cell-free expression of unnatural amino acid incorporated...

Research ArticleCell-Free Expression of Unnatural Amino AcidIncorporated Aquaporin SS9 with Improved SeparationPerformance in Biomimetic Membranes

PeilianWei1 Bingjia Zhuang2 Daoyong Yu3 Aziza Sharipova1 Jin Cai2 Lei Huang2

Jiazhang Lian 2 and Zhinan Xu 2

1School of Biological and Chemical Engineering Zhejiang University of Science amp Technology Hangzhou 310023 China2College of Chemical and Biological Engineering Zhejiang University Hangzhou 310027 China3College of Chemical Engineering China University of Petroleum (East China) Qingdao 266580 China

Correspondence should be addressed to Jiazhang Lian jzlianzjueducn and Zhinan Xu znxuzjueducn

Received 29 March 2018 Revised 29 July 2018 Accepted 6 September 2018 Published 27 September 2018

Academic Editor Sherry L Mowbray

Copyright copy 2018 Peilian Wei et al This is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Aquaporins (AQPs) are widely applied in biomimetic membranes for water recycling and desalination In this study a novelaquaporin was isolated from Photobacterium profundum SS9 (AQP SS9) which showed high water permeability and potential forpractical water purification applications To improve the stability of the AQP SS9 embedded biomimetic membranes a modifiedAQP SS9 was obtained by incorporation of an unnatural amino acid (p-propargyloxyphenylalanine pPpa) (P-AQP SS9) in vitrousing amutatedMethanocaldococcus jannaschii tyrosyl-tRNA synthetase (TyrRS) and the cell-free expression systemThemodifiedAQP SS9 can covalently link with phospholipids and hence significantly improve the stability of biomimetic membranes Theconcentration of Mg2+ and fusion expression with signal peptides were evaluated to enhance the expression level of P-AQP SS9resulting in a highest yield of 49 mgL The modified AQP SS9 was then reconstituted into DOPC liposomes and analyzed bya stopped-flow spectrophotometer The obtained water permeability coefficient (Pf ) of 746times10

minus4 ms was 57 times higher thanthat of proteoliposomes with the wild-type AQP SS9 (Pf=131times10

minus4 ms) and 121 times higher than that of the DOPC liposomes(Pf=615times10

minus5ms) This study demonstrates the development of a cell-free system for the expression of membrane proteins withmuch higher stability and the potential application of the modified aquaporins for water filtration

1 Introduction

Aquaporins belong to a large family of water-channel pro-teins and the so-called orthodox aquaporins (AQPs) possesshighly defined nanoscale pores to allow water molecules torapidly pass through while retaining the dissolved soluteseffectively [1] The incorporation of AQPs into the lipidbilayer could enhance the permeability of reconstitutedbilayer by an order of magnitude while the high retentionof solutes was still maintained [2] Such ideal separationproperties of aquaporins have led to an intensive interest insynthesizing aquaporin based high-performance biomimeticmembranes especially for desalination applications [3 4]

Considering the high osmotic pressure and salinity con-ditions in practical applications AQPs from the barophilic

bacteria could be suitable and promising candidates forthe fabrication of biomimetic membranes Photobacteriumprofundum SS9 was isolated from Sulu Trough amphipodliving in 2550 meters undersea [5 6] and has been classi-fied as a moderate barophilic bacterium [7] Therefore theaquaporin from P profundum SS9 (AQP SS9) should havecertain advantages in resisting high hydrostatic pressure highsalinity and some other extreme conditions inwater filtrationand desalination applications

The tyrosyl-tRNA synthetase (TyrRS) from Methano-caldococcus jannaschii and its corresponding tRNA(MjTyrRSMjtRNATyr) have been found to be able to identifythe amber codon (TAG) and transport tyrosine [8] Furtherstudy [9] showed that the mutated MjTyrRSMjtRNATyr

could transport certain unnatural amino acids to the TAG

HindawiBioMed Research InternationalVolume 2018 Article ID 3560894 7 pageshttpsdoiorg10115520183560894

2 BioMed Research International

p-propargyloxyphenylalanine

Aminoacyl-tRNA synthetase mRNA

Ribosome

Stop codon UAG

Peptide chain

Translation

AQP SS9 pPpa

Modified phospholipids membrane

Cross-link

Figure 1 Schematic diagram of genetic incorporation of pPpa into AQP SS9

Table 1 Primers used in this study

Primers SequenceAQP SS9TAG-F 51015840-gtggctgaattcattggcacatAGtggttagtatAGgggggttgtgg-31015840

