author's personal copy - dipartimento di farmacia … · author's personal copy...

This article appeared in a journal published by Elsevier. The attachedcopy is furnished to the author for internal non-commercial researchand education use, including for instruction at the authors institution

and sharing with colleagues.

Other uses, including reproduction and distribution, or selling orlicensing copies, or posting to personal, institutional or third party

websites are prohibited.

In most cases authors are permitted to post their version of thearticle (e.g. in Word or Tex form) to their personal website orinstitutional repository. Authors requiring further information

regarding Elsevier’s archiving and manuscript policies areencouraged to visit:

http://www.elsevier.com/copyright

969

http://www.elsevier.com/copyright

Author's personal copy

D184E MUTATION IN AQUAPORIN-4 GENE IMPAIRS WATERPERMEABILITY AND LINKS TO DEAFNESS

G. P. NICCHIA,a* R. FICARELLA,b A. ROSSI,a

I. GIANGRECO,c O. NICOLOTTI,c A. CAROTTI,c

F. PISANI,a X. ESTIVILL,d P. GASPARINI,e

M. SVELTOa AND A. FRIGERIa

aDepartment of General and Environmental Physiology and Center ofExcellence in Comparative Genomics (CEGBA), University of Bari,Bari, ItalybDepartment of Emergency and Organ Transplantation, Section ofInternal Medicine, Endocrinology, Andrology and Metabolic Diseases,University of Bari School of Medicine, Bari, ItalycDepartment of Medicinal Chemistry, University of Bari, Bari, ItalydGenetic Causes of Disease, Genes and Disease Programme, Centrefor Genomic Regulation (CRG) and UPF, Barcelona, SpaineUnit of Medical Genetics, Department of Reproductive Science andDevelopment, Institute for Maternal and Child Health—IRCCS “BurloGarofolo”—Trieste, Italy

Abstract—Aquaporins (AQPs) play a physiological role inseveral organs and tissues, and their alteration is associatedwith disorders of water regulation. The identification of mo-lecular interactions, which are crucial in determining the rateof water flux through the channel, is of pivotal role for thediscovery of molecules able to target those interactions andtherefore to be used for pathologies ascribable to an alteredAQP-dependent water balance. In the present study, a muta-tional screening of human aquaporin-4 (AQP4) gene wasperformed on subjects with variable degrees of hearing loss.One heterozygous missense mutation was identified in aSpanish sporadic case, leading to an Asp/Glu amino acidsubstitution at position 184 (D184E). A BLAST analysis re-vealed that the amino acid D184 is conserved across species,consistently with a crucial role in the structure/function ofAQP4 water channels. The mutation induces a significantreduction in water permeability as measured by the Xenopuslaevis oocytes swelling assay and by the use of mammaliancells by total internal reflection microscopy. By Western blot,immunofluorescence and 2D Blue Native/SDS-PAGE weshow that the reduction in water permeability is not ascrib-able to a reduced expression of AQP4 mutant protein or to itsincorrect plasma membrane targeting and aggregation intoorthogonal arrays of particles. Molecular dynamics simula-tion provided a molecular explanation of the mechanismwhereby the mutation induces a loss of function of the chan-nel. Substituting glutamate for aspartate affects the mobilityof the D loop, which acquires a higher propensity to equili-brate in a “closed conformation”, thus affecting the rate ofwater flux. We speculate that this mutation, combined withother genetic defects or concurrently with certain environ-

mental stimuli, could confer a higher susceptibility todeafness. © 2011 IBRO. Published by Elsevier Ltd. All rightsreserved.

Key words: D184E, AQP4, aquaporins, deafness, water trans-port, OAPS.

Water channels belong to a family of small membraneproteins, known as aquaporins (AQPs), which mediate anosmotically driven bidirectional water flux. The “orthodoxAQPs” are permeable only to water molecules, while theso-called “aquaglyceroporins” also allow the transport ofsmall and uncharged solutes, such as glycerol and urea.However, in both cases AQPs are not permeable to ions,which could be readily transferred through water mole-cules. This property is crucial to avoid that the passage ofwater affects the electrochemical membrane potential(Gonen and Walz, 2006). This selectivity for water is due toelectrostatic forces within the pore, which cause watermolecules to flip, thus breaking the interaction withcharged molecules required for their translocation. More-over, the narrowest diameter of the pores is 2.8 Å, whichenables water molecules to pass only in single file. Eventhough the functional unit for water permeability is thesingle AQP monomer of �30 kDa, water channel proteinsform a tetrameric unit in the membrane.

AQPs play a physiological role in several organs andtissues (Verkman, 2000), and their altered expression isassociated with disorders of water regulation. For exam-ple, AQP0 alteration is involved in a form of autosomaldominant cataract; mice lacking aquaporin-4 (AQP4) ex-hibit an altered brain water balance in some pathologicalconditions (Verkman et al., 2000), as well as hearing im-pairment (Li and Verkman, 2001) and mice lacking AQP5have defective saliva secretion (Ma et al., 1999). In hu-mans, AQP2 mutations cause an autosomal form of he-reditary nephrogenic diabetes insipidus (Deen et al.,1994).

Several AQPs are expressed in the inner ear (Umeni-shi and Verkman, 1998; Verkman et al., 2000; Yang et al.,1996; Lopez et al., 2007) where an accurate volume reg-ulation is required by the sensory epithelial cells. AQP4 isexpressed and organized in orthogonal arrays of particles(OAPs) (Takumi et al., 1998; Hirt et al., 2011) in the lateraland basal membrane domains of Hensen’s cells, Claudius’cells and outer sulcus cells (Lopez et al., 2007) where anunusual heterogeneity in OAP size, density and shapesuggests a peculiar function during acoustic signal trans-duction (Hirt et al., 2011). Interestingly, the outer sulcuscells in the lateral wall of the cochlea exhibit an apical

*Corresponding author. Tel: �39-080-5443335; fax: �39-080-5443388.E-mail address: [email protected] (G. P. Nicchia).Abbreviations: AQP, aquaporin; AQP4, aquaporin-4; cRNA, cappedRNA; DHPLC, denaturing high-performance liquid chromatography;MD, molecular dynamics; nsSNPs, nonsynonymous single nucleotidepolymorphisms; OAPs, orthogonal arrays of particles; PDB, ProteinData Bank; SNP, single-nucleotide polymorphism; WT, wild-type.

