 min, triturating the cell suspension and passing it through 40 μm cell
strainers. MEFs were cultured in complete medium (DMEM, high glucose, with glutamine; Invitrogen],
10% batch-adjusted heat-inactivated FBS [PAA], 0.1 mM β-mercaptoethanol, 1unit/ml penicillin and
1μg/ml streptomycin) for up to four passages or 15 days. For cell proliferation assays, Rac-FRETfl/fl, Rac-
FRETKi/fl and Rac-FRET MEFs from littermate embryos at 3-5 days post-isolation were plated at
0.8x105/ml in triplicate in 12-well plates. After 24, 48, 72 or 96 h, cells were trypsinised, stained with
0.04% trypan blue/PBS, and counted by hematocytometer. For cell cycle assays, Rac-FRETfl/fl and Rac-
FRET MEFs from littermate embryos were grown overnight in 10 cm dishes at 3x106 cells/dish,
trypsinised, washed in PBS, fixed in ice-cold 70% ethanol/PBS on ice for 30 min, washed, stained with 50
µg/ml propidium iodide in PBS containing 0.1 mg/ml RNAse for 10 min at RT, and analysed by flow
cytometry. For cell morphology assays, Rac-FRETfl/fl and Rac-FRET MEFs from littermate embryos at 3-5
days post-isolation were plated onto sterile glass coverslips at 2x105/well in complete medium in 6-well
plates. After 24 h, MEFs were washed twice with DMEM and serum-starved overnight in DMEM/0.1%
fatty-acid free BSA before stimulation with 50 ng/ml PDGF-BB (Source Bioscience) for 5 min. Cells were
fixed in 4% paraformaldehyde in 50 mM Pipes, pH 6.8, 1 mM EGTA, 1 mM MgCl2 for 15 min at RT,
washed twice in PBS, permeabilised in PBS/0.1% Triton X100 for 10 min, and washed again. F-actin was
stained using 2 μg/ml TRITC-phalloidin in PBS for 1 h in the dark. Slides were washed in H2O and
mounted using AquaPolymount (PolySciences, 18606-20). Samples were blinded and imaged using a
Supplemental p24![Page 37: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/37.jpg)
Zeiss AxioImager. 10-12 photos were taken across the width of each coverslip and all cells scored for
basal or ‘active Rac’ morphologies (spreading, lamellipodia, peripheral and dorsal membrane ruffles).
Biochemical assays:
For Pak-CRIB assays in neutrophils, 1-2x107 Rac-FRET or Wt bone-marrow derived neutrophils/ml were
pre-warmed at 37°C in DPBS (with Ca2+ and Mg2+) and stimulated for 10s with 10 µM fMLP. The reaction
was stopped by addition of 5 vol ice -cold lysis buffer (see above). Cells were lysed on ice for 3 min,
insoluble material removed by centrifugation at 13,400 xg for 3 min at 4°C, and GTP-bound Rac isolated
using immobilised GST-Pak-CRIB as described (Welch et al., 2005), with 2% of the lysates being set aside
for monitoring total Rac levels. For measuring maximal cellular Rac activity, some total lysate samples
were complemented with 63 µM GTPγS and 10 mM EDTA and incubated at 30oC for 30 min, before
stopping the reaction by the addition of 60 mM MgCl2. Samples were western blotted with monoclonal
Rac1 (05-389, Millipore) or polyclonal Rac2 antibody (07-604, Millipore) and analysed using ImageJ. For
MEFs, 1x106 Rac-FRET or Rac-FRETfl/fl cells at 3-5 days post-isolation from littermate embryos were
grown on 57x64 mm glass slides (Agar Scientific, Stansted, UK) in complete medium for 24 h, serum-
starved overnight in DMEM/0.1% fatty-acid free BSA and stimulated for 5 min with 50 ng/ml PDGF.
