biotechnology and your health

Biotechnology in the 21st Century

Biotechnology and Your HealthPharmaceutical Applications

Biotechnology on the Farm and in the FactoryAgricultural and Industrial Applications


Bioinformatics, Genomics, and ProteomicsGetting the Big Picture

The Ethics of Biotechnology



Bernice Schacter


All links and web addresses were checked and verified to be correct at the time of publication.Because of the dynamic nature of the web, some addresses and links may have changed since publication and may no longer be valid.

BIOTECHNOLOGY AND YOUR HEALTH

Copyright © 2006 by Infobase Publishing

All rights reserved. No part of this book may be reproduced or utilized in any form or by any means, elec-tronic or mechanical, including photocopying, recording, or by any information storage or retrieval systems,without permission in writing from the publisher. For information contact:

Chelsea HouseAn imprint of Infobase Publishing132 West 31st StreetNew York NY 10001

ISBN-10: 0-7910-8519-8ISBN-13: 978-0-7910-8519-6

Library of Congress Cataloging-in-Publication DataSchacter, Bernice Zeldin, 1943–

Biotechnology and your health: pharmaceutical applications/Bernice Schacter.p. cm.—(Biotechnology in the 21st century)

Includes bibliographical references and index.ISBN 0-7910-8519-8

1. Pharmaceutical biotechnology. 2. Medical technology. I. Title. II. Series.RS380.S33 2005615'.19—dc22 2005010397

Chelsea House books are available at special discounts when purchased in bulk quantities for businesses,associations, institutions, or sales promotions. Please call our Special Sales Department in New York at (212) 967-8800 or (800) 322-8755.

You can find Chelsea House on the World Wide Web at http://www.chelseahouse.com

Text and cover design by Keith Trego

Printed in the United States of America

Bang 21C 10 9 8 7 6 5 4 3 2

This book is printed on acid-free paper.

Foreword by Dr. Kary B. Mullis ix

Introduction xxiii

1 What Is Biotechnology? 1

2 Natural Products as Drugs 22

3 Large Molecules 34

4 Types of Recombinant Drugs 45

5 Uses for Recombinant Protein Drugs 61

6 Gene Therapy to Treat Disease 83

7 Gene Therapy for Cancer Treatment 96

8 Replacing Cells 106

9 Organ Transplantation 121

10 Lab Tests Using Recombinant Components 130

A History of Biotechnology 145

Glossary 149

Bibliography 163

Further Reading 168

Websites 169

Index 170

Table of Contents

Developing the Tools and Methods of Modern Biotechnology 2

Mendelian Genetics 2Stop and Consider 3What Is a Gene? 4

Unlocking the Secret of DNA 4Stop and Consider 7From Gene to Protein 7

The Biotechnologist’s Toolbox 8How to Engineer a Gene 8

The Polymerase Chain Reaction 10Delivering the Gene to Its New Home 10How Does PCR Work? 11Living Factories 12Choosing Which Cell to Engineer 14Cloning 15Using Whole Animals and Plants 16

Connections 20Reproductive Cloning 20

CHAPTER 1 WHAT IS BIOTECHNOLOGY? . . . . . . . . . . . . . . . . 1

Detailed Table of Contents

Natural Cures for Ancient Diseases 22From Dyes to Drugs 23

Stop and Consider 23

Finding Medicines in Nature 25FDA Approval of New Drugs 26Protection of Human Test Subjects 27

The Discovery of Antibiotics 28Who Owns Nature’s Medicine Cabinet? 29Alexander Fleming and the Discovery of Penicillin 32Stop and Consider 33

Connections 33

CHAPTER 2 NATURAL PRODUCTS AS DRUGS . . . . . . . . . . . . 22

Innoculation: Medical Breakthrough and Social Fad 34Vaccination: Less Risky and MoreEffective 35

The Immune System—Our Best Defense 37


The Use of Insulin: Replacing What Is Not Working 39The Use of Human Growth Hormone 39

The Discovery of Insulin: A Lifesaver 40Stop and Consider 42

Connections 43Prion Diseases 43

CHAPTER 3 LARGE MOLECULES . . . . . . . . . . . . . . . . . . . . . 34

Protein Factories 45Bacteria at Work 47

Changing the Bacterium’sDNA 48

Changing the Protein 48

The Shape of Proteins 50

Another Kind of Factory: Producing Sugars 52

Using Antifreeze to Keep Proteins in the Blood 53Choosing a Production System 54The Production of Antibodies 55

Stop and Consider 56Different Animals and Different Antibodies 56Stop and Consider 58

Connections 60

CHAPTER 4 TYPES OF RECOMBINANT DRUGS . . . . . . . . . . . 45

INTRODUCTION . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xxiii

FOREWORD BY KARY MULLIS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix

Pioneers and Medical Advances 61Replacing Missing Proteins 62

PRO OR CON? Are the Prices for Biotechnology Fair? 64

The Need to Make Treatments Safe 65Treating Hemophilia 65

Working With Blood Cells 67The Production of New Blood Cells 70Red Blood Cells and Erythropoietin 72Helping the Body Fight Infection 73

Immune System Drugs 74Stop and Consider 74Suppressing the Immune Response 74Stop and Consider 78

Treating Heart Disease 78Cancer Treatment 79

Monoclonal Treatments for Cancer 80Stop and Consider 81

Connections 82

CHAPTER 5 USES FOR RECOMBINANT PROTEIN DRUGS . . . . 61

The Ashanti de Silva Case 83Vectors: Getting Genes Inside Cells 86

The Human Genome Project 86

Problems with Gene Therapy 89Stop and Consider 90

Unintended Consequences of Gene Therapy 91

Immune Deficient Children 91Stop and Consider 91Death of a Gene Therapy Volunteer 92PRO OR CON? Children in Clinical Trials 94Stop and Consider 95

Connections 95

CHAPTER 6 GENE THERAPY TO TREAT DISEASE . . . . . . . . . . 83

Immune-based Cancer Gene Therapy Strategies 98

Stop and Consider 98The Use of Antisense 101

Cancer: Done in by Genes 102Stop and Consider 105

Connections 105

CHAPTER 7 GENE THERAPY FOR CANCER TREATMENT. . . . . 96

Blood Transfusions 106

Stem Cells 110U.S. Policy on Stem Cell Research 111

Blood-forming Stem Cells 113

Multitalented Stem Cells 113


Possibilities of Stem Cell Therapy 116Challenges That Face Stem Cell Research 117Stop and Consider 118Ethical Arguments 118Stop and Consider 119

Connections 119

CHAPTER 8 REPLACING CELLS . . . . . . . . . . . . . . . . . . . . . 106

Organ Transplant Successes and Failures 121Taking Organs from Other Animals 124

Organs from Primates 124Stop and Consider 125

PRO OR CON? Ethical Issues of Animal-to-Human Transplants 126

Stop and Consider 127Organs from Non-primates 127Stop and Consider 129

Connections 129

CHAPTER 9 ORGAN TRANSPLANTATION . . . . . . . . . . . . . . 121

Monoclonal Antibody Tests 130Diagnosing Infections 131Other Diagnostic Uses 131Home-based Tests 131

DNA Sequencing Tests 132Testing for HIV 132Tests for Genetic Conditions 134What Is PCR? 134Stop and Consider 136

DNA Provides Clues About Common Illnesses 137

DNA Marker Tests 138

Could the Results of a Genetic Test Be Used to Harm You? 138

How Are Forensic DNA Tests Done? 139


The Use of DNA Microarray 141

Connections 144

CHAPTER 10 LAB TESTS USING RECOMBINANT COMPONENTS . . . . . . . . . . . . . . . . . . . . . . . 130

A HISTORY OF BIOTECHNOLOGY. . . . . . . . . . . . . . . . . . 145

GLOSSARY . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 149

BIBLIOGRAPHY . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 163

FURTHER READING. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 168

WEBSITES. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 169

INDEX . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 170

The processes that eventually led to life began inside the firstgeneration of stars that resulted after what astrophysicists refer toas the Big Bang. The events associated with the Big Bang markthe beginning of our universe—a time during which such simpleelements as hydrogen and helium were turned by gravitationalpressure and heat into carbon, oxygen, nitrogen, magnesium,chlorine, calcium, sodium, sulfur, phosphorous, iron, and otherelements that would make the formation of the second generationof stars and their planets possible. The most familiar of theseplanets, our own planet Earth, would give rise to life as we knowit—from cells and giant squids to our own human race.