Neuroscience 197 (2011) 80–88

0306-4522/11 $ - see front matter © 2011 IBRO. Published by Elsevier Ltd. All rights reserved.doi:10.1016/j.neuroscience.2011.09.023

80970


expression of a different AQP, AQP5, thus suggesting anaquaporin-mediated transcellular water shunt between theperilymph and endolymph at this site (Hirt et al., 2010).Studies comparing the auditory brainstem responsethresholds across wild-type (WT) and AQP1, AQP3, AQP4and AQP5 KO mice have shown that only mice lackingAQP4 water channels exhibit a remarkable hearing impair-ment, thus indicating an important role for AQP4 in hearphysiology (Li and Verkman, 2001; Mhatre et al., 2002).

AQP4 is expressed as two major isoforms of 32 and 30kDa, which arise from different translation-initiating methio-nines, called AQP4-M1 and AQP4-M23 (Umenishi andVerkman, 1998; Verkman et al., 2000; Yang et al., 1996).The two isoforms are organized in the membrane as het-erotetramers (Neely et al., 1999), which can in turn aggre-gate into supra-molecular structures, known as OAPs(Rash et al., 1998). The physiological role of AQP4 orga-nization into OAPs is as yet largely unknown, though it hasbeen speculated that this assembly might enhance waterpermeability (Silberstein et al., 2004) or confer a higherlevel of plasma membrane stability (Crane and Verkman,2009; Nicchia et al., 2010; Rossi et al., 2010). Correlationshave been reported between OAP alteration and variousdisease processes such as cerebral ischemia (Neuhaus etal., 1990), epilepsy (Hatton and Ellisman, 1984) and mus-cular dystrophy (Frigeri et al., 1998). In addition to theregulation of water homeostasis, which accounts for themain function of AQP4, novel physiological roles haverecently been shown for this channel (Saadoun et al.,2005) in signal transduction, cell migration, glutamate up-take and regulation of connexin43 (Nicchia et al., 2005).Interestingly, AQP4 knockdown results in a reduced cellcoupling (Nicchia et al., 2005), which is crucial to hearingloss given that junctional current impairment (due to Cx26,Cx30 or Cx31 mutations) has been shown to be linked toboth syndromic and nonsyndromic forms of deafness(Grifa et al., 1999; Kelsell et al., 1997; Sorani et al., 2008;Zelante et al., 1997).

By analysing the DNA from an ethnically diverse cohort(African American, Caucasian American, Asian Americanand Mexican American) of 188 healthy individuals, 24variants in AQP4 have recently been identified, includingfour novel non-synonymous single nucleotide polymor-phisms (nsSNPs), I128T, I205L and M224T and D184E(Sorani et al., 2008). While all these nsSNPs do not affectprotein expression and membrane localization, they havean impact on AQP4-mediated water permeability.

In the present study, a mutational screening of humanAQP4 gene was performed on a total number of 450subjects with variable degrees of hearing loss. Oneheterozygous missense mutation was identified in a Span-ish sporadic case, which exhibits a T-A nucleotide changeat position 486 and leads to an Asp/Glu amino acid sub-stitution at position 184 (D184E), thus corresponding toone of the nsSNPs mentioned before (Sorani et al., 2008).Here we have used the two isoforms of AQP4, that is, theshorter OAP-forming isoform M23 and the longer M1, toanalyse the effect of D184E mutation on the water perme-ability of AQP4, as well as on the plasma membrane

assembly of this latter into higher order structures. Weshow that the reduction in water permeability is not ascrib-able to a reduced expression of AQP4 mutant protein or toits incorrect plasma membrane targeting and aggregationinto orthogonal arrays of particles. Molecular dynamics(MD) simulation provided a molecular explanation of themechanism whereby the mutation induces a loss of func-tion of the channel. Substituting glutamate for aspartateaffects the mobility of the D loop, which acquires a higherpropensity to equilibrate in a “closed conformation”, thusaffecting the rate of water flux.

EXPERIMENTAL PROCEDURES

Ethics

The genetic analysis was performed on the peripheral blood ofhuman patients. All procedures were conducted in compliancewith the Declaration of Helsinki and with the adequate understand-ing and written consent of the subjects. The study was approvedby the Clinical Research Ethical Committee of the Municipal In-stitute of Health Care (CEIC-IMAS), Barcelona.

All experiments performed on animals were in line with Euro-pean Union Council Directive of 24 November 1986 (86/609/EEC)on the ethical use of animals and were designed to minimise thenumber of animals used as well as their sufferings. Experiments inthis study were approved by the Italian Health Department (Art. 9del Decreto Legislativo 116/92).

Patients and DNA extraction

The study included 450 patients belonging to families representingthe largest series of observations, nonsyndromic hearing impair-ment included, ever collected worldwide, as well as sporadiccases. Inclusion criteria were sensorineural hearing loss; normaltympanometric evaluation and absence of mutations within Con-nexin26 gene (GJB2). Vestibular data were obtained by clinicalexamination and routine vestibular tests (one or more of thefollowing tests: caloric, rotatory, optokinetic, swinging torsion, sta-tokinesimetric and vestibulo-vegetative). Clinical findings werepreviously reported for most of these patients. The series includedcases with (i) variable degrees of hearing loss, ranging from mildto profound forms and (ii) with a variable age of onset, fromcongenital to late-onset forms. The majority of patients came fromcentral and southern Italy (206), while 140 were from Spain, 54from Belgium and 50 from Israel. The controls were healthy sub-jects from the same geographical area of the patients. After in-formed consent was subscribed to by all participants, peripheralblood was obtained from all the subjects, and their DNA wasisolated using the Wizard® Genomic DNA Purification Kit (Pro-mega, Milan, Italy), in line with the protocol supplied by the man-ufacturer.