Medium was aspirated, dishes transferred onto iced metal trays, cells scraped into 1 ml ice-cold lysis
buffer, incubated for 3 min, and insoluble material removed by centrifugation at 13,400 xg for 3 min at
4°C. Pak-CRIB pull down was performed as above and samples western blotted with monoclonal Rac1
antibody (05-389) and analysed by ImageJ. To measure p38MAPK phosphorylation, Rac-FRET and Wt
neutrophils were prepared as for Pak-CRIB assays, stimulated with 0.3 or 1 µM fMLP for 45 s, the
reaction stopped with 10 vol DPBS (with Ca2+ and Mg2+) and cells spun at 13,400 xg for 10s at 4°C. Ice-
cold anti-phosphatase lysis buffer (20 mM Tris pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton
X100, 2.5 mM sodium pyrophosphate, 1mM β-glycerophosphate, 1 mM sodium orthovanandate, 0.1
Supplemental p25
![Page 38: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/38.jpg)
mM PMSF, 10 µg/ml leupeptin and 10 µg/ml aprotinin) was added, samples incubated on ice for 3 min,
spun for 3 min as above, and the supernatant boiled in SDS-sample buffer. Western blots were
performed using phospho-p38MAPK and total p38MAPK antibodies (Cell Signalling 9211 and 9212). For
p38MAPK phosphorylation assays in Rac-FRET MEFs, samples were prepared as for Pak-CRIB assays and
analysed as for neutrophils.
Imaging and quantification of Rac activity in MEFs and neutrophils by ratiometric FRET analysis:
For Rac-FRET neutrophils and MEFs, all images were acquired using an Olympus Cell^R imaging system
comprising an Olympus IX81 microscope, Olympus 60×1.4 NA objective, Till Photonics Polychrome V
polychromator light source, Andor iXon EM CCD camera (Hamamatsu Orca ER used for MEF
experiments) and a Solent Scientific environment chamber to maintain 37°C. Wide-field epifluorescence
images were collected using 425 nm excitation with a 10 nm band width and two emission filters 483/32
for CFP and 542/27 for YFP with an exposure time of 500 ms. Sequential acquiring of images was used
for neutrophil spreading experiments and for MEFs, with pairs of images being acquired every 15s for
spreading neutrophils and every 10s for MEFs. For imaging of chemotaxing neutrophils, an OptoSplit II
Image splitter (Cairn Research Ltd, Faversham, UK) was used with an associated ImageJ plugin so that
both channels were acquired simultaneously at 1 frame/s. The CFP and YFP fluorescence intensity
images were background-subtracted and median-filtered (over a circle with a 2-pixel radius; ImageJ). A
pixel-by-pixel YFP/CFP ratio image was generated using Ratio-Plus plugin (created by Paulo Magalhães,
available from ImageJ), which allowed setting a cut-off for pixel intensity, thereby making it possible to
exclude weakly fluorescing pixels. The cut-off was chosen based on the histogram after background
subtraction, of an area devoid of cells.
Supplemental p26
![Page 39: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/39.jpg)
For imaging Rac-FRET MEFs, cells 5-10 days post-isolation were grown on 22 mm glass coverslips
for 24 h in complete medium, washed in PBS and serum-starved overnight in DMEM with 0.1% fatty-acid
free BSA. Imaging was begun before addition of stimulus, and an empty frame was inserted into the
movies to mark the time of addition of either 50 ng/ml PDGF or 100 µg/ml Insulin. CFP and YFP-FRET
(CFP excitation, YFP emission filter) videos were mean-filtered (radius of 1 pixel; ImageJ function which
mean-corrects each pixel to all adjacent pixels in a 3x3 square) and bleach-corrected using
(www.embl.de/eamnet/html/bleach_correction.html), and mean background pixel intensity was
subtracted with a clipping value of max-mean intensity. Rac activity was presented in pseudo-colours
using the ImageJ 16-colour scheme.
For analysing Rac activity in spreading and polarising neutrophils, the cells were added to a dish
containing coverslips and either HBSS with Ca2+/Mg2+ and Rac inhibitor NSC27633 or HBSS with
Ca2+/Mg2+ alone. Imaging commenced from the first point of contact of the cells with the coverslip
(without any preincubation period apart from the time it took the cells to settle onto the coverslips,
usually around 2 mins), and cells were manually kept in focus as they spread. For analysis, the average
FRET ratio for each frame was normalized to the average FRET ratio of the first image from the same
cell, and FRET ratio in NSC23766-treated cells was normalised to that in control cells. The timing of the
start of polarisation, the % of fully polarised cells, and the % of polarised cells reverting to non-polar
morphology were assessed by manually counting these events for all cells that were included in the
FRET ratio analysis.