AQP SS9TAG-R 51015840-ccacaacccccCTatactaaccaCTatgtgccaatgaattcagccac-31015840

dsbAsp-AQP-F 51015840-catgccatggcaatgaaaaagatttggctggcgctggctggtttagttttagcgtttagcgcatcggcgatgtcagttatcacaccatatc-31015840

malEsp-AQP-F51015840-

catgccatggcaatgaaaataaaaacaggtgcacgcatcctcgcattatccgcattaacgacgatgatgttttccgcctcggctctcgccatgtcagttatcacaccatatc-31015840

ompAsp-AQP-F 51015840-catgccatggcaatgaaaaagacagctatcgcgattgcagtggcactggctggtttcgctaccgtagcgcaggccatgtcagttatcacaccatatc-31015840

ompCsp-AQP-F 51015840-catgccatggcaatgaaagttaaagtactgtccctcctggtcccagctctgctggtagcaggcgcagcaaacgctatgtcagttatcacaccatatc-31015840

pelBsp-AQP-F 51015840-catgccatggcaatgaaatacctattgcctacggcagccgctggattgttattactcgctgcccaaccagcgatggccatgtcagttatcacaccatatc-31015840

phoAsp-AQP-F 51015840-catgccatggcaatgaaacaaagcactattgcactggcactcttaccgttactgtttacccctgtgacaaaagccatgtcagttatcacaccatatc-31015840

SP-AQP-R 51015840-cgggatccttattaatgatgatgatgatgatgatcttcgtttggaca-31015840

Note mutation sites for unnatural amino acid incorporation were capitalized the upstream signal peptide sequences and downstream His6-tag wereunderlined and the restriction sites were italicized

codon of a target gene thereby enhancing the performanceof protein stabilizing protein structure and even generatingnew functions More than 90 unnatural amino acids havebeen site-specifically incorporated into a variety of proteinsvia the gene coding technology [8]

In this study AQP SS9 was firstly phylogeneticallycharacterized as an orthodox aquaporin Then an unnatu-ral amino acid was introduced into AQP SS9 which canlink covalently with phospholipids to improve the stabilityof the biomimetic membranes As shown in Figure 1 astop codon TAG has been introduced into the expressionvector pIVEX24c-AQP SS9 via site-directed mutagenesisand the mutated M jannaschii TyrRS could catalyze theaminoacylation of tRNA with the unnatural amino acid p-propargyloxyphenylalanine (pPpa)Then pPpa incorporatedAQP SS9 (P-AQP SS9) was efficiently expressed in theEscherichia coli derived cell-free system Finally P-AQP SS9and AQP SS9 incorporated proteasomes were constructedand their separation performance (water permeability) wascomparedThe system with modified AQP SS9 showedmuchhigher water permeability demonstrating the potential forpractical applications in wastewater treatment and seawaterdesalination

2 Materials and Methods

21 Strains and Plasmids E coli DH5120572 was used for plasmidconstruction and E coli BL21 (DE3) (Novangen USA) as thehost for making cell-free extract pIVEX24c (Roche Gren-zacherstrasse Switzerland) was used to construct cell-freeexpression vectors pIVEX24c-AQP SS9 pETDuet-CK-T7pUC-MjtRNA p15a-MjpPpaRS and pIVEX24c-MjpPpaRSwere constructed in our previous studies

22 Reagents Restriction endonucleases LA Taq DNA poly-merase and T4 DNA ligase were purchased from TakaraCompany (Dalian China) All primers for PCR amplificationwere synthesized by Sangon Biotech (Shanghai China) CoLtd and listed in Table 1 The unnatural amino acid p-propargyloxyphenylalanine (pPpa) was provided by AmatekChemical Company Western-blot reagents were purchasedfrom Beyotime Biotechnology (Shanghai China)

23 Vector Construction The amber mutations wereintroduced into the sites of F35TAG and L39TAG of AQPSS9 using the primer set AQP SS9TAG-FAQP SS9TAG-R with pIVEX24c-AqpSS9 as the template resulting in