At every step in the processes that led to the rich variety of lifeon Earth, the thing that was forming in any particular environmentwas capable of transforming, and did, transform that environment.Especially effective at transformation was that class of things that

Foreword

we now refer to as replicators. We know of two examples ofreplicators: genes and memes. (The latter rhymes with “creams.”)

Genes and memes exist in cells, tissues, and organs. But memesmostly are in brains, and human religions and civilizations. Near thebottom of the hierarchy it’s all genes and near the top it’s morememes. Genes appeared independently of cells, and are responsiblefor most of what we call biological life, which can be thought of asa soft and comfortable vehicle made mostly of cells, and created andmaintained by the genes, for their efficient replication and evolu-tion. Amazingly, the existence of replicators is all it takes to explainlife on Earth; no grand creation, no intelligent design, no constantmaintenance; at first just genetic replicators and natural selection,and as far as we know, just one more thing, which appeared afterthere were human brains big enough to support them: memes.

Genes you’ve already heard of; but memes may be a completelynew term to you. Memes follow the same rules as genes and theirnatural selection and evolution account for everything that thenatural selection of genes doesn’t. For instance, our brains arealmost too large for our upright stance and therefore must some-how answer to a calling other than the mere replication of ourgenes, which were doing okay without the extra pint of whitematter we gained in the last 50,000 years. The striking increase inbrain size means something powerful is strongly benefiting fromour increased brain capacity. The best explanation for this, accord-ing to Richard Dawkins, in his best selling and robustly influentialbook, The Selfish Gene, is that our brains are particularly welladapted for imitation, and therefore for the replication of memes.Memes are things like words, ideas, songs, religious or politicalviewpoints, and nursery rhymes. Like genes, they exist for them-selves—that is, they are not here to promote us or anything else,and their continued existence does not necessarily depend on theirusefulness to anything: only to their fecundity, their ability to copythemselves in a very precise, but inexact way, and their relative

FOREWORDx

stability over time. It is these features of genes and of memes thatallow them to take part in natural selection, as described by Darwinin 1859, in spite of the fact that he was unaware of the nature of thetwo replicators. After 150 years, we have started to understand thedetails. Looking back on it from only a century and a half, Darwin’sconception was probably the most brilliant that mankind haschanced upon in our relatively short time here on Earth. What elsecould possibly explain dandelions?

Dawkins realized that the genes were evolving here, not us.We are just the vessel, and Dawkins realized the significance ofreplicators in general. After that, the field opened up rather widely,and must include Stan Cohen and Herbert Boyer, whose notion,compounded in 1973 in a late-night deli in Oahu, of artificiallyreplicating specific genes underlies most of the subject matter inthis rather important series of books.

SO WHAT’S SO IMPORTANT ABOUT GENES AND MEMES?

I’m sure that most of you might want to know a little bit about thestuff from which you are made. Reading the books in this series willteach you about the exciting field of biotechnology and, perhapsmost importantly, will help you understand what you are (now payattention, the following clause sounds trivial but it isn’t), and giveyou something very catchy to talk about with others, who will likelypass along the information to others, and so on. What you say tothem may outlive you. Reading the books in this series will exposeyou to some highly contagious memes (recall that memes arewords, ideas, etc.) about genes. And you will likely spread thesememes, sometimes without even being aware that you are doing so.

THE BIRTH OF BIOTECHNOLOGY—OAHU 1973

So what happened in Oahu in 1973? Taking the long view, nothingreally happened. But we rarely take the long view, so let’s take theview from the 70s.

xiFOREWORD

At the time, it was widely held that genes belonged to a partic-ular organism from whose progenitors the gene had been passed toan organism and that the organism in question would pass the geneto its offspring, and that’s the only way that genes got around. Itmade sense. Genes were known by then to carry the instructions forbuilding new organisms out of the germinal parts of old organisms,including constructing a wide array of devices for collecting thenecessary raw materials needed for the process from the environ-ment; genes were the hereditary mechanism whereby like begatlike, and you looked like your parents because of similar genes,rather than looking like your neighbors. The “horizontal transfer”of genes from one species to another was not widely contemplatedas being possible or desirable, in spite of the fact that such transferwas already evident in the animal and plant worlds—think ofmules and nectarines. And “undesirable” is putting it rather mildly.A lot of people thought it was a horrible idea. I was a researchscientist in the recombinant laboratories of Cetus Corporation in1980, during which time Cetus management prudently did notadvertise the location of the lab for fear that the good people ofBerkeley, California (a town known for its extreme toleranceof most things) might take offense and torch our little convertedwarehouse of a lab. Why this problem in regard to hybrid lifeforms? Maybe it had something to do with the fact that muleswere sterile and nectarines were fruit.

Apples have been cultivated in China for at least 4,000 years.The genetic divergence from the parental strains has all beenaccomplished by intentional cultivation, including selection ofcertain individuals for properties that appealed to our farmingancestors; and farmers did so without much fanfare. The Chinesefarmers were not aware that genes were being altered permanentlyand that was the reason that the scions from favored appletrees, when grafted onto a good set of roots, bred true. Butthey understood the result. Better apple genes have thus been

FOREWORDxii

continually selected by this process, although the process through-out most of history was not monitored at the genetic level. Thefarmers didn’t have any scary words to describe what they weredoing, and so nobody complained. Mules and nectarines andGranny Smith apples were tolerated without anyone giving a hoot.

Not so when some educated biologists took a stab at the samething and felt the need to talk about it in unfamiliar terms to eachother, but not the least to the press and the businessmen who werethinking about buying in. There was, perhaps, a bit too muchhyperbole in the air. Whatever it was, nobody was afraid of apples,but when scientists announced that they could move a human geneinto a bacterium, and the bacterium would go on living and copyingthe gene, all hell broke loose in the world of biology and the sleepylittle discipline of bioethics became a respectable profession. Out ofthe settling dust came the biotechnology industry, with recombinantinsulin, human growth hormone, erythropoietin, and tissue plas-minogen activator, to name a few.

CETUS IN 1980

The genie was out of the bottle. Genes from humans had been putinto terrified bacteria and the latter had survived. No remarkablenew bacteremias—that is, diseases characterized by unwantedbacteria growing in your blood—had emerged, and the initialhesitancy to do recombinant DNA work calmed down. Cetus builta P-3, which was something like an indoor submarine, with labsinside of it. The P-3 was a royal pain to get in and out of; but it hadwindows through which potential investors could breeze by andbe impressed by the bio-suited scientists and so, just for theinvestment it encouraged, it was worth it. Famous people like PaulBerg at Stanford had warned the biotech community that we wereplaying with fire. It stimulated investment. When nobody diedbleeding from the eyeballs, we started thinking maybe it wasn’tall that scary. But there was something in the air. Even the janitors

xiiiFOREWORD

pushing their brooms through the labs at night and occasionalscientists working until dawn, felt that something new and promis-ing was stirring.