Neutrophils chemotaxing towards 3 µM fMLP in an Ibidi chamber were imaged at a frame
interval of 1s and tracked using ImageJ plugin QuimP11 (www.warwick.ac.uk) to determine the speed of
movement between frames for a number of nodes on the cell perimeter and the maximal 3x3 FRET ratio
pixel intensity within a chosen distance, here 0.4 µm from the outer node. Nodes were grouped into 5%
bins for each frame, and FRET ratio compared up to 5s forwards and backwards in time with the speed
Supplemental p27
![Page 40: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/40.jpg)
of protrusion or retraction. Pearson correlation was used to analyse the time-dependence between Rac
activity and speed of cell edge movement. Schematic cell traces displaying cell outlines at times T and
T+1s were generated using QuimP11. Polar plots (Ferguson et al., 2007) were used for spatiotemporal
representation of Rac activity at the cell perimeter, with the circumference of the cell represented as a
circle and time represented as excentric circles from the centre outwards. In addition, line scans were
performed along the longitudinal axis of chemotaxing neutrophils each 1s and the pixel with the highest
Rac activity along this line determined for each frame. De-noising was applied to the raw image using
NDSAFIR software (Boulanger et al., 2010). From this, the periodicity of the Rac activity signal shifting
longitudinally throughout the cell over time was calculated using Fourier transformation.
3D intestinal crypt cultures and freshly isolated crypts for ex vivo FLIM-FRET imaging of Rac activity:
Intestinal crypts were cultured as described (Sato et al., 2009). In short, crypts from the Rac-FRET mouse
were purified by incubating the small intestine in 2 mM EDTA for 30 min in cold PBS. After several
washes, crypts were embedded in 20 µl/well growth-factor reduced Matrigel (BD Bioscience) and plated
in a 24-well plate. Each well contained 0.5 ml Advanced DMEM/F12 (Life Technologies) supplemented
with N2 and B27 (Life Technologies). In addition, Noggin (100 ng/ml, Peprotech), EGF (50 ng/ml,
Peprotech) and R-spondin1 (500 ng/ml, R&D Systems) were added and renewed every other day. 3D
crypts were passaged every 7 days and allowed to grow for 4 days after passaging prior to multiphoton
based FLIM-FRET imaging of Rac activity at depths of 0-100 µm in response to stimulation with 200 nM
phorbol 12-myristate 13-acetate (PMA) (Sigma-Aldrich) for up to 90 min. Ex vivo FLIM-FRET imaging of
Rac activity (see below) in freshly isolated crypts (Myant et al., 2013) was performed from the base of
crypts towards the villi at depths of 0-150 µm.
Supplemental p28
![Page 41: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/41.jpg)
Vil-Cre-ERT2 APCfl/fl Rac-FRET mice for in vivo FLIM-FRET imaging of Rac activity at the base of intestinal
crypts following APC loss:
Vil-Cre-ERT2 APCfl/fl mice (el Marjou et al., 2004; Myant et al., 2013; Sansom et al., 2007) were crossed to
the Rac-FRET mouse to generate Vil-Cre-ERT2 APCfl/fl Rac-FRET mice. Recombination of the APC allele was
induced with 1 intraperitoneal (ip) injection of 80 mg/kg tamoxifen per day for 4 days. Tamoxifen-
induced Vil-Cre-ERT2 Rac-FRET mice were used as controls. Analysis was performed on day 4 after
induction (Myant et al., 2013). To permit FLIM imaging, intestinal tissue was treated with 50 mg/ml (-)-
scopolamine-N-butylbromide for 10 min to minimise peristalsis. Tissue was maintained on a 37°C heated
stage.