Genetic analysis

To amplify AQP4 gene five primer pairs were designed(AQP4_M1/F ggcaggcaatgagagctg, AQP4_M1/R tgcctaagaag-gcacaaaca; AQP4_2/F tgtagtggcttctgatgctg, AQP4_2/R tgcaag-aagcttggagtcct; AQP4_3/F aaaatgtgcctttcacaatga, AQP4_3/R tcct-cactctagctggcctg; AQP4_4/F tgacagcaaattgcaatgaa, AQP4_4/Rgacaattacctgtggggctc and AQP4_5/F gctgctcaatggaatagcttt,AQP4_5/R ctcagatttccttccaccca); PCR fragments included thecoding regions and the splice sites. All amplicons were screenedby denaturing high-performance liquid chromatography (DHPLC),performed on a WAVE Nucleic Acid Fragment Analysis SystemHSM (Transgenomic), following manufacturer’s protocols. TheDHPLC data analysis was based on a subjective comparison of

G. P. Nicchia et al. / Neuroscience 197 (2011) 80–88 81

971


sample and reference chromatograms. The PCR products thatexhibited an abnormal chromatographic profile on DHPLC analy-sis were sequenced directly on an automated sequencer (ABI 377and 3100; PerkinElmer, Milan, Italy) using the ABI-PRISM big-dyeTerminator Cycle Sequencing Ready Reaction Kit (PerkinElmer,Milan, Italy). To assess the possible pathogenic variants the con-servation of residues was also studied with multiple sequencealignments using WU-BLAST2.

Plasmids and mutagenesis

Human D184E-M1- and D184-M23-AQP4 mutant isoforms weregenerated by site-direct mutagenesis, using the QuikChange® XLSite-Directed Mutagenesis Kit (Stratagene, Milan, Italy). The mu-tagenic primer used (5=- gat tcc aaa cgg act gaa gtc act ggc tca atagc -3=) contained the desired mutation in the middle of the primerwith the correct sequence on both sides. D184E substitution wasverified by DNA sequencing. Two vectors were used as templates,which contained the WT coding sequence of human AQP4 (M1-AQP4 and M23-AQP4), both cloned in the pTarget mammalianexpression vector (Promega, Milan, Italy). WT and mutant M1-AQP4 human sequences were subcloned in the enhanced Xeno-pus plasmid expression vector pGEM-HE with flanking 5= and3=UTRs from the Xenopus �-globin gene for capped RNA (cRNA)in vitro transcription.

Cell cultures and transfection

HeLa (ATCC CCL-2) cells were used for transient transfectionexperiments, which were performed using Lipofectamine 2000from Invitrogen (Milan, Italy), following manufacturer’s instruc-tions.

AQP4 cRNA synthesis and Xenopus leavis oocytespreparation

The mMessage mMachine (Ambion, Austin, TX, USA) T7 in vitrotranscription kit was used to produce cRNA from each constructfor oocyte injection. Ten nanograms of mutant and wild-typecRNAs were injected into single oocytes using an automatedmicroinjector (Nanoject; Drummond Scientific, Broomall, PA,USA). Oocytes were surgically removed from anaesthetized (2 g/Ltricaine, Sigma, Milan, Italy) Xenopus leavis and defolliculatedwith collagenase type IA (Sigma, Milan, Italy) 1 mg/ml for 2–4 h at20 °C in the following buffer: 96 mM NaCl; 2 mM KCl; 2 mM MgCl2;2.5 mM Na-pyruvate; 1.8 mM CaCl2; 5 mM Hepes, pH 7.6 supple-mented with 1 �g/ml gentamicin and stored at 16 °C for 24–48 h.

Xenopus leavis oocytes swelling assay

Twenty-four to forty-eight hours after injection, the osmotic waterpermeability coefficient (Pf) was measured from the time course ofoocyte swelling and images were recorded every 10 s for 6 minwith a microscope equipped with a computer-interface camera. Tocalculate the osmotic permeability coefficient (Pf), mutant and wildtype AQP4 cRNAs and water injected oocytes were maintained inisotonic MND96 prior to experiments. The hypotonic shock wasinduced by replacing the total volume of the isotonic MND96solution (200 mOsm) with a hypotonic one (70 mOsm) in thechamber where oocytes were placed. As previously described, Pf

value (cm/s) was estimated from the function Pf�JW/VW A �Osm,where JW is the volume of water (in �l) transferred in the unit oftime (s) under an initial osmotic gradient �Osm (mol/cm3), VW isthe partial molar volume of water (18 ml/mol) and A is the initialobserved area of the oocyte (mm2). JW values were obtained fromthe slope of the volume versus time function in the first 10 s. Thedata obtained from independent experiments with differentoocytes were presented as mean�SEM.

TIRF measurements

For the swelling assay by TIRF, cells were grown on 20-mmdiameter round glass coverslips and used 24–48 h later. Cellswere loaded with 1 �M calcein-AM, and water permeability wasmeasured using a Nikon Laser TIRF setup as described by Pisaniet al. (2010). The kinetics of osmotic volume changes was char-acterized by comparing the time constants of cell swelling (ob-tained from experimental data) fitted to a single exponential func-tion.

Antibodies

The anti-AQP4 antibodies used for immunofluorescence and im-munoblotting analysis were from Santa Cruz (CA, USA). Thedonkey anti-goat IgG peroxidase-conjugated antibodies were fromSanta Cruz, and donkey anti-goat Alexa 488-conjugate antibodiesused for immunofluorescence analysis were from Invitrogen (Mi-lan, Italy).