My lab made oligonucleotides, which are little, short, single-stranded pieces of DNA, constructed from the monomers A, C, T,and G that we bought in kilogram quantities from the Japanese,who made them from harvested salmon sperm (don’t ask mehow). We broke these DNA pieces down into little nucleosideconstituents, which we chemically rebuilt into 15- to 30-base longsequences that the biologists at Cetus could use to find the bigpieces, the genes, that coded for things like interferons, inter-leukins, and human proteins.

We were also talking about turning sawdust into petroleumproducts. The price of petroleum in the world was over $35 abarrel, if my memory serves me at all, which was high for thedecade. A prominent oil company became intrigued with thesawdust to petroleum idea and gave us somewhere between$30 or $40 million to get us started on our long-shot idea.

The oil company funding enabled us to buy some very expen-sive, sensitive instruments, like a mass spectrometer mounted onthe backside of a gas chromatograph, now called GCMS. It waspossible under very special conditions, using GCMS, to prove thatit could be done—glucose could be converted biologically intolong chain hydrocarbons. And that’s what gasoline was, andsawdust was mainly cellulose, which was a polymer of glucose, sothere you have it. Wood chips into gasoline by next year. Therewere a few details that have never been worked out, and now it hasbeen a quarter of a very interesting century in which the incentive,the price of oil, is still very painful.

My older brother Brent had gone to Georgia Tech as had I.He finished in chemical engineering and I in chemistry. Brentworked for a chemical company that took nitrogen out of theair and methane out of a pipe and converted them into just

FOREWORDxiv

about anything from fertilizer to the monomers needed to makethings like nylon and polyethylene. Brent and I both knew aboutchemical plants, with their miles of pipes and reactors andabout a century of good technical improvements, and that thequantities of petroleum products necessary to slake the globalappetite for dark, greasy things would not fit easily into indoorsubmarines. We had our doubts about the cellulose to oil program,but proteins were a different thing altogether. Convincing bacteria,then later yeasts and insect cells in culture, to make human proteinsby inserting the proper genes not only seemed reasonable to usbut it was reasonable.

WE DID IT!

I remember the Saturday morning when David Mark first found anE. coli clone that was expressing the DNA for human beta-interferonusing a P32 labeled 15-base long oligonucleotide probe that mylab had made. Sometimes science is really fun. I also remember theFriday night driving up to my cabin in Mendocino County when Isuddenly realized you could make an unlimited amount of anyDNA sequence you had, even if what you had was just a tiny partof a complex mixture of many DNAs, by using two oligos and apolymerase. I called it Polymerase Chain Reaction. The name stuck,but was shortened to PCR.

We were down in a really bad part of town, Emeryville beingthe industrial side of Berkeley; but we were young and brave, andsometimes it was like an extended camping trip. There were traintracks behind our converted warehouse. You could walk downthem during the daytime to an Indian restaurant for lunch, or ifyou could manage to not be run over by a train late at night whilea gel was running or an X-ray plate was exposing, you could creepover across the tracks to the adjacent steel mill and watch white hotsteel pouring out of great caldrons. In the evenings, you could goup on the roof and have a beer with the president of the company.

xvFOREWORD

Like the Berkeley of the late Sixties which had preceded it, it was atime that would never happen again.

Today, nobody would be particularly concerned about therepercussions of transferring a gene out of bacteria, say a gene outof Bacillus thuringiensis inserted into a commercial strain of corn,for instance. Genes now have found a new way to be movedaround, and although the concept is not revolutionary, the rateat which it is happening is much faster than our own genes canreact. The driver, which is the case for all social behaviors inhumans today, is the meme. Memes can appear, replicate, anddirect our actions as fast as thought. It isn’t surprising, but itdoes come as a shock to many people when they are confrontedwith the undisputed fact that the evolving elements in what wehave referred to as biological evolution, which moves us fromHomo habilus to Homo sapiens, are genes; not organisms,packs, species, or kinship groups. The things that evolve aregenes, selfishly. What comes as an even more shocking surprise,and which in fact is even less a part of the awareness of most ofus, is that our behavior is directed by a new replicator in theworld, the meme.

YOU MAY WANT TO SKIP THIS PART

(Unless You’re Up for Some Challenging Reading)

Let’s digress a little, because this is a lot of new stuff for somepeople and may take a few hours to soak in. For starters, whatexactly is a gene? . . . Atgaagtgtgccgtgaaagctgctacgctcgacgctc-gatcacctggaaaaccctggtag . . . could be the symbol for a gene, arather short gene for our editorial convenience here (most ofthem have thousands of letters). This rather short gene wouldcode for the peptide met-lys-cys-ala-val-lys-gly-gly-thr-leu-asp-ala-arg-ser-pro-gly-lys-pro-trp, meaning that in a cell, it woulddirect the synthesis of that string of amino acids, (which may ormay not do something very important).

FOREWORDxvi

Getting back to the gene, it may share the organism as anenvironment favoring its replication with a whole gang of otherreplicators (genes), and they may cooperate in providing a comfylittle protected enclave in which all of the genes develop a meansto replicate and cast their sequences into the future all usingthe same mechanism. That last fact is important as it separatesa cellular gene from a viral gene, but I won’t belabor it here. Review-ing just a little of what I’ve infected you with, that sequence ofAGCT-type letters above would be a replicator, a gene, if it didthe following:

(1) exhibited a certain level of fecundity—in other wordsit could replicate itself faster than something almostlike it that couldn’t keep up;

(2) its replication was almost error-free, meaning thatone generation of it would be the same as the nextgeneration with perhaps a minor random change thatwould be passed on to what now would be a branchof its gene family, just often enough to provide somevariation on which natural selection could act; and

(3) it would have to be stable enough relative to the gen-eration time of the organism in which it found itself,to leave, usually unchanged, with its companion geneswhen the organism reproduced.

If the gene goes through the sieve of natural selection success-fully, it has to have some specific identity that will be preservedlong enough so that any advantage it confers to the rate of its ownreplication will, at least for some number of generations, be associ-ated with its special identity. In the case of an organic replicator,this specialness will normally be conferred by the linear sequenceof letters, which describe according to the genetic code, a linear

xviiFOREWORD

sequence of amino acids in a peptide. The process is self-catalyticand almost irreversible, so once a sequence exhibits some advantagein either (1), (2), or (3) above, all other things being nearly equal, itis selected. Its less fortunate brethren are relatively unselected andthe new kid on the block takes over the whole neighborhood. Seehow that works?

This should not be shocking to you, because it is a tautology,meaning it implies nothing new. Some people, however, are accus-tomed to the notion that genes and individual organisms serve thegreater good of something they call a species, because in the speciesresides an inviolate, private gene pool, which is forever a part ofthat species. This concept, whether you like it or not, is about asmeaningful—and now I guess I will date myself—as the notion thatRoger Waters is forever and always going to be playing with PinkFloyd. It isn’t so. Waters can play by himself or more likely withanother group. So can genes. And don’t forget that not only genes,but also an entirely different kind of replicator is currently usingour bodies as a base of operations. Genes have a reaction time thatis slow relative to the lifetime of an individual. It takes a long timefor genes to respond to a new environment. Memes can undergovariation and selection at the speed of thought.

Let’s leave the subject of memes for awhile. They are animmense part of every human now, but biotechnology as practicedin the world and described in this book does not pay them muchmind. Biotechnologists are of the impression that their world isof genes, and that’s alright. A whole lot happened on Earthbefore anybody even expected that the place was spinning andmoving through space, so memes can wait. I thought I ought towarn you.