KPC Rac-FRET mice for ex vivo and in vivo FLIM-FRET imaging of Rac activity in pancreatic tumours:
For imaging of Rac activity in pancreatic tumours, the Rac-FRET mouse was crossed to the Kras+/G12D
Trp53+/ R172H Pdx1-Cre (KPC) mouse model of pancreatic cancer in which Pdx1-Cre targets tissue specific
expression of active KrasG12D and mutant p53R172H to the pancreas (Hingorani et al., 2005), resulting in
invasive and metastatic pancreatic ductal adenocarcinoma which recapitulates the pathology of the
human disease (Heid et al., 2011; Hruban et al., 2006; Morton et al., 2010; Muller et al., 2009; Muller et
al., 2013; Olive and Tuveson, 2006; Tan et al., 2013). KPC Rac-FRET mice were used at 138, 145 and 156
days of age (average 146), control mice without induction of K-RasG12D and p53R172H expression at 113,
209 and 113 days (average 145); all were on mixed C57Bl6/FvB genetic background. For ex vivo imaging,
the pancreas was dissected out and FLIM-FRET imaged immediately (see below) within a 2-3h period.
PyMT Rac-FRET mice for ex vivo and in vivo FLIM-FRET imaging of Rac activity in mammary tumours:
The Rac-FRET mouse was crossed with the locally invasive Polyoma-middle T (PyMT) breast cancer
model (Guy et al., 1992) to monitor whether NSC23766-dependent inhibition of Rac activity could be
Supplemental p29
![Page 42: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/42.jpg)
observed in the tumors. PyMT Rac-FRET mice on mixed C57Bl6/FvB genetic background were aged
between 80-120 days, with tumours forming after ~40-50 days. Primary tumours were FLIM-FRET
imaged (see below) ex vivo 14-21 days after formation within 2-3h after being dissected out. In vivo
imaging was done as described below.
K14-Cre Rac-FRET mice for tissue-specific expression of Raichu-Rac and ex vivo FLIM-FRET imaging of Rac
activity in embryonic skin:
Rac-FRETfl/fl mice were crossed with K14-Cre strain (Dassule et al., 2000) to induce tissue-specific
expression of Raichu-Rac in the skin. The experimental set up for ex vivo imaging of Rac activity in the
skin of embryos homozygous for Rac-FRET was as described (Mort et al., 2010). Briefly, a section of skin
from the back of E15.5 K14-Cre Rac-FRET embryos was removed, placed epidermis side-down onto a
glass-bottomed dish and covered with a nuclepore membrane (Whatman). Growth Factor Reduced
Matrigel (BD bioscience) was applied to the top to immobilize the sample and incubated for 10 min at
37°C, followed by the addition of culture medium (phenol red-free DMEM with HEPES (GIBCO), 10% FBS,
penicillin, streptomycin). For PMA treatment, 400 nM was added directly to the culture medium for 0-30
min prior to FLIM-FRET imaging.
Multiphoton FLIM-FRET imaging and analysis of Rac activity as fluorescence lifetime:
To permit in vivo imaging, mice were terminally anesthetized using 1:1 hypnorm-H2O + 1:1 hypnovel-
H2O as described (Abdel-Latif et al., 2005; McGhee et al., 2011; Timpson et al., 2011), before being
restrained on a 37°C heated stage and the respective tissue (pancreas, breast, liver or intestine) being
surgically exposed. Where indicated, NSC23766 (Tocris Bioscience) was administered by ip injection
(4mg/kg) (Myant et al., 2013) and Rac activity assessed over 90 min.
Multiphoton-excited FLIM-FRET measurements were conducted using typical scan parameters
Supplemental p30
![Page 43: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/43.jpg)
of 150×150 μm field of view over 512×512 pixels scanned at 400 Hz with the acquisition of 100 frames.