BioMed Research International 3

dsbAsp (periplasmic protein disulphide isomerase I)Met Lys Lys Ile Trp Leu Ala Leu Ala Gly Leu Val Leu Ala Phe Ser Ala Ser AlamalEsp (maltose transporter subunit)Met Lys Ile Lys Thr Gly Ala Arg Ile Leu Ala Leu Ser Ala LeuThrThr Met Met Phe Ser Ala Ser Ala Leu AlaompAsp (outer membrane protein A)Met Lys Lys Thr Ala Ile Ala Ile Ala Val Ala Leu Ala Gly Phe Ala Thr Val Ala Gln AlaompCsp (outer membrane protein C)Met Lys Val Lys Val Leu Ser Leu Leu Val Pro Ala Leu Leu Val Ala Gly Ala Ala Asn AlapelBsp (pectate lyase B precursor)Met Lys Tyr Leu Leu ProThr Ala Ala Ala Gly Leu Leu Leu Leu Ala Ala Gln Pro Ala Met AlaphoAsp (alkaline phosphatase)Met Lys Gln Ser Thr Ile Ala Leu Ala Leu Leu Pro Leu Leu PheThr Pro Val Thr Lys Ala

Box 1 Signal peptides used in this study to enhance the expression of AQP SS9 in cell-free system The peptidase cleavage sites Ala-X-Alawere underlined

the construction of pIVEX24c-AQP SS9TAG As signalpeptides (sp) were found to enhance the expressionlevel of target proteins in cell-free system [10] six fusionexpression plasmids including pIVEX24c-pelBsp-AQPSS9TAG pIVEX24c-ompCsp-AQP SS9TAG pIVEX24c-ompAsp-AQP SS9TAG pIVEX24c-malEsp-AQP SS9TAGpIVEX24c-dsbAsp-AQP SS9TAG and pIVEX24c-phoAsp-AQP SS9TAG were constructed The expression of themutated AQP SS9 with different signal peptides includingdsbAsp (GenBank ID BAL40432) malEsp (GenBank IDBAL40591) ompAsp (GenBank ID BAL38095) ompCsp(GenBank ID BAL39006) pelBsp (GenBank ID AAA24848)and phoAsp (GenBank ID BAL37591) was carried outaccording to the previously reported method [11] The signalpeptide sequences were predicted using the Signal PeptideDatabase (httpprolinebicnusedusgspdbindexhtml)(Box 1)

24 Expression and Purification of Proteins Using E coliDerived Cell-Free Expression System Two plasmids pUC-MjtRNA and p15a-MjpPpaRS were cotransformed into E coliBL21 (DE3) which was used for the preparation of cell-freeextracts following a previously reported protocol [12] Thecell-free extracts were stored at -80∘C for future use The Ecoli cell-free expression system was set up accordingly withminor modifications [11 12] The unnatural amino acid pPpawas prepared as a stock solution of 50mM and supplementedto the cell-free system at a final concentration of sim045 mMunless specifically mentioned 1 Brij58 was supplemented tothe reaction mixture for soluble expression of the membraneproteinThe cell-free reactionmixture was shaken at 400 rpmand 37∘C (thermostatmetal bath) for 4 h and then centrifugedat 12000 g for 10 min The resulting supernatant was diluted5 times with column buffer (20 mM Tris-HCl pH 78 300mM NaCl 10 mM imidazole 005 Brij-78) and mixed with1 mL Ni2+-NTA resin and then shaken at 4∘C and 120 rpmfor additional 1 h After rinsed with 5 mL column buffer thetarget proteinwas elutedwith 1mLwash buffer (MOPS-KOHpH 75 300 mM imidazole 005 Brij-78)

25 Preparation of AQP SS9 and P-AQP SS9 ProteoliposomesTo prepare AQP derived proteoliposome 100 120583gmL AQP

SS9 or P-AQP SS9 4 mgmL DOPC liposome and 025Triton X-100 (mv) [13] were mixed and shaken at 25∘C 120rpm for 30 min Then 02 gmL SM-2 Bio-Beads (Sigma StLouis MO USA) were added to the mixture and shaken foradditional 2 h The reaction mixture was ultracentrifuged at300000 g and 4∘C for 15min and the precipitateswerewashedand resuspended with MOPS-KOH buffer (100 mM pH 75)to get the AQP SS9 or P-AQP SS9 proteoliposomes

26 Water Permeability Assay of Reconstituted P-AQP SS9Proteoliposomes Thewater permeability of DOPC liposomeAQP SS9 proteoliposome and P-AQP SS9 proteoliposomewas measured by light scattering at 436 nm 500 V and25∘C using a stopped-flow spectrophotometer (SFM-300BioLogic) [14] An equal volume of liposome or proteoli-posome solution (100 120583gmL) and hypertonic solution (100mM MOPS-KOH pH 75 400 mM NaCl) was mixed andmeasured under the reported conditions [15]