It is worth noting that new gene sequences arise from pre-existing gene sequences but gene molecules are not made out of oldgenes. Gene molecules are made out of small parts that may havebeen in genes before, but the atoms making up the nucleotides that

FOREWORDxviii

are strung together and constitute today’s incarnation of a gene,may have two weeks ago been floating around in a swamp as ureaor flying out of a volcano as hot lava. A gene sequence (notice thatmolecule is not equal to sequence) that makes itself very useful maylast millions of years with hardly a single change. You may findprecisely the same gene sequence in a lot of very different specieswith few significant changes because that sequence codes for someprotein like cytochrome C that holds an iron atom in a particularlyuseful way, and everybody finds that they need it. It’s a more classicdesign than a Jaguar XK and it just keeps on being useful throughall kinds of climatic eras and in lots of different species. Thesequence is almost eternal. On the very different other hand, thespecific molecular incarnations of a gene sequence, like the DNAmolecule that encodes the cytochrome C sequence in an individ-ual cell of the yeast strain that is used, for example, to make myfavorite bread, Oroweat Health Nut, is ephemeral. The actualmolecules strung together so accurately by the DNA polymeraseto make the cytochrome C are quickly unstrung in my smallintestine as soon as I have my morning toast. I just need the carbon,nitrogen, and phosphorous. I don’t eat it for the sequence. AllDNA sequences taste the same, a little salty if you separate themfrom the bread.

That’s what happens to most chemical DNA molecules. Some-body eats them and they are broken down into general purposebiological building blocks, and find their way into a new anddifferent molecule. Or, as is often the case in a big organism likeArnold Schwarzenegger, body cells kill themselves while GovernorSchwarzenegger is still intact because of constantly undergoingperfectly normal tissue restructuring. Old apartments come down,new condos go up, and beautiful, long, perfectly replicated DNAsequences are taken apart brick by brick. It’s dangerous stuff toleave around on a construction site. New ones can be made. Theenergy just keeps coming: the sun, the hamburgers, the energy bars.

xixFOREWORD

But the master sequences of replicators are not destroyed. Fewgerm cells in a woman’s ova and an embarrassingly large numberof germ cells in a male’s sperm are very carefully left more or lessunaltered, and I say more or less, because one of the most impor-tant processes affecting our genes, called recombination, does alterthe sequences in important ways; but I’m not going to talk about ithere, because it’s pretty complicated and this is getting to be toolong. Now we are ready to go back to the big question. It’s a simpleanswer, but I don’t think you are going to get it this year.

If . . . atgaagtgtgccgtgaaagctgctacgctcgacgctcgatcacctggaaaaccct-ggtag . . . is a gene, then what particular format of it is a gene? Forthis purpose, let’s call it a replicator instead of a gene, because allgenes are after all replicators. They happen to encode proteinsequences under certain conditions, which is one of our main usesfor them. As I’ve mentioned, the one above would code for theprotein met-lys-cys-ala-val-lys-gly-gly-thr-leu-asp-ala-arg-ser-pro-gly-lys-pro-trp with the final “tag” being a punctuation markfor the synthesis mechanism to stop. We make other uses of them.There are DNA aptamers, which are single-stranded DNA poly-mers useful for their three-dimensional structures and ability tospecifically cling to particular molecular structures, and thenthere is CSI, where DNA is used purely for its ability to distinguishbetween individuals. But replication for the genes is their reason forbeing here. By “reason for being here,”I don’t mean to imply that theyare here because they had some role to fulfill in some overall scheme;I just mean simply that they are here because they replicate—it’s assimple or impossible to understand as that. Their normal way ofreplication is by being in their molecular form as a double strandedhelical organic polymer of adenosine, guanosine, thymidine, andcytosine connected with phosphate linkages in a cell. Or they couldbe in a PCR tube with the right mixture of nucleoside triphosphates,simple inorganic salts, DNA polymerase, and short strands of single-stranded DNA called primers (we’re getting technical here, that’s

FOREWORDxx

why you have to read these books). Looking ahead, DNA poly-merase is a molecular machine that hooks the triphosphate formof four molecular pop beads called A, C, T, and G together into longmeaningful strings.

Okay, getting back to the question, is the gene, . . . atgaagtgt-gccgtgaaagctgctacgctcgacgctcgatcacctggaaaaccctggtag . . . always theorganic polymer form of the sequence, which has a definite mass,molecular weight, chemical structure, or is the Arabic letter form ofit in your book still a gene, or is the hexadecimal representation ofit, or the binary representation of it in your CPU a gene, or is anequivalent series of magnetic domains aligned in a certain way onyour hard disk just another form of a gene? It may sound like adumb question, but it isn’t. If you are insistent that a gene is justthe organic polymer of A, C, T, and G that can be operated on byDNA polymerase to make replicas in a cell, then you may take aminute to think about the fact that those little triphosphatederivatives of A, C, T, and G may not have been little nucleotideslast month when they were instead disembodied nucleotide piecesor even simple atoms. The atoms may have been residing in thingscalled sugars or amino acids in some hapless organism thathappened to become food for a bigger organism that containedthe machinery that assembled the atoms into nucleotides, andstrung them into the sequence of the gene we are talking about.The thing that is the same from generation to generation isthe sequence, not the molecule. Does that speak to you? Doesit say something like maybe the symbol of the gene is more thegene than the polymer that right now contains it, and thecomprehensive symbolic representation of it in any form at allis a replicator? This starts to sound pretty academic, but in anybiotechnology lab (and you will read about some of them in thisseries) making human proteins to sell for drugs, the genes for theproteins take all the above mentioned forms at one time oranother depending on what is appropriate, and each of them can

xxiFOREWORD

be reasonably called a replicator, the gene. Genetic engineering isnot just the manipulation of chemicals.

SKIP DOWN TO HERE

These books are not written to be the behind the scenes story ofgenes and memes any more than a description of an integratedcircuit for someone who wants to use it in a device for detectingskin conductivity or radio waves is about quantum mechanics.Quantum mechanics is how we understand what’s happeninginside of a transistor embedded in an integrated circuit in youriPod or described in the Intel catalogue. By mentioning what’sgoing on inside biotechnology, I hope to spark some interest in youabout what’s happening on the outside, where biotechnology is, soyou can get on about the important business of spreading thesememes to your friends. There’s nothing really thrilling about grow-ing bacteria that make human hormones, unless your cousin needsa daily injection of recombinant insulin to stay alive, but the wholeprocess that you become involved in when you start manipulatingliving things for money or life is like nothing I’ve found on theplanet for giving you the willies. And remember what I said earlier:you need something to talk about if you are to fulfill your role as ameme machine, and things that give you the willies make great andeasily infectious memes. Lowering myself to the vernacular for thesake of the occasional student who has made it this far, “Biotech isfar out man.” If you find something more interesting, let me know.I’m at [email protected], usually.

Dr. Kary B. MullisNobel Prize Winner in Chemistry, 1993

President/Altermune, LLC

FOREWORDxxii

IntroductionBIOTECHNOLOGY: AN INTRODUCTION

Biotechnology, the use of biological organisms and processes toprovide useful products in industry and medicine, is as old ascheese making and as modern as creating a plant-based energy cellor the newest treatment for diabetes. Everyday, newspaper articlesproclaim a new application for biotechnology. Often, the mediaraises alarms about the potential for new kinds of biotechnologyto harm the environment or challenges our ethical values. As aresult of conflicting information, sorting through the headlinescan be a daunting task. These books are designed to allow youto do just that—by providing the right tools to help you to makebetter educated judgments.