Immunofluorescence analysis

Transfected HeLa cells were fixed with paraformaldheyde 4% inPBS for 10 min, washed three times with PBS, permeabilized with0.3% TritonX-100 in PBS for 10 min and finally saturated withPBS–0.1% gelatin for 10 min. Cells were then incubated with com-mercial anti-AQP4 antibody for 30 min, washed three times withPBS and incubated for 30 min with Alexa-conjugated secondaryantibodies, washed and finally mounted in PBS–glycerol (1:1) pH8.0, containing 1% n-propyl gallate. Immunostained cells werescreened with a photomicroscope equipped for epifluorescence(DMRXA; Leica), and digital images were obtained with a DMX1200 camera (Nikon, Tokyo, Japan).

Protein samples for SDS-PAGE and2D BN/SDS-PAGE analysis

A confluent layer of cells, transfected 48 h earlier, was lysed inthree volumes of BN lysis buffer (aminocaproic acid 500 mM,Bis–Tris 20 mM, pH 7.2, EDTA 2 mM, NaCl 12 mM, glycerol 10%,TritonX-100 1%, PMSF 1 mM and protease inhibitor cocktail) onice for 2 h. The samples were then centrifuged at 22,000 g for 1 h,and the protein content of the supernatant measured with BCAProtein Assay Kit (Pierce, Rockford, IL, USA).

Two-dimensional BN/SDS-PAGE and Westernblotting

The 2D analysis was performed as already described. Briefly, thefirst dimension was performed on 3–10% polyacrylamide nativegradient gels prepared as described (Nicchia et al., 2010), and�50 �g of protein sample mixed with 5% of Coomassie BlueG-250 (CBB G-250) was loaded into each lane. The lanes fromthe first dimension were equilibrated in denaturation buffer (1%SDS and 1% �-mercaptoethanol) for 1 h and then placed into asecond SDS gel of the same thickness. At the end of the run, thegel was blotted onto a polyvinylidene difluoride membrane forWestern blot analysis performed as described by Pisani et al.(2010).

Molecular dynamics simulation

After screening (Giangreco et al., 2010; Nicolotti et al., 2007)the Protein Data Bank (PDB, [http://www.rcsb.org/pdb/home/home.do]), two AQP4 structures with PDB codes 2D57 and 3GD8(Ho et al., 2009) were retrieved. The former was a rat AQP4 X-raysolved with a resolution of 3.2 Å at pH�6.0 and T�4.2 K. Thelatter, a very recent one, was instead a human AQP4 X-ray solvedwith a better resolution (i.e. 1.8 Å) in the same pH condition and at

G. P. Nicchia et al. / Neuroscience 197 (2011) 80–8882

972


T�77 K. Our computational studies were thus performed on themonomer from the 3GD8 crystal. After adding hydrogen atoms,the structure was minimised with AMBER10 (Case, 2008) (105cycles of in vacuo minimization including 300 steps of initial steep-est descent followed by conjugate gradient until convergence).The D184E mutation was inserted in the minimised structure byusing the biopolymer tool available in Sybyl 8.0 (Tripos Inc., St.Louis, 2007). Both mutated and wild-type protein structures wereincorporated into a periodic box of TIP3P water molecules ex-tended by 18 Å in each direction from all protein atoms. Watermolecules and loop D residues from Ala176 to Leu191 weresubjected to molecular dynamics while all the other atoms wereheld fixed. The parm99SB version of the all-atom AMBER forcefield was used to model the system. The solvent molecules wereinitially relaxed by energy minimizations and 30 ps of MD. Sub-sequently, the full system was minimised to remove steric clashesin the initial geometry and gradually heated up to 310 K within 600ps of MD. The SHAKE algorithm was employed to constrain allR–H bonds. Periodic boundary conditions were applied in alldirections. A nonbonded cut-off of 12 Å was used, whereas theParticle-Mesh-Ewald (PME) was employed to include the contri-butions of long-range interactions. All simulations were performedin an isothermal-isobaric ensemble (1 atm, 310 K) with a Nosè–Hoover Langevin barostat (oscillation period 200 fs, decay coef-ficient 100 fs) and a Langevin thermostat (damping coefficient 1ps�1). The time step was set to 1.5 fs, and coordinates weresaved every 400 steps (0.6 ps). The analysis was performed on atotal production run corresponding to a 1.2 ns trajectory.

RESULTS

D184E missense mutation in a deaf patient

The AQP4 gene mutational screening performed on a totalnumber of 450 European hearing-impaired patients led tothe identification of a missense mutation in a Spanishsporadic case, which did not show any other mutation orvariation in AQP4 gene. The mutation in question is a T-Anucleotide change at position 486 which leads to an Asp/Glu amino acid substitution at position 184 (D184E) local-ized at the level of intracellular loop D (Fig. 1). The residueis highly conserved across species. D184E allele was

absent in 200 chromosomes of normal individuals from thesame geographical area of the patient.

Water permeability of AQP4 D184E

We first expressed the cRNA corresponding to M23-D184E AQP4 in Xenopus laevis oocytes in order to havean absolute estimate of the osmotic permeability coeffi-cient (Pf) conferred by the expression of the mutatedAQP4 compared with the wild type (Fig. 2A, B). Our resultsshow that the D184E substitution significantly slows downthe time course of the swelling kinetics, thus resulting in a42.3% reduction of the osmotic permeability coefficientcalculated. The water permeability reduction measured forthe mutated AQP4 M23 isoform is in line with that ob-served by Manley for the same mutation using M1 isoform(Sorani et al., 2008). A swelling assay was also performedusing the calcein dilution method with TIRF apparatus onmammalian cells transfected with the WT and D184E M23(Fig. 2C, D). The results obtained, consistent with theexperiments performed in the oocytes, showed that D184Emutation reduced the rate of cell swelling by 34.7%. Thisreduction was not significantly altered in experimentswhere M1 was cotransfected with M23 in both WT andD184E conditions (data not shown).