Pixel dwell time was 5 µs with a total acquisition time of approximately 120s. Typical laser power as
measured at the sample plane was ~30 mW. Control and tumour tissues expressing Raichu-Rac could be
imaged at depths of up to 150 μm. Imaging was carried out on a Nikon Eclipse TE2000-U inverted
microscope with an Olympus long working distance 20×0.95 NA water immersion lens. The excitation
source used was a Ti:Sapphire (Cameleon) femtosecond pulsed laser, operating at 80 MHz and tuned to
a wavelength of 830 nm. A scan head specifically designed for multiphoton excitation was used (Trim-
scope, LaVision Biotec, Germany) to control beam scanning and data acquisition. Non-descanned
detectors (NDD) were used (Hamamatsu H6780-01-LV 1M for <500 nm detection and H6780-20-LV 1M
for >500 nm detection), located at the back focal plane of the objective. A dichroic filter (Chroma 455
nm DCXR) was used to spectrally separate the second harmonic generated signal, when present, from
the CFP emission of the Rac-FRET mouse. Band pass filters (Semrock 470/40 and Chroma 500 nm LP)
were used to further filter the emission for the CFP channel. For the measurement of fluorescence
excited state lifetime, a 16-anode PMT (FLIMx16, LaVision Biotec, Germany) was used in a time-
correlated single photon counting (TCSPC) scheme. Detector array sped-up data acquisition by enabling
detection of multiple photons per excitation event. The increased photon count rate enabled accurate
lifetime to be measured in situations not previously accessible in vivo. The TCSPC detector was used
with a gain setting of 250 (0-255 full range) and configured with 75 time bins, each of which were 0.04
ns wide, based on the 80 MHz repetition rate of the laser as described (McGhee et al., 2011; Nobis et al.,
2013; Timpson et al., 2011).
Raw data was analyzed using the built-in TCSPC fluorescence lifetime analysis functionality of
ImSpectorPro (LaVison Biotec, Germany). Single exponential fit with offset was performed on
fluorescence decay data from specific regions and lifetime fit recorded. Statistically significant
differences were assessed by unpaired Student's t-test on multiple data sets. Lifetime maps were also
Supplemental p31
![Page 44: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/44.jpg)
produced using ImspectorPro, where single exponential fit was performed for each pixel across the time
bins spanning the peak to the end of decay. An intensity threshold was applied with the value set to the
average background pixel value for the summed data set. A 3x3 smoothing operation was performed on
the raw data while calculating the FLIM map. A standard rainbow colour look up table with the limits
between 0 and 3.0 ns, 1 and 3.0 ns or 0 and 4 ns, as stated, was used to display all FLIM maps for ease of
comparison between individual tissue types and activation states. In the lifetime colour maps, low basal
Rac activity is represented as warm yellow/red colours, while high Rac activity is represented as blue,
and areas of low signal to noise ratio in which an accurate lifetime measurement could not be achieved
are black. A 5x5 median filter was applied to Tau maps.
Supplemental p32
![Page 45: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/45.jpg)
Supplemental References
Abdel-Latif, D., Steward, M., and Lacy, P. (2005). Neutrophil primary granule release and maximal superoxide generation depend on Rac2 in a common signalling pathway. Can. J. Physiol. Pharmacol. 83, 69-75.
Boulanger, J., Kervrann, C., Bouthemy, P., Elbau, P., Sibarita, J.B., and Salamero, J. (2010). Patch-based nonlocal functional for denoising fluorescence microscopy image sequences. IEEE Trans. Med. Imaging 29, 442-454.
Dassule, H.R., Lewis, P., Bei, M., Maas, R., and McMahon, A.P. (2000). Sonic hedgehog regulates growth and morphogenesis of the tooth. Development 127, 4775-4785.
el Marjou, F., Janssen, K.P., Chang, B.H., Li, M., Hindie, V., Chan, L., Louvard, D., Chambon, P., Metzger, D., and Robine, S. (2004). Tissue-specific and inducible Cre-mediated recombination in the gut epithelium. Genesis 39, 186-193.
Feil, R., Brocard, J., Mascrez, B., LeMeur, M., Metzger, D., and Chambon, P. (1996). Ligand-activated site-specific recombination in mice. Proc. Nat. Acad. Sci. U. S. A. 93, 10887-10890.
Ferguson, G.J., Milne, L., Kulkarni, S., Sasaki, T., Walker, S., Andrews, S., Crabbe, T., Finan, P., Jones, G., Jackson, S., et al. (2007). PI(3)Kγ has an important context-dependent role in neutrophil chemokinesis. Nat. Cell Biol. 9, 86-91.
Guy, C.T., Cardiff, R.D., and Muller, W.J. (1992). Induction of mammary tumors by expression of polyomavirus middle T oncogene: a transgenic mouse model for metastatic disease. Mol. Cell. Biol. 12, 954-961.