The new biotechnologies share with the old a focus on helpingpeople lead better, safer, and healthier lives. Older biotechnologies,such as making wine, brewing beer, and even making bread, were

based on generations of people perfecting accidental discoveries.The new biotechnologies are built on the explosion of discoveriesmade over the last 75 years about how living things work. Inparticular, how cells use genetic material to direct the productionof proteins that compose them, and provide the engines used toproduce energy needed to keep them alive. These discoveries haveallowed scientists to become genetic engineers, enabling them tomove genes from one living organism to another and change theproteins made by the new organism, whether it is a bacterium,plant, mouse, or even a human.

Biotechnologists first engineered bacterial cells, producing newproteins useful in medicine and industry. The type of cell thatbiotechnologists engineer today may be a simple bacterium or acomplicated animal or human cell. The protein product might bea simple string of amino acids or a complicated antibody of fourchains, with critical genetic instructions from both mice andhumans. Plant biotechnologists engineer plants to resist predatoryinsects or harmful chemicals to help farmers produce more, withless risk and expense. Plants have also been engineered to makeproducts useful for industry and manufacturing. Animals havebeen engineered for both research and practical uses.

Research is also underway to develop methods of treatinghuman diseases by changing the genetic information in the cellsand tissues in a patient’s body. Some of these efforts have beenmore successful than others and some raise profound ethical con-cerns. Changing the genetic information of a human may one dayprevent the development of disease, but the effort to do so pushesthe envelope of both ethics and technology. These and other issuesraised by advances in biotechnology demand that we as citizensunderstand this technology, its promise, and its challenge so thatwe can provide appropriate limits on what biotechnologists create.

Who are the biotechnologists, the genetic engineers? Generally,they have university or advanced training in biology or chemistry.

INTRODUCTIONxxiv

They may work in a university, a research institute, a company, orthe government. Some are laboratory scientists trained in the toolsof genetic engineering–the laboratory methods that allow a genefor a particular protein to be isolated from one living creature’sDNA and inserted into another’s DNA in a way that instructs thenew cell to manufacture the protein. Some are computer scientistswho assemble databases of the DNA and protein sequences ofwhole organisms. They may write the computer code that allowsother scientists to explore the databases and use the informationto gain understanding of evolutionary relationships or make newdiscoveries. Others work in companies that engineer biologicalfactories to produce medicines or industrial plastics. They mayengineer plants to promote faster growth and offer better nutrition.A few have legal training that allows them to draft or review patentsthat are critical to the business of biotechnology. Some even workin forensic laboratories, processing the DNA fingerprinting yousee on TV.

The exact number of working biotechnologists is hard to deter-mine, since the job description doesn’t neatly fit into a conventionalslot. The U.S. Department of Labor indicates that there are over75,000 Master’s and Ph.D.-level biologists in the U.S. and Bio.org,the Website for the Biotechnologies Industry Organization, reportsnearly 200,000 biotechnologists are currently employed.

Biotechnology is not just the stuff of the future. The workof modern biotechnology and genetic engineering is in our dailylives, from the food we eat and clothing we wear to some of themedicines we take. The ketchup you put on your fries at lunch todaymay have been sweetened with corn syrup made from corn that wasengineered to resist a deadly insect. The cotton in your T-shirt, evenif the shirt were made in China or Bangladesh, probably came froma U.S. cotton plant genetically engineered to resist another insect.If someone in your family is a diabetic, the insulin he or she injectsand the glucose test monitor used to determine the amount of

xxvINTRODUCTION

insulin to inject rely on biotechnology. If you go to the doctor andshe arranges for blood tests, the laboratory uses biotechnologyproducts to run those tests.

This series, BIOTECHNOLOGY IN THE 21ST CENTURY, was developedto allow you to understand the tools and methods of biotechnology,and to appreciate the current impact and future applications ofbiotechnology in agriculture, industry, and your health. This seriesalso provides an exploration of how computers are used to managethe enormous amount of information produced by geneticresearchers. The ethical and moral questions raised by the technology,whether they involve changing the genetic information of livingthings or using cells from human embryos to develop new ways totreat disease, are posed with a foundation in how moral philosophersthink about ethical issues. With these tools, you will be better able tounderstand the headlines about the latest advances in biotechnologyand the alarms raised by those concerned with the impact that theseapplications have on the environment and our society. You may evenbe inspired to learn more and join the community of scientists whowork on finding new and better ways to produce food, products,and medical treatments.

Bernice Zeldin Schacter, Ph.D.Series Editor

INTRODUCTIONxxvi

Biotechnology, in its most general meaning, is the use of biologicprocesses to create a product for human use and benefit. Today,when people use the term biotechnology, we usually think theymean the application of modern methods of manipulation of DNA

(deoxyribonucleic acid), the genetic information of an organism, tomake a product. In fact, biotechnology is ancient, providing the basisfor making a wide range of products, including bread, cheese, beer,and wine. These early forms of biotechnology relied on fermentation,the breakdown by microorganisms of organic molecules, particularlysugars, into simpler compounds, often CO2 (carbon dioxide). Inpractice, fermentation involves holding the material under condi-tions that allow the microorganisms to increase in number, and tochange the original material through chemical reactions inside thecells. The starting material in fermentation can be bread dough,made of flour, water, and yeast, or grape juice plus yeast.

1

What Is Biotechnology?

1

To make bread, after the dough is kneaded to make the gluten(flour protein) stringy, the dough is kept at a warm temperature toallow the yeast cells to multiply in number. The yeast cells needenergy to grow, so they break down sugars in the flour to CO2,creating pockets of gas. This gas makes the dough rise. When thebread is baked, the gluten dries out and the bread is filled withmany small holes.

Wine makers grow yeast submerged in liquid grape pressings.This deprives the yeast of oxygen so that it produces ethanol as awaste product when it metabolizes sugar. A slightly more compli-cated process is used to make beer, but the principle also involvesgrowing yeast cells without oxygen so that they produce ethanol asthey make energy.

Cheese is also made through biotechnology. Rennin, a proteinfound in the stomachs of young cows, is added to milk to makecheese. (Today, rennin is usually made with modern biotechnologymethods.) The rennin breaks down casein, the major protein ofmilk, into small pieces. Then, cheese makers add bacteria to milkto convert (ferment) the lactose sugar in the milk to acid, whichcauses the casein fragments to curdle, making them form semi-solidlumps. The flavor of cheese becomes more intense as it ages, and theflavors concentrate. Adding certain molds during the aging processturns cheese blue in color.

DEVELOPING THE TOOLS AND METHODS

OF MODERN BIOTECHNOLOGY

Mendelian Genetics

Modern biotechnology, defined as the movement and modificationof genes at will, was built on discoveries in genetics and biochem-istry originally made in the first half of the 20th century. Scientistslearned that inherited characteristics or traits, such as hair or eyecolor, are passed from parents to offspring in units of inheritancecalled genes. You may have learned how an Austrian monk named

BIOTECHNOLOGY AND YOUR HEALTH2

Gregor Mendel figured this out in the late 19th century by carefullyconducting breeding experiments with peas. However, his workwas not noticed until 34 years later, when several scientists cameupon his papers and realized the importance of his discoveries.Building on Mendel’s findings, scientists studied plants, animals,and humans, and determined several things: 1) genes are carriedon chromosomes, structures in the cell’s nucleus; 2) genetic informa-tion resides in the chemicals that make up the chromosomes; and3) traits are generally based directly or indirectly on the proteinsproduced in cells.

