Biotechnology

What is biotechnology?

• Biotechnology is formally defined as the science of using living things, and components of living things, to produce goods and services.

• It involves manipulating and modifying organisms, often at the molecular level, to create new and practical applications for agriculture, medicine and industry.

It isn’t new

• It is not new…Bread, fermented beverages and cheese are all products of biotechnology that have been around for thousands of years.

• Even selecting the best crops to plant can be considered an application of biotechnology.

Yeast and bacteria

• Bread, alcohol, yogurt and cheese all involve the action of micro-organism in their creation.

• Bread and alcohol use yeast, while yogurt use bacteria.

• Cheese is made using an enzyme called Rennin. Some cheese also contains molds.

Modern biotechnology

• Modern biotechnology generally refers to alterations carried out on the cell or molecular level.

• This new field of science began in the late 1970’s.

Bacteria gene splicing

• With an increased knowledge of genetics, scientists have been able to isolate individual genes on chromosomes.

• Using substances called restriction enzymes, geneticists have been able to cut out desired genes.

• They are then able to insert these desirable genes into a different organism.

What are restriction enzymes?

• These enzymes were discovered in bacteria.

• Each restriction enzyme recognizes a certain DNA sequence, and cuts it.

• For example: A restriction enzyme may recognize the sequence, “TTGG”.

• Everytime this “enzyme” sees this sequence, it cuts the strand between the T and the G

• This action turns a long strand of DNA into several smaller strands.

Example

• CGTTGGATTACATTGGCCGATATTGGAC• If this strand is treated with our restriction

enzyme that recognizes TTGG we would wind up with this.

• CGTT GGATTACATT GGCCGATATT GGAC

• Instead of one long strand, we know have 4 shorter strands.

Applications

• Geneticists can now use restriction enzymes to cut out useful genes and then insert them into another organisms DNA.

• The human gene for insulin can be cut out of the healthy cell and “spliced” the DNA of a bacteria.

• This new bacterial DNA is called “recombinant DNA”.

• Bacteria with recombinant DNA will now be able to produce Human insulin.

• This processes has saved the lives of literally millions of people suffering from diabetes.

Other applications

• Gene splicing has recreated recombinant DNA in many species.

• Some plants have been genetically altered to be pest and frost resistant.

• Scientists have also used gene splicing to create new animal genotypes and phenotypes.

• http://www.youtube.com/watch?v=n0UzdYRnMtY

Cloning

• Cloning is the creation of an organism that is genetically identical to another organism.

• Cloning in plants has been going on for thousands of years.

• Many plants make clones of themselves without any human intervention.

• In other cases, plants with desirable characteristics were cloned by taking a cutting from that plant and growing a new plant.

Animal cloning

• First attempted in 1950’s frogs, fish and mice were created.

• In these cases the DNA of non-differentiated embryonic cells was removed and placed into an egg cell.

• The failure rate was very high. Very few clones were created.

• Dolly the sheep was something different.

Somatic Cell Nuclear Transfer

• Or SCNT is the process by which the entire nucleus of an adult somatic cell is removed and placed into an egg cell that has its nucleus removed.

• This is the process used to create Dolly.

• http://www.youtube.com/watch?v=3TFF6Gbx8tk

Ethics and cloning.

• Since Dolly the sheep was cloned in 1998, many other mammals have been cloned in this manner.

• Cat and Dog owners have paid tens of thousands of dollars to create clones of their beloved pets.

• The technology exists so what about cloning humans?

Human cloning

• There are two main branches to consider.

• Theraputic cloning would involve the cloning of human cells for medical purposes.

• This type of cloning could lead to the treatment of such diseases as cancer and diabetes.

Reproductive cloning

• In this type of cloning an entire human being would be cloned creating a new individual.

• http://www.youtube.com/watch?v=7tbxN5uwaqA

• Can you think of arguments for human reproductive cloning?

• Can you think of arguments against human reproductive cloning?