3 Results

31 Phylogenetic Analysis of AQP SS9 Due to the lack ofexperimental data a phylogenetic analysis was performedto study the evolutionary origins and the potential solutetransport properties [16] Some known bacterial orthodoxaquaporins and aquaglyceroporins as well as an animal(AQP1) and a plant (TIP) aquaporin were aligned usingClustal Omega [17] and included in the phylogenetic tree Asshown in Figure 2 AQP SS9 showed the highest homologywith the E coli AqpZ [18] which has been characterized asan orthodox aquaporin andwas not included in the aquaglyc-eroporin branch of the phylogenetic treeTherefore based onthe phylogenetic analysis AQP SS9 belongs to the orthodoxaquaporin subfamily of water-channel proteins which shouldtransport water molecules efficiently and specifically

32 Design of Unnatural Amino Acid Incorporation in AQPSS9 As the crystal structure of AQP SS9 has not beenreported yet the E coli AqpZ with similar structure andhigh homology was selected for evaluation Based on mul-tiple sequence alignment (MSA) and analysis of the trans-membrane region of AqpZ by TMHMM as well as the


TIP

MgaGlpF

MgeGlpF

BsGlpF

EcGlpF

AQP1

6083AqpZ

EcAqpZ

AQP SS9

Figure 2 Phylogenetic analysis of AQP SS9 The amino acid sequences of aquaporin homologs were aligned and the phylogenetic treewas constructed TIP a plant aquaporin (NCBI Accession Number P258181) MgaGlpFMycoplasma gallisepticum aquaglyceroporin (NCBIAccession Number ADC309621) MgeGlpF Mycoplasma genitalium aquaglyceroporin (NCBI Accession Number AAC712491) BsGlpFBacillus subtilis aquaglyceroporin (NCBI Accession Number AOT514221) EcGlpF E coli aquaglyceroporin (NCBI Accession NumberNP 4183621) AQP1 an animal aquaporin (NCBI Accession Number P299723) 6083AqpZ Synechocystis sp PCC6803 aquaporin Z (NCBIAccession Number P738091) EcAqpZ E coli aquaporin Z (NCBI Accession Number NP 4153961)

P-AQP SS9 Dimer

MjpPpaRS

P-AQP SS9 Monomer

2 3 4 5 6 7 81kDa

49

35

25

Figure 3 Western-blot analysis of pPpa incorporated AQP SS9 Lane 1 pellet without pPpa Lane 2 supernatant without pPpa Lane 3 pelletwith 2 120583L pPpa Lane 4 supernatant with 2 120583L pPpa Lane 5 pellet with 4 120583L pPpa Lane 6 supernatant with 4 120583L pPpa Lane 7 pellet withpPpa and pIVEX24c-MjpPpaRS Lane 8 supernatant with pPpa and pIVEX24c-MjpPpaRS

polarity of unnatural amino acids F35 and L39 of AQP SS9were chosen as the optimal sites for unnatural amino acidincorporation

33 Optimization of the Expression of pPpa IncorporatedP-AQP SS9 The pIVEX24c-AqpSS9TAG carrying ambermutations was expressed in E coli cell-free expression systemunder different conditions P-AQP SS9 expression could notbe detected neither in the soluble nor in the insoluble frac-tions without the addition of pPpa (Figure 3 Lane 1 and Lane2) while the supplementation of 2 120583L pPpa (sim045mM) led tothe expression of P-AQP SS9 (Figure 3 Lane 3 and Lane 4)These results indicated that MjpPpaRSMjtRNA in the cell-free expression system could recognize the stop codon TAGand specifically incorporate pPpa intoAQP SS9 Since furtherincrement of pPpa up to 4 120583L could not improve the amountof the recombinant protein (Figure 3 Lane 5 and Lane 6) 2 120583LpPpa was set as the optimal amount for subsequent studiesAlthough MjpPpaRS has already been overexpressed in thecell-free extracts supplementation of pIVEX24c-MjpPpaRSfurther increased the production of P-AQP SS9 (Figure 3Lane 7 and Lane 8) indicating that the amount of MjpPpaRSwas the bottleneck for efficient incorporation of pPpa into

the recombinant proteinNotably in agreementwith previousstudies all the membrane proteins were expressed as theinsoluble form in the cell-free system (Figure 3) To enablesoluble expression of P-AQPSS9 1Brij58was supplementedinto the cell-free system in the following studies

In addition the effect of Mg2+ on the expression of P-AQP SS9 was also investigated Varied concentration ofMg2+(110 138 165 192 220 and 248mM)was added to the cell-free expression systemWestern-blot analysis showed that thehighest expression level of P-AQP SS9 was achieved with 220mM of Mg2+ while very low level of protein expression wasobserved when Mg2+ concentration was beyond the rangefrom 110 mM to 220 mM (Figure 4)