D184E plasma membrane localization, proteinexpression levels and orthogonal arrays of particles

The reduced water permeability measured for the D184Emutated form of AQP4 in both the oocytes and mammalianexpression systems could be ascribed to its defective tar-geting into the plasma membrane and/or to a reduction inthe total protein expression levels of D184E AQP4 and/orto an incorrect formation of higher-order structures. Inorder to explore all these assumptions, we performed im-munofluorescence and Western blot analysis. AQP4 im-munolocalization performed using AQP4 commerciallyavailable antibodies (Fig. 3) showed that the mutation did

Fig. 1. Identification and BLAST analyses of D184E mutation. (A) BLAST analysis of human, rat and mouse AQP4 sequences showing that the D184residue is conserved across the species. (B) The heterozygous missense mutation (T-A) found in the Spanish deaf patient is indicated by the arrow.(C) The mutation occurs at intracellular loop D. For interpretation of the references to color in this figure legend, the reader is referred to the Webversion of this article.


973


not affect the protein expression and did not impact correctplasma membrane targeting of AQP4. In fact, as shownfor the WT, D184E M1 staining appeared diffuse in theplasma membrane, whereas D184E M23 staining ap-peared punctuated, thus indicating the ability of themutated form to supra-structure aggregates (Nicchia etal., 2010). No effect of the mutation on AQP4 plasmamembrane localization was observed also in experi-ments performed by cotransfecting equal amounts ofWT and D184E M1 and M23.

The same transfection conditions were also analysedfor possible alterations of the mutated AQP4 into theplasma membrane using different techniques. Westernblot analysis of the total protein fraction showed that themutation did not affect the total protein expression levels ofboth isoforms (Fig. 4A, B). The only difference found be-tween WT and D184E AQP4 isoforms was highlightedusing Tricine-based gel systems (Fig. 4B) where a signif-icantly higher amount of AQP4 dimers was observed forD184E compared with WT for both M1 and M23 and alsoM1�M23. The same samples subjected to a glycine im-

munoblotting (Fig. 4A) did not show the same feature.Taken together, these data suggest that the reduction inwater permeability registered for the D184E mutation doesnot result from improper plasma membrane targeting orfrom altered total protein expression levels. The more pro-nounced tendency to aggregate of the mutated form led usto focus on D184E organization into higher-order struc-tures thought to be crucial to water permeability increase(Silberstein et al., 2004). We therefore tried to understandwhether D184E mutation affects AQP4 plasma membraneorganization into higher-order structures. We analysedcells transfected with WT and mutated AQP4 by BN/SDS-PAGE, a technique recently introduced by our group (Nic-chia et al., 2008) for the biochemical separation of OAPs.Fig. 4C shows a BN/SDS-PAGE 2D gel of proteins fromcells transfected with WT and mutated AQP4 M23 aloneand together with M1. The results showed that the muta-tion induces a general reduction in the amount of the30–32-kDa bands, in particular for large-sized OAPs(�880 kDa). However, at the level of AQP4 dimers at �60kDa, the opposite situation is given. A higher level of

Fig. 2. D184E expression in Xenopus oocytes and HeLa cells. (A) The time course of swelling of oocytes injected with the WT and D184E humanM23 AQP4 cRNA. (B) The hystobar summarizes the Pf value calculated in cm/s (M23 WT: 2.6�0.22�10�2; M23 D184E: 1.5�0.27�10�2; H20:3.2�1.2�10�4; * P0.005; n�17). (C) The time course of cell swelling measured for HeLa cells transfected with the WT- and D184E-M23-AQP4isoforms using TIRF apparatus. (D) The histogram shows the time constant (�) of cell swelling measured for WT (3.2�0.3 s, n�15) and D184 AQP4(4.9�0.24 s, n�18), * P0.005.


974


dimers is shown for mutated AQP4 compared with WT.Given that the second dimension of a 2D BN/SDS-PAGEexperiment is performed using a Tricine buffer (see Fig.

4A, B), our results suggest that the mutation does notseem to dramatically affect OAP size, but rather its pro-pensity to aggregate.

Molecular analysis of the D184E mutation

The D184E mutated residue belonged to the loop D stretchof hAQP4 structure. As is known (Tani et al., 2009), thisspecific region has been assumed to be involved in thewater gating mechanism of different AQP isoforms ex-pressed by different organisms (e.g. plants). Loop D con-formational mobility was investigated through MD simula-tions. The analyses were focused on a monomer copyretrieved from the 3GD8 (Ho et al., 2009) crystal structureavailable from the PDB ([http://www.rcsb.org/pdb/home/home.do]). Interestingly, a preliminary visual inspectionrevealed that loop D did not obstruct the pore lumen andwas therefore assumed to have an open conformation. Asa matter of fact, it was observed that the side chains of allloop D-forming residues were protruding outside the porelumen. Moreover, a salt bridge was supposed to occurbetween the guanidine and carboxylate groups belongingto residues Arg182 and Asp184, respectively. Loop D mo-lecular flexibility was investigated by running 1.2-ns MDsimulation on the wild type (WT) as well as on the D184Emutated loop D structures. It emerged that inserting gluta-mate residue in the place of the aspartate residue at theposition 184 increased loop D conformation mobility. Thiswas clearly evident in Fig. 5 that illustrates the higheroscillations of the C-� atoms (measured as root-mean-square deviations, i.e. RMSD) observed for the D184E

Fig. 3. D184E cellular localization. Immunofluorescence analysis ofHeLa cells transiently transfected with the WT and D184E M1- andM23-AQP4 isoforms. No major differences in the plasma membranelocalization of mutated AQP4 were found.

Fig. 4. D184E biochemical analysis by Western blot and BN/SDS-PAGE. (A, B) WT and D184E M1, M23 and M1�M23 transfected HeLa cellssubjected to immunoblotting after SDS-PAGE performed in a glycine- (left) or Tricine- (right) based buffer. No differences were found in overall AQP4protein levels between WT and mutated AQP4. The arrowheads indicate AQP4 dimers of �60 kDa, strongly detectable in D184E M1, M23 andM1�M23 only using a Tricine-based gel system. (C) BN/SDS-PAGE 2D analysis conducted on cells transfected with M23 alone (M23) and togetherwith M1 and M23 (M1�M23). The arrows indicate AQP4 monomers at 30–32 kDa, and the arrowheads indicate the dimers of AQP4 at �60 kDa.