Proteins (also called polypeptides) are composed of one or morelinear chains of amino acids. There are 20 different amino acids thatshare a common structure, with side chain groups that vary in size,shape, charge, chemical reactivity, and solubility in water. Proteinscan be small (made up of just a few amino acids) or very large(composed of thousands of amino acids). The biochemical prop-erties, three-dimensional shape, and function of each proteinprimarily result from the sequence of the amino acids that makeup the particular protein. Proteins do many things: they providestructure, allow cells and whole organisms to move, and permit cellsto produce and break down all kinds of chemicals to gain nutritionand energy. In complex organisms such as animals, plants, andinsects, many proteins travel around the body to carry gases forrespiration (breathing) and to carry signals between and among cells

3What Is Biotechnology?

Stop and ConsiderIt took 34 years for biologists to appreciate Gregor Mendel’s work onthe genetics of peas. Does it surprise you that something that nowseems like a profound discovery was not immediately recognized?What do you think keeps people, even scientists, from understandingthe importance of a discovery when it is first made?

in different parts of the body. The production of different proteinsby cells is what gives each cell its properties and the organism asa whole its traits. The human body produces more than 70,000different proteins; a single liver cell has approximately 10,000 dif-ferent proteins. Within every cell of every organism, the integrated,finely orchestrated functioning of these proteins, both separate andtogether, is central to life.

What Is a Gene?

To figure out how genes work and how they direct the productionof specific proteins that allow organisms to inherit traits, scientistsstarted with the fact that chromosomes were known to be made upof protein and DNA. A series of experiments using bacteria andviruses that infect bacteria established that DNA, not protein, wasthe basic genetic material. Scientists figured out how DNA “worked”as the genetic material, how it was copied when a cell divided intotwo identical cells, and how DNA determined traits—that is, deter-mined the sequence of amino acids in each protein that allowdifferent traits to be expressed.

DNA molecules are chains of four bases: adenosine (A), cytosine(C), guanine (G), and thymine (T). Each of these bases is slightlydifferent from the others in its chemical makeup. Figuring outthe structure of DNA provided the clues to how DNA worked totransmit genetic information (Figure 1.1).

UNLOCKING THE SECRET OF DNA

In 1962, James Watson, Francis Crick, and Maurice Wilkins won theNobel Prize in Physiology or Medicine for their discovery that thestructure of DNA is a double helix. This double helix is made up oftwo chains of DNA bound to each other by the ability of each A baseto form a weak chemical bond to a T base and each C to a G. Thebases only paired with their base partners, so that where one strandhad a T, the other had an A, and where one had a C, the other had



Figure 1.1 The structure of DNA is illustrated here. DNA is the geneticmaterial of the cell. Through the processes of transcription and translation,the DNA sequence is used to produce first an RNA copy of the gene andthen a protein based on the gene sequence.

a G. This rule of base pairing means that when the strands separatebefore a cell divides into two, the DNA is copied precisely, becausea T in one strand lines up with an A for the new strand, an A linesup with a T, and so on. The bases A and T, as well as C and G, arecalled complementary bases because they form pairs easily.

In the 1960s, scientists developed methods that allowed them tofigure out the order, or sequence, of bases in a DNA molecule. Themethods have been modified over the years so that machines cannow do much of the work, but the principle remains the same. Thesequencing method requires:

• The piece of DNA to be sequenced;

• DNA polymerase, a protein that can make a copy of astrand of DNA in a test tube;

• the four different bases;

• chemically modified versions of bases that, when addedto the strand, stop more bases from being added; and

• a short piece of DNA with a base sequence thatcomplements the sequence at the beginning of the pieceof DNA to be sequenced. (This bit of DNA is called aprimer, and it tells the DNA polymerase where to startadding bases.)

The DNA, the primer, and the four bases are placed in four testtubes. The primer is chemically tagged with dye. Then, a chemicallymodified version of one base—A, T, C, or G—is added to each testtube. The reaction is started with the addition of DNA polymerase.In each tube, sets of DNA strands, complementary to the DNA to besequenced, are made. Synthesis of a strand stops when, at random,the modified form of the base is added. There are millions of copiesof the DNA to be sequenced in each tube, and at the end of anhour or so, there are millions of copies of strands, each stopped


when a modified base is added. At the end of the process, each tube(the A, T, C, and G tubes) will contain a mixture of many copiesof different-sized products, the length of each determined by thelocation of that base. Each reaction mixture is injected into a tubefilled with a plastic-like material that separates the DNA piecesby size. The size of the fragments flowing out of the four tubes is“read” by a machine that picks up the dye molecule of the primer.Computer programs interpret the results and generate the sequenceby analyzing which base is added, as the products of the four tubesget longer, base by base.

From Gene to Protein

Genes are composed of the sequence of As, Ts, Cs, and Gs that thecell decodes to make up a protein. The code for each of the 20 aminoacids is a particular triplet of bases. When a cell manufactures aprotein, intermediate copies of the gene sequence are made, in theform of messenger ribonucleic acid (mRNA), and these copies moveto the ribosomes, the protein-manufacturing structures of the cell.In the ribosome, the code is read from the triplets of RNA basesthat specify the amino acids. RNA is composed of four bases thatare slightly different chemically from the bases of DNA. The sugarportions of the DNA bases have one less oxygen atom than the RNAbases do. Amino acids are shuttled to the ribosome and lined up byanother type of RNA called transfer RNA (tRNA). For each aminoacid, a specific tRNA, carrying the base sequence that complements


Stop and ConsiderMoving genes from one species to another is distasteful to somepeople because it allows genetic changes to occur outside thenatural mating processes. What are your opinions on this issue?Would they be influenced by the planned use of a particularbiotechnology product?

the triplet code for that amino acid, lines up the amino acid by basepair formation with the mRNA on the ribosome. A cell protein thenconnects the amino acids lined up by the mRNA. In this way,the sequence of bases, taken in threes, determines the sequence ofa protein. A gene is thus the sequence of DNA bases that codes fora protein.

The sequence of bases (the order of As, Ts, Cs, and Gs) in a geneor a whole organism can provide useful information, includingdetails that are needed to move a gene from one organism toanother, and insight into how the cell decides to make the proteinencoded in the DNA and how the cells in an organism worktogether. The sequence even provides clues about how differentorganisms are related in evolution. Modern biotechnology isonly one way that scientists are using this information, and thehealthcare applications described in this book are only one part ofmodern biotechnology. Before we dive into the ways biotechnologycan be applied to your health, we have to become familiar with the“biotechnologist’s toolbox.”

THE BIOTECHNOLOGIST’S TOOLBOX

How to Engineer a Gene

The essential task of modern biotechnology is to change an organ-ism’s genetic material (DNA) to allow for the production of a usefulprotein. The gene for the protein must first be isolated and engineeredso that it will drive production of the protein. The product may be theprotein, or it may be a modified organism, such as a bacterium thatcleans up oil spills, a tree that removes mercury from contaminatedsoil, or a virus that treats cancer.

To isolate a gene, scientists use surgical DNA “scissors” calledrestriction endonucleases (RE), proteins made by bacteria that cutDNA, based on specific rules. Each kind of RE—there are hundreds—recognizes specific sequences of 4–8 base pairs and cuts the DNAmolecule at a specific spot (Figure 1.2). The biotechnologist selects


the RE based on the sequence of the DNA at each end of the gene.Many REs make staggered cuts that leave a single-stranded tail ofDNA at each end of the cut piece, which can bind, through the rulesof base pairing, to DNA fragments of other sequences cut by thesame RE.


Figure 1.2 The restriction enzyme ECOR1, illustrated here, is one of hundreds isolatedfrom bacteria and used by biotechnologists to cut DNA molecules so that they can bejoined with other DNA molecules. This allows scientists to insert a desired geneticsequence into a strand of DNA.