34 Fusion Expression of P-AQP SS9 with Different SignalPeptides The fusion of signal peptide at the N-terminushas been found to increase the expression level of recom-binant proteins in cell-free system [11] Therefore multiplesignal peptides including dsbAsp malEsp ompAsp ompCsppelBsp and phoAsp were chosen to further enhance theexpression of P-AQP SS9 Among six signal peptides testeddsbAsp enhanced the expression of P-AQPSS9 up to 49mgLwhich was two times higher than that without any signal


P-AQP SS9

110 138 165 192 220 248[Mg+] (mM)

Figure 4 Effects of varied concentration of Mg2+ on AQP SS9 expression in cell-free system

P-AQP SS9 Dimer

P-AQP SS9 Monomer

1kDa 8765432

49

35

25

Figure 5 Effect of fusion expression of P-AQP SS9 with different signal peptides Lane 1 pIVEX24c-AQP SS9TAG Lane 2 pIVEX24c-dsbAsp-AQP SS9TAG Lane 3 pIVEX24c-malEsp-AQP SS9TAG Lane 4 pIVEX24c-ompAsp-AQP SS9TAG Lane 5 pIVEX24c-ompCsp-AQP SS9TAG Lane 6 pIVEX24c-pelBsp-AQP SS9TAG Lane 7 pIVEX24c-phoAsp-AQP SS9TAG Lane 8 negative control without thesupplementation of any AQP SS9 expression plasmid

000 005 010 015 020 025 03000

02

04

06

08

10

DOPC liposomeAQP SS9 proteoliposomeP-AQP SS9 proteoliposome

Nor

mal

ized

ligh

t sig

nal

Time (s)

k=166 sminus Pf =615times-ms

k= sminus Pf =times-ms


Figure 6 Water permeability of AQP SS9 and P-AQP SS9 proteoliposomes by stopped-flow spectrometer

peptide (Figure 5) Interestingly signal peptides pelBsp andphoAsp decreased the expression level of P-AQP SS9 to 11mgL

35 Water Permeability of P-AQP SS9 Reconstituted Proteoli-posomes The two types of proteoliposomes with AQP SS9and P-AQP SS9 were individually prepared and analyzed forits water permeabilityThe Pf of P-AQP SS9 proteoliposomesAQP SS9 proteoliposomes and control empty liposomeswere 746times10minus4ms 131times10minus4ms and 615times10minus5ms respec-tively (Figure 6) The water permeable rate of P-AQP SS9proteoliposomes was 57 times higher than that of AQPSS9 proteoliposomes both of which were much higher thanthat of the empty liposomes Thus the modified P-AQP SS9presented better water filtration activity compared with thewild-type AQP SS9

4 Discussion

The AQPs incorporated biomimetic membranes havedemonstrated better water permeability and salt rejectionability [19] but the low strength and poor integrity ofthe membranes are the biggest challenges for practicalapplications To solve these defects we have successfullyincorporated pPpa into AQP SS9 to achieve the covalent-linkbetween the membrane proteins and the phospholipidsbilayer In this case the strength and integrity of AQPembedded biomimetic membrane could be enhanced

Considering the impact of unnatural amino acids on the3D structure and water permeability of AQPs as well as thecross linking efficiency between AQPs and phospholipidsthe type of unnatural amino acid and its incorporation sitesin AQP SS9 should be rationally designed Based on the


modeling studies of AqpZ which is highly homologous toAQP SS9 the active sites and phospholipids-linking regionsof AQP SS9 were avoided for amino acid substitution andfinally F35TAG and L39TAG were selected as the mutationsites On the other hand since the covalent cross-link ofacetylene group and phospholipids may improve the proteinstability in the membrane pPpa was chosen as the targetunnatural amino acid to be incorporated into AQP SS9

To achieve our engineering goal theM jannaschii TyrRSmutant constructed in our previous studies was used forthe synthesis of corresponding aminoacyl-tRNA and thestop codon TAG was specifically introduced into the AQPSS9 gene by site-directed mutagenesis Then E coli cell-freeexpression system containing the engineered TyrRS couldspecifically incorporate pPpa into the F35TAG and L39TAGsites of AQP SS9 The expression level of P-AQP SS9 in cell-free system was further improved through the optimizationof theMg2+ concentration (220mM) and the fusion of signalpeptide (dsbAsp) resulting in the production of 49 mgL P-AQP SS9

To characterize the obtained P-AQP SS9 and explore itspossible applications P-AQP SS9 was reconstituted into lipo-somes and biomimetic membranes The water permeabilityfactor (Pf ) of P-AQP SS9 liposomes was 746times10minus4 ms 57and 121 times higher than that of natural AQP SS9 andDOPCliposomes respectively