Heid, I., Lubeseder-Martellato, C., Sipos, B., Mazur, P.K., Lesina, M., Schmid, R.M., and Siveke, J.T. (2011). Early requirement of Rac1 in a mouse model of pancreatic cancer. Gastroenterology 141, 719-730, 730 e711-717.
Hingorani, S.R., Wang, L., Multani, A.S., Combs, C., Deramaudt, T.B., Hruban, R.H., Rustgi, A.K., Chang, S., and Tuveson, D.A. (2005). Trp53R172H and KrasG12D cooperate to promote chromosomal instability and widely metastatic pancreatic ductal adenocarcinoma in mice. Cancer Cell 7, 469-483.
Hruban, R.H., Adsay, N.V., Albores-Saavedra, J., Anver, M.R., Biankin, A.V., Boivin, G.P., Furth, E.E., Furukawa, T., Klein, A., Klimstra, D.S., et al. (2006). Pathology of genetically engineered mouse models of pancreatic exocrine cancer: consensus report and recommendations. Cancer Res. 66, 95-106.
Supplemental p33
![Page 46: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/46.jpg)
Itoh, R.E., Kurokawa, K., Ohba, Y., Yoshizaki, H., Mochizuki, N., and Matsuda, M. (2002). Activation of rac and cdc42 video imaged by fluorescent resonance energy transfer-based single-molecule probes in the membrane of living cells. Mol. Cell. Biol. 22, 6582-6591.
Lawson, C., Donald, S., Anderson, K., Patton, D., and Welch, H. (2011). P-Rex1 and Vav1 cooperate in the regulation of fMLF-dependent neutrophil responses. J. Immunol. 186, 1467-1476.
Li, S., Yamauchi, A., Marchal, C.C., Molitoris, J.K., Quilliam, L.A., and Dinauer, M.C. (2002). Chemoattractant-stimulated Rac activation in wild-type and Rac2-deficient murine neutrophils: preferential activation of Rac2 and Rac2 gene dosage effect on neutrophil functions. J. Immunol. 169, 5043-5051.
McGhee, E.J., Morton, J.P., Von Kriegsheim, A., Schwarz, J.P., Karim, S.A., Carragher, N.O., Sansom, O.J., Anderson, K.I., and Timpson, P. (2011). FLIM-FRET imaging in vivo reveals 3D-environment spatially regulates RhoGTPase activity during cancer cell invasion. Small GTPases 2, 239-244.
Mort, R.L., Hay, L., and Jackson, I.J. (2010). Ex vivo live imaging of melanoblast migration in embryonic mouse skin. Pigment Cell Melanoma Res. 23, 299-301.
Morton, J.P., Timpson, P., Karim, S.A., Ridgway, R.A., Athineos, D., Doyle, B., Jamieson, N.B., Oien, K.A., Lowy, A.M., Brunton, V.G., et al. (2010). Mutant p53 drives metastasis and overcomes growth arrest/senescence in pancreatic cancer. Proc. Nat. Acad. Sci. U. S. A. 107, 246-251.
Muller, P.A., Caswell, P.T., Doyle, B., Iwanicki, M.P., Tan, E.H., Karim, S., Lukashchuk, N., Gillespie, D.A., Ludwig, R.L., Gosselin, P., et al. (2009). Mutant p53 drives invasion by promoting integrin recycling. Cell 139, 1327-1341.
Muller, P.A., Trinidad, A.G., Timpson, P., Morton, J.P., Zanivan, S., van den Berghe, P.V., Nixon, C., Karim, S.A., Caswell, P.T., Noll, J.E., et al. (2013). Mutant p53 enhances MET trafficking and signalling to drive cell scattering and invasion. Oncogene 32, 1252-1265.
Myant, K.B., Cammareri, P., McGhee, E.J., Ridgway, R.A., Huels, D.J., Cordero, J.B., Schwitalla, S., Kalna, G., Ogg, E.L., Athineos, D., et al. (2013). ROS production and NF-kappaB activation triggered by RAC1 facilitate WNT-driven intestinal stem cell proliferation and colorectal cancer initiation. Cell Stem Cell 12, 761-773.