The Polymerase Chain Reaction

To prepare a gene for engineering, the scientist generally needsmany millions of identical copies of the gene. Originally, the onlyway to get these copies was to start with a large number of cells or alarge piece of tissue, to use chemicals to extract and purify the DNA,and then to treat the DNA with an RE to clip the desired gene.Today, there is a much faster way to copy the same piece of DNA. Inthe mid-1980s, American chemist Kary Mullis developed a methodthat could make many copies of a stretch of DNA, even when thescientist knew only the sequence of bases at either end of the strand.This technique, called the polymerase chain reaction (PCR), whichwon Mullis the Nobel Prize in Chemistry in 1993, has becomea routine tool used in just about every research, hospital, andcriminal evidence laboratory that works with DNA. It allowsusable amounts of identical DNA molecules to be producedfrom a small sample, about the amount found in just a few cells.

Once the gene has been isolated, the next step is to join it toa molecular “on-switch,” a sequence of DNA that will allow thecell to use the gene to make the desired protein. The on-switch,called a promoter, is matched to the type of cell that will be usedfor production.

Delivering the Gene to Its New Home

The next challenge is to get the desired gene into the new cell. Thetarget cell may be a bacterium, a yeast cell, or a cell from an insect,plant, or mammal. Scientists use delivery systems, called vectors,suited for the cell type, to get the combination of gene and promoter(sometimes called a “cassette”) into the target cell, so that DNA willbe copied each time the cell divides. The most commonly used vectorto get a gene into bacteria is a plasmid, a small circular piece of DNAthat is copied every time the bacterium divides into two, though itdoes not become part of the bacterial DNA. Plasmids have beendeveloped that work as vectors for yeast, plant, and mammal cells.



The DNA isolated from cells, or from another source, is combined with primers and with

DNA polymerase, a protein that copies the DNA between the primers. The trick is to use

a DNA polymerase that can withstand high temperatures. Taq polymerase, widely used in

PCR, was isolated from a bacterium, Thermos aquaticus, discovered growing in a hot

spring. With 20 to 30 repeated cycles of heating to separate the strands of DNA, and then

cooling to allow the primers to bind and the DNA polymerase to copy the region between

the primers again, enough DNA for analysis is made from the sample. Twenty-three

cycles will generate 2,097,152 copies of the original sequence (Figure 1.3).

This ground-breaking technique for making multiple copies of DNA in a test tube was

invented in the 1980s by Kary Mullis, a biochemist. Mullis’ revolutionary technique earned

him a Nobel Prize in Chemistry in 1993.

How Does PCR Work?

Figure 1.3 Polymerase chain reaction, or PCR, allows scientists to produce many exactcopies of a piece of DNA. The process is illustrated here.

Viruses are natural vectors that take over cells and make them intovirus-producing factories, a process that often kills the cell. Someviruses have been used as vectors for biotechnology after their geneticinformation has been changed to remove the instructions that permitthe production of full-fledged new viruses. There are bacterial virusescalled bacteriophage that can be used as genetic engineering vectors—that is, after they have been modified to make them useful but notharmful to the bacteria.

To insert the gene cassette into the vector, the vector DNA is cutwith a matching RE that creates sticky ends so that it will accept thegene and promoter. Another protein called DNA ligase is used torejoin, or stitch up, the pieces of DNA, joining the cut ends.

All that is left to be done is to add the engineered vector to agroup of the bacteria, yeast, or other cells that have been treated tomake their outside membrane porous enough to allow the plasmidor other vector DNA to enter. At this point, the cell has been engi-neered to make the desired product (Figure 1.4).

How can scientists tell that the cell has been successfully engi-neered? It is possible for mistakes to occur. Some of the RE-clippedpieces may not have lined up at the correct spot, or may have lined upwith each other, but the scientists are prepared for this. In addition tothe product gene and its on-switch, the scientists include a gene fora protein that would make the engineered cell stand out. This maybe a gene for a protein that breaks down an antibiotic, or a gene fora protein that makes the cells give off fluorescent light. Whatever typeof gene is used, the protein produced by the extra gene lets scientistsdistinguish cells that were successfully changed from those that werenot. Now scientists have cultures of engineered cells that can be grownto large numbers and make the desired protein.

Living Factories

Every cell—whether bacterium, yeast, plant, insect, or human—is aprotein factory, among other things. Cells produce the proteins for



Figure 1.4 Engineering of a bacterium with a plasmid vector is a usefultechnique in biotechnology. Restriction enzymes are used to cut bothforeign DNA and plasmid DNA, which are then joined together usingDNA ligase and inserted into bacteria. The bacteria can then reproduce,expressing the modified DNA.

their membranes, the proteins wrapped around their DNA to protectand control which proteins are made from its instructions, the enzyme

proteins that transform raw food materials into energy to keep the cellalive, and the proteins needed to build a new cell when one cell dividesinto two. Eukaryotic cells, cells that have a nucleus, must also make theproteins for the membrane of their nucleus, the sack containingtheir genetic material, with its proteins split into the bits calledchromosomes. Eukaryotic cells of all sorts—yeast, plant, animal,and human—make the proteins for their little energy factories calledmitochondria, and plant cells make the proteins for the chloroplasts,the energy factories that capture light and transform it into chemi-cal energy so the plant cell can make proteins and carbohydrates. Incomplex creatures like animals, plants, insects, and even some wormswith many different kinds of cells, the cells are unique because theymake different proteins. To make a simple comparison, liver cellsmake proteins to help break down food, but liver cells do not growhair. The cells that grow hair make different proteins.

Choosing Which Cell to Engineer

Genetic engineers must decide into which cell they will insert theirgene—a choice that depends on the protein product, its intendeduse, and costs. Bacterial cells are less expensive to grow in largenumbers for production of a protein, but as we shall see, human andother eukaryotic cells, unlike bacterial cells, attach sugar moleculesto the proteins they make, and this difference may be important forhow the body handles a protein or for how well the protein works.It is expensive to grow large numbers of human or animal cellsto manufacture a protein, and it may be tricky. Small changes ingrowing conditions—such as temperature, acidity of the broth, andvitamins or hormones in the broth—may change the size, shape, oramount of the protein made by the cells. Researchers are exploringthe use of insect cells to produce protein drugs and the use ofviruses that infect insect cells as vectors.


Cloning

Genes

Cloning a gene means making copies of the same DNA sequence. Asdescribed above, this can be done with PCR. Another way scientistsclone DNA is to insert it into a plasmid with RE, use the plasmidto transform a bacterial culture, grow a large number of modi-fied bacteria, extract the DNA, and then clip it back out with theappropriate RE.

Cells

For most uses, and particularly for use as a drug, a protein must beconsistent, so that every molecule in the bottle is just like every othermolecule. An important method used to increase the odds that everyprotein in the bottle is identical is to make sure that the cells produc-ing the protein—whether bacteria, animal, or human—are identicalwith the gene cassette in the same place in the cell’s genetic material.The process of producing a culture of identical cells descended froma single common ancestor is also called cloning. Whether the cells arebacterial, yeast, plant, animal, or human, the principle of creating aculture of genetically identical cells is the same: First, scientists needthe mixture of the cells with a known concentration and a littleplastic tray with a set of small wells, each able to hold about 1/100th

of a liter. Then, the scientists will:

• dilute the mixture of cells so that when he or she delivers a 1/100th of liter to each well in a plastic culture plate, bychance each well will receive no more than one cell; and

• provide the needed temperature and nutrients in theculture wells so that each cell divides repeatedly.

Every cell in each resulting individual culture will be geneticallyidentical, though the cultures may be different from each other.Then the scientists test a sample from each well to see which ones


are producing the desired protein. Now they have sets of cloned cellsthat can be increased in number to create large amounts of thedesired protein product.