975


mutated structure compared with WT. This later actuallyexhibited somewhat limited molecular rearrangementscompared with initial X-ray conformation. Presumably, themutated loop D was assumed to have a higher propensityto equilibrate in closed conformation. Interestingly, ourpreliminary calculations suggested the occurrence of abidentate salt bridge interaction between the variableacidic residue at position 184 and Arg182. The strength ofthis bond is supposed to depend on the length of theresidue side chain. We observed that the insertion of amethylene spacer, as a result of the Asp/Glu amino acidsubstitution, increased the number of degrees of freedomof the residue side chain at position 184, thus underminingthe chance of establishing direct ionic interactions at anoptimal distance. As observed in Fig. 5B, a longer distancecharacterized the mutated (blue profile) over the WT (redprofile) protein. This interaction was even transiently lost atan early stage for mutated AQP4.

The weakness of the salt bridge due to the D184Emutation induced an additional conformational change inVal185, a residue that contributed, together with Ile189, toform a sort of hydrophobic barrier able to partially block thewater pore. Moreover, a closer inspection of the trajectoryrevealed that mutated AQP4 loop D increased its second-ary structure content by extending the length of helix H4(Fig. 6).

DISCUSSION

Some genetic variants for AQPs have already been asso-ciated with some clinical phenotypes. For example, natu-rally occurring AQP2 variants R254L (de Mattia et al.,2005) and L22V (Canfield et al., 1997) have been associ-ated with nephrogenic diabetes insipidus, even thoughthey both exhibit only a partial loss of function (28% and69% over the control, respectively), thus indicating thatAQP variants can be disease-associated even if they donot block the protein function completely. For humanAQP4, 25 variants have been reported (Sorani et al.,2008), including one single-nucleotide polymorphism(SNP) (M278T) characterized by a gain of function and

four SNPs with reduced water permeability (D184E andI128T, I205L and M224T). SNPs are not absolute indica-tors of disease, but they can either predispose to diseaseor influence drug response. The present study has beenable to highlight for the first time an association betweenD184E SNP (with a T�A nucleotide change) and a form ofnonsyndromic deafness. This finding seems to be intrigu-ing in light of the fact that an AQP4 defect in animal modelshas already been associated to deafness. AQP4 knockoutmice actually exhibit remarkable hearing impairment, thusindicating that AQP4 is likely to play a role in some formsof deafness and that AQP4 function modulation in the innerear promises to have a therapeutic value.

The analysis of the data on D184E mutation collectedby our group and by Sorani et al. (2008) demonstrates acertain level of variability across ethnic groups. D184E has

Fig. 5. (A) Root-mean-square deviations (RMSD) of the C-� atoms of the mutated (blue line) and of the wild-type (red line) AQP4 with respect to the3GD8 crystal structure. (B) Distance between the centre of mass of the oxygen atoms in the acidic side chain (D184E) and the centre of mass of thenitrogen atoms in the basic side chain (Arg182) measured for each frame. For interpretation of the references to color in this figure legend, the readeris referred to the Web version of this article.

Fig. 6. Zoomed-in view of loop D (rendered as stick) after a moleculardynamics simulation of 1.2 ns (blue cartoon) compared with initialcoordinates of mutated structure (gray cartoon). The extension of thealpha-helix H4 induced by the punctual mutation D184E is shown.Val185 points inside the lumen of the pore and, together with Ile189,constitutes a hydrophobic barrier that reduces water gating. For inter-pretation of the references to color in this figure legend, the reader isreferred to the Web version of this article.


976


been reported to have an allele frequency of 2.1% forAfrican American, 1.1% for Mexican and 0% for Caucasianand Chinese cohorts on a screening study conducted onlarge cohorts (up to 47 individuals) for each ethnic group(Sorani et al., 2008). The 0% value found in Caucasians isin line with the result of our screening process that high-lighted the presence of only one mutation in a Spanishpatient out of a total of 544 individuals studied (444 withhearing impairment and 100 healthy controls from thesame geographic area of the patients).

A preliminary BLAST analysis revealed that residue Dat position 184 is conserved across species, consistentlywith a crucial role for this amino acid in the structure/function of AQP4 water channels. Unlike other AQPs, high-er-order structures of AQP4 can be found in the plasmamembrane of the tissues where this AQP is expressed.These supra-structures are called OAPs. OAPs are madeof multiple heterotetramers of the two major isoforms ofAQP4 known as M1-AQP4 and M23-AQP4. M23 is theOAP-forming isoform, whereas M1 is not able to formOAPs when expressed alone. The loss of function reportedby Sorani et al. (2008) for AQP4 D184E has been testedusing only M1-AQP4. By contrast, all the experimentsconducted within the present study have taken into ac-count the importance of AQP4 organization into OAPs inthe plasma membrane (Crane and Verkman, 2009; Nic-chia et al., 2010; Rossi et al., 2010; Silberstein et al.,2004), in view of the stability and water permeability of thesame AQP4. Our first purpose was to measure the impactof D184E mutation on the water permeability of the OAP-forming isoform M23 using both the oocyte expressionsystem, which allows to estimate the osmotic permeabilitycoefficient, and a mammalian expression system in orderto additionally explore water flux properties in experimentalconditions more representative of the physiological condi-tion. We found that the mutation induced a significantreduction in water permeability, which is not ascribable toa reduced amount of AQP4 mutant protein or to its incor-rect plasma membrane targeting. All our data are in agree-ment with what was found in AQP4 M1 by Sorani in termsof reduced water permeability, normal protein expressionlevel and correct targeting of the plasma membrane on thepart of the mutant. In addition, by using BN/SDS-PAGE, atechnique recently introduced for the analysis of AQP4organization into OAPs (Crane and Verkman, 2009; Nic-chia et al., 2008; Sorbo et al., 2008), no major alterationwas observed for AQP4 D184E in terms of supra-structureorganization, but an increased tendency of the mutant toaggregate and form dimers. We cannot rule out that thisaspect might somehow affect the dynamic of OAP forma-tion and/or its interaction with other proteins. However, thesame tendency to aggregate has been already found forother AQP4 mutations, including �61-64 (Pisani et al.,2010) and E63K (unpublished observation) and for S180D(Mitsuma et al., 2010), thus indicating that this feature isnot unique to D184E. An interesting point that deservesadditional attention, albeit in a different context, is that thistendency is in general highlighted using Tricine-based

rather than glycine-based gel systems, thus suggesting theimportance of the buffer in stabilizing AQP4 aggregates.