5 Conclusion

In this study the M jannaschii TyrRS mutant was used toincorporate the unnatural amino acid pPpa into AQP SS9(P-AQP SS9) via the E coli cell-free expression system Theexpression level of P-AQP SS9 in cell-free system was furtherimproved by optimizingMg2+ concentration and fusing witha signal peptide Subsequent analyses showed that the waterpermeability of P-AQP SS9 had been significantly improvedcompared with that of AQP SS9

Data Availability

The data used to support the findings of this study areavailable from the corresponding author upon request

Conflicts of Interest

The authors declare that they have no conflicts of interest

Acknowledgments

Weappreciate Prof ZhiningWang (Key Laboratory ofMarineChemistry Theory and Technology Ministry of EducationOcean University of China China) for the great help inaquaporin activity assays This work was financially sup-ported by National Natural Science Foundation of China(Nos 21606205 21576232 21506185 and 21276226) andthe Natural Science Foundation of Zhejiang Province (NoLY18B060002)

References

[1] TWalz B L SmithM L Zeidel A Engel and P Agre ldquoBiolog-ically active two-dimensional crystals of aquaporin CHIPrdquoTheJournal of Biological Chemistry vol 269 no 3 pp 1583ndash15861994

[2] M J Borgnia D Kozono G Calamita P C Maloney and PAgre ldquoFunctional reconstitution and characterization of AqpZthe E coli water channel proteinrdquo Journal of Molecular Biologyvol 291 no 5 pp 1169ndash1179 1999

[3] M Kumar M Grzelakowski J Zilles M Clark and W MeierldquoHighly permeable polymeric membranes based on the incor-poration of the functional water channel protein Aquaporin ZrdquoProceedings of the National Acadamy of Sciences of the UnitedStates of America vol 104 no 52 pp 20719ndash20724 2007

[4] C Y Tang Y Zhao R Wang C Helix-Nielsen and A G FaneldquoDesalination by biomimetic aquaporin membranes Review ofstatus and prospectsrdquo Desalination vol 308 pp 34ndash40 2013

[5] E F Delong and A A Yayanos ldquoAdaptation of the membranelipids of a deep-sea bacterium to changes in hydrostatic pres-surerdquo Science vol 228 no 4703 pp 1101ndash1103 1985

[6] E F Delong and A A Yayanos ldquoBiochemical function andecological significance of novel bacterial lipids in deep-seaprocaryotesrdquo Applied and Environmental Microbiology vol 51no 4 pp 730ndash737 1986

[7] C Kato andD H Bartlett ldquoThemolecular biology of barophilicbacteriardquo Extremophiles vol 1 no 3 pp 111ndash116 1997

[8] C C Liu and P G Schultz ldquoAdding new chemistries to thegenetic coderdquo Annual Review of Biochemistry vol 79 pp 413ndash444 2010

[9] A Deiters and P G Schultz ldquoIn vivo incorporation of analkyne into proteins in Escherichia colirdquoBioorganicampMedicinalChemistry Letters vol 15 no 5 pp 1521ndash1524 2005

[10] J-H Ahn M-Y Hwang K-H Lee C-Y Choi and D-MKim ldquoUse of signal sequences as an in situ removable sequenceelement to stimulate protein synthesis in cell-free extractsrdquoNucleic Acids Research vol 35 no 4 article no e21 2007

[11] X Zhang J Lian L Kai LHuang P Cen andZ Xu ldquoEnhancedfunctional expression of aquaporin Z via fusion of in situcleavable leader peptides in Escherichia coli cell-free systemrdquoEnzyme and Microbial Technology vol 55 pp 26ndash30 2014

[12] T-W Kim J-W Keum I-S Oh C-Y Choi C-G Park andD-M Kim ldquoSimple procedures for the construction of a robustand cost-effective cell-free protein synthesis systemrdquo Journal ofBiotechnology vol 126 no 4 pp 554ndash561 2006

[13] X Li RWang FWicaksana C Tang J Torres and A G FaneldquoPreparation of high performance nanofiltration (NF) mem-branes incorporated with aquaporin Zrdquo Journal of MembraneScience vol 450 pp 181ndash188 2014

[14] Y Zhao A Vararattanavech X Li et al ldquoEffects of proteolipo-some composition and draw solution types on separation per-formance of aquaporin-based proteoliposomes Implicationsfor seawater desalination using aquaporin-based biomimeticmembranesrdquo Environmental Science amp Technology vol 47 no3 pp 1496ndash1503 2013