Nobis, M., McGhee, E.J., Morton, J.P., Schwarz, J.P., Karim, S.A., Quinn, J., Edward, M., Campbell, A.D., McGarry, L.C., Evans, T.R., et al. (2013). Intravital FLIM-FRET imaging reveals dasatinib-induced spatial control of src in pancreatic cancer. Cancer Res. 73, 4674-4686.
Supplemental p34
![Page 47: Cell Reports ResourceWe generated a Rac activity reporter mouse strain by intro-ducing the extensively validated intramolecular Raichu-Rac FRET biosensor (Itoh et al., 2002) into the](https://reader033.vdocuments.us/reader033/viewer/2022052009/601f5deaff4c0c644b0d2e41/html5/thumbnails/47.jpg)
Olive, K.P., and Tuveson, D.A. (2006). The use of targeted mouse models for preclinical testing of novel cancer therapeutics. Clinical cancer research : an official journal of the American Association for Cancer Res. 12, 5277-5287.
Roberts, A.W., Kim, C., Zhen, L., Lowe, J.B., Kapur, R., Petryniak, B., Spaetti, A., Pollock, J.D., Borneo, J.B., Bradford, G.B., et al. (1999). Deficiency of the Hematopoietic Cell-Specific Rho Family GTPase Rac2 Is Characterized by Abnormalities in Neutrophil Function and Host Defense. Immunity 10, 183-196.
Sansom, O.J., Meniel, V.S., Muncan, V., Phesse, T.J., Wilkins, J.A., Reed, K.R., Vass, J.K., Athineos, D., Clevers, H., and Clarke, A.R. (2007). Myc deletion rescues Apc deficiency in the small intestine. Nature 446, 676-679.
Sasaki, Y., Derudder, E., Hobeika, E., Pelanda, R., Reth, M., Rajewsky, K., and Schmidt-Supprian, M. (2006). Canonical NF-kappaB activity, dispensable for B cell development, replaces BAFF-receptor signals and promotes B cell proliferation upon activation. Immunity 24, 729-739.
Sato, T., Vries, R.G., Snippert, H.J., van de Wetering, M., Barker, N., Stange, D.E., van Es, J.H., Abo, A., Kujala, P., Peters, P.J., et al. (2009). Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature 459, 262-265.
Schwenk, F., Baron, U., and Rajewsky, K. (1995). A cre-transgenic mouse strain for the ubiquitous deletion of loxP-flanked gene segments including deletion in germ cells. Nucl. Acids Res. 23, 5080-5081.
Tan, E.H., Morton, J.P., Timpson, P., Tucci, P., Melino, G., Flores, E.R., Sansom, O.J., Vousden, K.H., and Muller, P.A. (2013). Functions of TAp63 and p53 in restraining the development of metastatic cancer. Oncogene. Published online. doi 10.1038/onc.2013.287.
Timpson, P., McGhee, E.J., Morton, J.P., von Kriegsheim, A., Schwarz, J.P., Karim, S.A., Doyle, B., Quinn, J.A., Carragher, N.O., Edward, M., et al. (2011). Spatial regulation of RhoA activity during pancreatic cancer cell invasion driven by mutant p53. Cancer Res. 71, 747-757.
Welch, H.C., Coadwell, W.J., Ellson, C.D., Ferguson, G.J., Andrews, S.R., Erdjument-Bromage, H., Tempst, P., Hawkins, P.T., and Stephens, L.R. (2002). P-Rex1, a PtdIns(3,4,5)P3- and Gβγ-regulated guanine-nucleotide exchange factor for Rac. Cell 108, 809-821.
Welch, H.C., Condliffe, A.M., Milne, L.J., Ferguson, G.J., Hill, K., Webb, L.M., Okkenhaug, K., Coadwell, W.J., Andrews, S.R., Thelen, M., et al. (2005). P-Rex1 regulates neutrophil function. Curr. Biol. 15, 1867-1873.
Zambrowicz, B.P., Imamoto, A., Fiering, S., Herzenberg, L.A., Kerr, W.G., and Soriano, P. (1997). Disruption of overlapping transcripts in the ROSA beta geo 26 gene trap strain leads to widespread expression of beta-galactosidase in mouse embryos and hematopoietic cells. Proc. Nat. Acad. Sci. U. S. A. 94, 3789-3794.
Supplemental p35