MD simulation provided a clear molecular explanationof the mechanism whereby the mutation impacts AQP4-mediated water flux. AQPs function as always-open chan-nels allowing the passage of water molecules. Normally,the side chains of all the loop D-forming residues areprotruding outside the pore lumen in a kind of “open con-formation” (Ho et al., 2009). The insertion of glutamate inthe place of aspartate residue at position 184 resulted in anincreased conformation mobility of the D loop, which ac-quires a higher propensity to equilibrate in a kind of “closedconformation”. Even though the mutated loop is not a realgate that closes the channel completely, its presencewithin the aqueous pore interferes with the way watermolecules flow and therefore reduce water permeabilityrate. The identification of those interactions between theloops that are important for water flux indicates that mole-cules able to target these interactions might play a thera-peutic role in those pathologies ascribable to an AQP-dependent altered water balance.

CONCLUSION

In conclusion, for the first time we have been able to showthe association of human AQP4 gene D184E mutation to aform of nonsyndromic deafness. On the basis of the dataobtained in the present study, the loss of function is neitherdue to an altered AQP4 protein expression and delivery tothe plasma membrane nor to its defective aggregation intohigher-order structures. Substituting glutamate for aspar-tate seems to impact the mobility of the D loop, whichmoves in the direction of the water pore, thus affecting therate of water flux. We can speculate that in the Caucasianpopulations this mutation could confer a higher suscepti-bility to deafness when combined with other genetic de-fects or concurrently with certain environmental stimuli.Future studies are therefore required to investigate thisissue in greater detail.

Acknowledgments—The authors would like to thank Dott. LuciaSollecito for her assistance in revising the English of the article.

REFERENCES

Canfield MC, Tamarappoo BK, Moses AM, Verkman AS, Holtzman EJ(1997) Identification and characterization of aquaporin-2 waterchannel mutations causing nephrogenic diabetes insipidus withpartial vasopressin response. Hum Mol Genet 6:1865–1871.

Case DA (2008). Assisted model building with energy refinement(AMBER 10).San Francisco, CA: University of California.

Crane JM, Verkman AS (2009) Determinants of aquaporin-4 assemblyin orthogonal arrays revealed by live-cell single-molecule fluores-cence imaging. J Cell Sci 122:813–821.

de Mattia F, Savelkoul PJ, Kamsteeg EJ, Konings IB, van der Sluijs P,Mallmann R, Oksche A, Deen PM (2005) Lack of arginine vaso-pressin-induced phosphorylation of aquaporin-2 mutant AQP2-R254L explains dominant nephrogenic diabetes insipidus. J AmSoc Nephrol 16:2872–2880.

Deen PMT, Verdijk MAJ, Knoers NVAM, Wieringa B, Monnens LAH,van Os CH, van Oost BA (1994) Requirement of human renal


977


water channel aquaporin-2 for vasopressin-dependentconcentration of urine. Science 264:92–95.

Frigeri A, Nicchia GP, Verbavatz JM, Valenti G, Svelto M (1998)Expression of aquaporin-4 in fast-twitch fibers of mammalian skel-etal muscle. J Clin Invest 102:695–703.

Giangreco I, Nicolotti O, Carotti A, De CF, Gargano G, Bellotti R (2010)Analysis of X-ray structures of matrix metalloproteinases via cha-otic map clustering. BMC Bioinformatics 11:500.

Gonen T, Walz T (2006) The structure of aquaporins. Q Rev Biophys39:361–396.

Grifa A, Wagner CA, D’Ambrosio L, Melchionda S, Bernardi F, Lopez-Bigas N, Rabionet R, Arbones M, Monica MD, Estivill X, Zelante L,Lang F, Gasparini P (1999) Mutations in GJB6 cause nonsyn-dromic autosomal dominant deafness at DFNA3 locus. Nat Genet23:16–18.

Hatton JD, Ellisman MH (1984) Orthogonal arrays are redistributed inthe membranes of astroglia from alumina-induced epileptic foci.Epilepsia 25:145–151.

Hirt B, Gleiser C, Eckhard A, Mack AF, Müller M, Wolburg H, Löwen-heim H (2011) All functional aquaporin-4 isoforms are expressed inthe rat cochlea and contribute to the formation of orthogonal arraysof particles. Neuroscience 189:79–92.

Hirt B, Penkova ZH, Eckhard A, Liu W, Rask-Andersen H, Müller M,Löwenheim H (2010) The subcellular distribution of aquaporin 5 inthe cochlea reveals a water shunt at the perilymph-endolymphbarrier. Neuroscience 168:957–970.

Ho JD, Yeh R, Sandstrom A, Chorny I, Harries WE, Robbins RA,Miercke LJ, Stroud RM (2009) Crystal structure of human aqua-porin 4 at 1.8 A and its mechanism of conductance. Proc Natl AcadSci U S A 106:7437–7442.

Kelsell DP, Dunlop J, Stevens HP, Lench NJ, Liang JN, Parry G,Mueller RF, Leigh IM (1997) Connexin 26 mutations in hereditarynon-syndromic sensorineural deafness. Nature 387:80–83.

Li J, Verkman AS (2001) Impaired hearing in mice lacking aquaporin-4water channels. J Biol Chem 276:31233–31237.

Lopez IA, Ishiyama G, Lee M, Baloh RW, Ishiyama A (2007) Immu-nohistochemical localization of aquaporins in the human inner ear.Cell Tissue Res 328:453–460.