[15] B Hang J Pan D Ni et al ldquoHigh-level production ofaquaporin Z in Escherichia coli using maltose-binding pro-teinpolyhistidine dual-affinity tag fusion systemrdquo Process Bio-chemistry vol 51 no 5 pp 599ndash606 2016

[16] G Calamita B Kempf K E Rudd et al ldquoThe aquaporin-Zwater channel gene of Escherichia coli Structure organization


and phylogenyrdquo Biology of the Cell vol 89 no 5-6 pp 321ndash3291997

[17] F Sievers A Wilm D Dineen et al ldquoFast scalable generationof high-quality protein multiple sequence alignments usingClustal Omegardquo Molecular Systems Biology vol 7 article 5392011

[18] G Calamita W R Bishai G M Preston W B Guggino andP Agre ldquoMolecular cloning and characterization of AqpZ awater channel from Escherichia colirdquo The Journal of BiologicalChemistry vol 270 no 49 pp 29063ndash29066 1995

[19] Y-X Shen P O Saboe I T Sines M Erbakan and M KumarldquoBiomimetic membranes A reviewrdquo Journal of MembraneScience vol 454 pp 359ndash381 2014

Hindawiwwwhindawicom

International Journal of

Volume 2018

Zoology

Hindawiwwwhindawicom Volume 2018

Anatomy Research International

PeptidesInternational Journal of



Journal of Parasitology Research

GenomicsInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom Volume 2013Hindawiwwwhindawicom

The Scientific World Journal

Volume 2018


BioinformaticsAdvances in

Marine BiologyJournal of



Neuroscience Journal


BioMed Research International

Cell BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawiwwwhindawicom Volume 2018


Genetics Research International


Advances in

Virolog y Stem Cells International



Enzyme Research



MicrobiologyHindawiwwwhindawicom

Nucleic AcidsJournal of

Volume 2018

Submit your manuscripts atwwwhindawicom


p-propargyloxyphenylalanine

Aminoacyl-tRNA synthetase mRNA

Ribosome

Stop codon UAG

Peptide chain

Translation

AQP SS9 pPpa

Modified phospholipids membrane

Cross-link

Figure 1 Schematic diagram of genetic incorporation of pPpa into AQP SS9

Table 1 Primers used in this study

Primers SequenceAQP SS9TAG-F 51015840-gtggctgaattcattggcacatAGtggttagtatAGgggggttgtgg-31015840

AQP SS9TAG-R 51015840-ccacaacccccCTatactaaccaCTatgtgccaatgaattcagccac-31015840

dsbAsp-AQP-F 51015840-catgccatggcaatgaaaaagatttggctggcgctggctggtttagttttagcgtttagcgcatcggcgatgtcagttatcacaccatatc-31015840

malEsp-AQP-F51015840-

catgccatggcaatgaaaataaaaacaggtgcacgcatcctcgcattatccgcattaacgacgatgatgttttccgcctcggctctcgccatgtcagttatcacaccatatc-31015840

ompAsp-AQP-F 51015840-catgccatggcaatgaaaaagacagctatcgcgattgcagtggcactggctggtttcgctaccgtagcgcaggccatgtcagttatcacaccatatc-31015840

ompCsp-AQP-F 51015840-catgccatggcaatgaaagttaaagtactgtccctcctggtcccagctctgctggtagcaggcgcagcaaacgctatgtcagttatcacaccatatc-31015840

pelBsp-AQP-F 51015840-catgccatggcaatgaaatacctattgcctacggcagccgctggattgttattactcgctgcccaaccagcgatggccatgtcagttatcacaccatatc-31015840

phoAsp-AQP-F 51015840-catgccatggcaatgaaacaaagcactattgcactggcactcttaccgttactgtttacccctgtgacaaaagccatgtcagttatcacaccatatc-31015840

SP-AQP-R 51015840-cgggatccttattaatgatgatgatgatgatgatcttcgtttggaca-31015840

Note mutation sites for unnatural amino acid incorporation were capitalized the upstream signal peptide sequences and downstream His6-tag wereunderlined and the restriction sites were italicized

codon of a target gene thereby enhancing the performanceof protein stabilizing protein structure and even generatingnew functions More than 90 unnatural amino acids havebeen site-specifically incorporated into a variety of proteinsvia the gene coding technology [8]