Ma T, Song Y, Gillespie A, Carlson EJ, Epstein CJ, Verkman AS(1999) Defective secretion of saliva in transgenic mice lackingaquaporin-5 water channels. J Biol Chem 274:20071–20074.

Mhatre AN, Stern RE, Li J, Lalwani AK (2002) Aquaporin 4 expressionin the mammalian inner ear and its role in hearing. BiochemBiophys Res Commun 297:987–996.

Mitsuma T, Tani K, Hiroaki Y, Kamegawa A, Suzuki H, Hibino H,Kurachi Y, Fujiyoshi Y (2010) Influence of the cytoplasmic domainsof aquaporin-4 on water conduction and array formation. J Mol Biol402:669–681.

Neely JD, Christensen BM, Nielsen S, Agre P (1999) Heterotetramericcomposition of aquaporin-4 water channels. Biochemistry 38:11156–11163.

Neuhaus J, Schmid EM, Wolburg H (1990) Stability of orthogonalarrays of particles in murine skeletal-muscle and astrocytes aftercirculatory arrest, and human gliomas. Neurosci Lett 109:163–168.

Nicchia GP, Cogotzi L, Rossi A, Basco D, Brancaccio A, Svelto M,Frigeri A (2008) Expression of multiple AQP4 pools in the plasmamembrane and their association with the dystrophin complex.J Neurochem 105:2156–2165.

Nicchia GP, Rossi A, Mola MG, Pisani F, Stigliano C, Basco D,Mastrototaro M, Svelto M, Frigeri A (2010) Higher order structure ofaquaporin-4. Neuroscience 168:903–914.

Nicchia GP, Srinivas M, Li W, Brosnan CF, Frigeri A, Spray DC (2005)New possible roles for aquaporin-4 in astrocytes: cell cytoskeletonand functional relationship with connexin43. FASEB J 19:1674–1676.

Nicolotti O, Miscioscia TF, Leonetti F, Muncipinto G, Carotti A (2007)Screening of matrix metalloproteinases available from the proteindata bank: insights into biological functions, domain organization,and zinc binding groups. J Chem Inf Model 47:2439–2448.

Pisani F, Mastrototaro M, Rossi A, Nicchia GP, Tortorella C, RuggieriM, Trojano M, Frigeri A, Svelto M (2010) Identification of two majorconformational AQP4 epitopes for neuromyelitis optica autoanti-bodies binding. J Biol Chem 18:9216–9224.

Rash JE, Yasumura T, Hudson CS, Agre P, Nielsen S (1998) Directimmunogold labeling of aquaporin-4 in square arrays of astrocyteand ependymocyte plasma membranes in rat brain and spinalcord. Proc Natl Acad Sci U S A 95:11981–11986.

Rossi A, Pisani F, Nicchia GP, Svelto M, Frigeri A (2010) Evidences fora leaky scanning mechanism for the synthesis of the shorter M23protein isoform of aquaporin-4: implication in orthogonal arrayformation and neuromyelitis optica antibody interaction. J BiolChem 285:4562–4569.

Saadoun S, Papadopoulos MC, Watanabe H, Yan D, Manley GT,Verkman AS (2005) Involvement of aquaporin-4 in astroglial cellmigration and glial scar formation. J Cell Sci 118:5691–5698.

Silberstein C, Bouley R, Huang Y, Fang P, Pastor-Soler N, Brown D,Van Hoek AN (2004) Membrane organization and function of M1and M23 isoforms of aquaporin-4 in epithelial cells. Am J PhysiolRen Physiol 287:F501–F511.

Sorani MD, Zador Z, Hurowitz E, Yan D, Giacomini KM, Manley GT(2008) Novel variants in human aquaporin-4 reduce cellular waterpermeability. Hum Mol Genet 17:2379–2389.

Sorbo JG, Moe SE, Ottersen OP, Holen T (2008) The molecularcomposition of square arrays. Biochemistry 47:2631–2637.

Takumi Y, Nagelhus EA, Eidet J, Matsubara A, Usami S, Shinkawa H,Nielsen S, Ottersen OP (1998) Select types of supporting cell in theinner ear express aquaporin-4 water channel protein. Eur J Neu-rosci 10:3584–3595.

Tani K, Mitsuma T, Hiroaki Y, Kamegawa A, Nishikawa K, Tanimura Y,Fujiyoshi Y (2009) Mechanism of aquaporin-4’s fast and highlyselective water conduction and proton exclusion. J Mol Biol389:694–706.

SYBYL 8.0 (2007), Tripos International, 1699 South Hanley Rd., St.Louis, MO 63144, USA.

Umenishi F, Verkman AS (1998) Isolation and functional analysis ofalternative promoters in the human aquaporin-4 water channelgene. Genomics 50:373–377.

Verkman AS (2000) Physiological importance of aquaporins: lessonsfrom knockout mice. Curr Opin Nephrol Hypertens 9:517–522.

Verkman AS, Yang B, Song Y, Manley GT, Ma T (2000) Role of waterchannels in fluid transport studied by phenotype analysis of aqua-porin knockout mice. Exp Physiol 85:Spec No. 233S–241S.

Yang BX, Brown D, Verkman AS (1996) The mercurial insensitivewater channel (AQP-4) forms orthogonal arrays in stably trans-fected Chinese hamster ovary cells. J Biol Chem 271:4577–4580.

Zelante L, Gasparini P, Estivill X, Melchionda S, D’Agruma L, GoveaN, Milà M, Monica MD, Lutfi J, Shohat M, Mansfield E, DelgrossoK, Rappaport E, Surrey S, Fortina P (1997) Connexin26 mutationsassociated with the most common form of non-syndromic neuro-sensory autosomal recessive deafness (DFNB1) in Mediterra-neans. Hum Mol Genet 6:1605–1609.

(Accepted 9 September 2011)(Available online 16 September 2011)


978

author's personal copy - dipartimento di farmacia … · author's personal copy...

Documents