In this study AQP SS9 was firstly phylogeneticallycharacterized as an orthodox aquaporin Then an unnatu-ral amino acid was introduced into AQP SS9 which canlink covalently with phospholipids to improve the stabilityof the biomimetic membranes As shown in Figure 1 astop codon TAG has been introduced into the expressionvector pIVEX24c-AQP SS9 via site-directed mutagenesisand the mutated M jannaschii TyrRS could catalyze theaminoacylation of tRNA with the unnatural amino acid p-propargyloxyphenylalanine (pPpa)Then pPpa incorporatedAQP SS9 (P-AQP SS9) was efficiently expressed in theEscherichia coli derived cell-free system Finally P-AQP SS9and AQP SS9 incorporated proteasomes were constructedand their separation performance (water permeability) wascomparedThe system with modified AQP SS9 showedmuchhigher water permeability demonstrating the potential forpractical applications in wastewater treatment and seawaterdesalination

2 Materials and Methods

21 Strains and Plasmids E coli DH5120572 was used for plasmidconstruction and E coli BL21 (DE3) (Novangen USA) as thehost for making cell-free extract pIVEX24c (Roche Gren-zacherstrasse Switzerland) was used to construct cell-freeexpression vectors pIVEX24c-AQP SS9 pETDuet-CK-T7pUC-MjtRNA p15a-MjpPpaRS and pIVEX24c-MjpPpaRSwere constructed in our previous studies

22 Reagents Restriction endonucleases LA Taq DNA poly-merase and T4 DNA ligase were purchased from TakaraCompany (Dalian China) All primers for PCR amplificationwere synthesized by Sangon Biotech (Shanghai China) CoLtd and listed in Table 1 The unnatural amino acid p-propargyloxyphenylalanine (pPpa) was provided by AmatekChemical Company Western-blot reagents were purchasedfrom Beyotime Biotechnology (Shanghai China)

23 Vector Construction The amber mutations wereintroduced into the sites of F35TAG and L39TAG of AQPSS9 using the primer set AQP SS9TAG-FAQP SS9TAG-R with pIVEX24c-AqpSS9 as the template resulting in









3 Results




TIP

MgaGlpF

MgeGlpF

BsGlpF

EcGlpF

AQP1

6083AqpZ

EcAqpZ

AQP SS9


P-AQP SS9 Dimer

MjpPpaRS

P-AQP SS9 Monomer

2 3 4 5 6 7 81kDa

49

35

25








P-AQP SS9

110 138 165 192 220 248[Mg+] (mM)


P-AQP SS9 Dimer

P-AQP SS9 Monomer

1kDa 8765432

49

35

25


000 005 010 015 020 025 03000

02

04

06

08

10


Nor

mal

ized

ligh

t sig

nal

Time (s)







4 Discussion







5 Conclusion


Data Availability




Acknowledgments


References
























Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018










3 Results




TIP

MgaGlpF

MgeGlpF

BsGlpF

EcGlpF

AQP1

6083AqpZ

EcAqpZ

AQP SS9


P-AQP SS9 Dimer

MjpPpaRS

P-AQP SS9 Monomer

2 3 4 5 6 7 81kDa

49

35

25








P-AQP SS9

110 138 165 192 220 248[Mg+] (mM)


P-AQP SS9 Dimer

P-AQP SS9 Monomer

1kDa 8765432

49

35

25


000 005 010 015 020 025 03000

02

04

06

08

10


Nor

mal

ized

ligh

t sig

nal

Time (s)







4 Discussion







5 Conclusion


Data Availability




Acknowledgments


References
























Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018



TIP

MgaGlpF

MgeGlpF

BsGlpF

EcGlpF

AQP1

6083AqpZ

EcAqpZ

AQP SS9


P-AQP SS9 Dimer

MjpPpaRS

P-AQP SS9 Monomer

2 3 4 5 6 7 81kDa

49

35

25








P-AQP SS9

110 138 165 192 220 248[Mg+] (mM)


P-AQP SS9 Dimer

P-AQP SS9 Monomer

1kDa 8765432

49

35

25


000 005 010 015 020 025 03000

02

04

06

08

10


Nor

mal

ized

ligh

t sig

nal

Time (s)







4 Discussion







5 Conclusion


Data Availability




Acknowledgments


References
























Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018



P-AQP SS9

110 138 165 192 220 248[Mg+] (mM)


P-AQP SS9 Dimer

P-AQP SS9 Monomer

1kDa 8765432

49

35

25


000 005 010 015 020 025 03000

02

04

06

08

10


Nor

mal

ized

ligh

t sig

nal

Time (s)







4 Discussion







5 Conclusion


Data Availability




Acknowledgments


References
























Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018






5 Conclusion


Data Availability




Acknowledgments


References
























Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018









Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018


cell-free expression of unnatural amino acid incorporated...

Documents