Using Whole Animals and Plants

Since the 1950s, scientists have been able to clone plants. You mayhave cloned a carrot or onion plant in school, meaning that youisolated a single cell from the root of an onion or carrot and grewit, first in liquid in a dish to which you added nutrients to allow thecells to increase in number, and then in plant hormones that madethe clump of cells develop into an entire plant with roots, stem, andall. Because you started with a single cell, you cloned the plant,and your cloned plant was genetically identical to the plant thatprovided the starting cell. If you had transformed it by engineeringfor a new protein in the gene before you put that cell in the culturedish, you could have created a set of genetically engineered plantsable to produce the new protein. The vectors used for plants have tosuit the plant. One vector used for many plants is a plasmid froma bacterium that causes a large growth, called a crown gall, in plants(Figure 1.5). You may see these large masses on trees. To insert agene into a plant susceptible to the bacteria, scientists first removethe genetic information from the plasmid that causes the largegrowths, and replace it with the genetic information for the desiredprotein. The plasmid is then put back into the bacteria, and theplant cells are infected. Some plants cannot be infected with thecrown gall bacteria, so the genetic information has to be deliveredanother way. One common method is to a use a gene-gun, a devicethat “shoots” tiny metal spheres that are covered with the geneticinformation into plant cells.

Animals

Researchers have also inserted foreign genetic information into mice,rats, chickens, pigs, and sheep. An animal whose genetic information



Figure 1.5 The tree in this picture has Crown Gall disease, which iscaused by a bacterium that carries a plasmid used for genetic engineeringof some plants.

has been modified to carry a new, foreign gene is called a transgenic

animal. There are two ways to make transgenic mice. Both use acassette of the desired gene in an appropriate vector.

One method, first successfully attempted in mice in the 1970s,uses newly fertilized eggs. The researchers use a very fine needle toinject the desired DNA into the area containing the DNA from thesperm, before the sperm and egg have fused. The injected DNA maybecome part of the sperm DNA. After fusion has occurred, thefertilized egg is allowed to develop into a two-cell embryo, which isthen implanted into a female mouse. If the embryo attaches to theuterus, the pregnancy will go forward and healthy pups, or babymice, will develop. Successful development of transgenic mice isnot certain, because only one-third of the embryos placed into amouse uterus develop into live animals, and only a few may carrythe transgene and produce the desired protein.

A second method provides a more certain outcome. Before themanipulated embryo is put into the mouse’s uterus, that geneticinformation is present and in a form that will drive production ofa protein. This method uses embryonic stem (ES) cells. Early in itsdevelopment, before it settles in the uterus, the embryo becomes ahollow ball of cells called the blastocyst, and inside that ball areembryonic stem (ES) cells (Figure 1.6). A single mouse ES cell candevelop into a whole animal. Several research groups have reportedthat an entire mouse was produced from an ES cell that wasallowed to grow and develop into an embryo in the lab and wasthen placed in the uterus of a female mouse to complete its devel-opment. To make a transgenic animal using ES cells, the researcherfirst constructs the DNA cassette containing the desired gene, thegene that will signal whether the transformation succeeds, and theappropriate stretches of DNA that tell the cell to read the genes andmake the proteins. All of this material is incorporated into a vector.The researcher mixes the vector with the ES cells. Some ES cells willtake the new DNA into their genetic material. Then the ES cells are


treated to separate those that have successfully taken up the newgenetic material from those that have not. The successfully trans-formed ES cells are injected into the hollow center of a blastocyst,so that the genetically modified ES cells mix with the small numberof ES cells present. The embryo is allowed to develop in thelaboratory for a short time, and is then placed into the uterus ofa female. Success is still not certain: About 10% of the live mousepups will have the new gene, the transgene. Only one of twochromosomes of the transgenic mice will carry the transgene, sothe mice will have to be bred to produce animals with two copiesof the new gene.

ES cells can also be used to generate an animal geneticallyidentical to a living animal, a process termed reproductive cloning.Reproductive cloning has been used in some species, and has beenhotly debated, particularly regarding its potential use in humans.


Figure 1.6 Early development of an embryo is illustrated here. The human blastocystdevelops by about 4 1/2 days. Embryonic stem cells are formed from inner cell mass.

CONNECTIONS

The ability to move a gene from one organism to another at will wasbuilt on basic discoveries about the biology and genetics of cells andwhole organisms. The biotechnologist’s toolbox includes methodsto precisely clip DNA and insert it into a new cell, along with other


Laboratory methods have been used to produce animals that are genetically identical to

one another. These procedures are also called cloning, specifically reproductive cloning,

because the goal is to produce a live animal. Animal and human clones are not unknown.

Identical twins, because they derive from the same fertilized egg that splits into two, are

genetically identical, and each is therefore a clone of the other. But the form of cloning

that concerns and sometimes alarms people is the process by which the nucleus of an

adult individual’s cell is substituted for the nucleus of a fertilized egg, with the goal of

generating a genetic copy of the donor of the nucleus. Dolly the sheep, the first cloned

mammal, was produced in 1996 by substituting the nucleus from a skin cell of a sheep

for the nucleus of an unfertilized egg. Many such transfers were done, and each egg was

cultured in the laboratory until it developed into an embryo and was then placed into the

uterus of an ewe treated with hormones to mimic pregnancy. Hundreds of embryos were

produced, but only one resulted in a live birth. Others died early in development or were

born with fatal birth defects. A similar method has been used to produce cloned sheep,

goats, cows, mice, pigs, cats, rabbits, and a gaur, which is an endangered ox. The method

is called somatic nuclear transfer (SNT). The cells in animal and human bodies

destined to develop into sperm or eggs are called germ cells, and the rest of the cells

are called somatic cells. The process is not a sure thing. In every species in which SNT

has been tried, experience has shown that many embryos die early in development or,

if born alive, have significant birth defects.

The morality and ethics of human reproductive cloning have been hotly debated

since Dolly’s birth, and the issues are of great concern to many religious faiths. The debate

centers on respect for the earliest form of human life, and different ideas about the stage

of development at which a human embryo should be granted protection as a “person.”

This debate will not be easily cooled. Ethical and moral issues aside, after thorough review

of results with different animal species, the scientific and medical consensus is that

reproductive cloning of humans is too dangerous and should not be attempted.

Reproductive Cloning

genetic material that allows selection of successfully changed cellsand instructs the cells to make the desired protein. Methods tomake many copies of stretches of DNA and to determine thesequence of bases in the DNA allow the researcher to understandthe relationship between DNA sequence and protein product, andto modify the genetic information of a cell in new and usefulways. The methods have also been applied to genetically modifiedwhole plants and animals. Biotechnologists apply these methodsto make useful products for medicine, agriculture, and industry.This book will explore some approaches that have proven usefulin health care and some that are still experimental. The possibilityof using this method to create a genetic copy of humans, thoughgenerally viewed as medically too risky, has spurred ethical andmoral debates.


FOR MORE INFORMATIONFor more information about the concepts discussed in this chapter,search the Web using the keywords:genetic engineering, animal cloning, polymerase chain reaction

NATURAL CURES FOR ANCIENT DISEASES

In China in 500 B.C., moldy soybeans—the first antibiotic—wereconsidered one prescription to cure a rash. Diseases were treatedwith products from living organisms hundreds of years before thedevelopment of biotechnology methods that allowed scientiststo move genetic information from one organism to another. Adocument from 1550 B.C. in Egypt, perhaps the earliest medicalbook ever found, describes more than 700 drugs, many of themmade from herbs.

Many medicines that we now use and often take for grantedwere based on the healing properties of plants and other naturalsources known to traditional healers. Aspirin, or acetylsalicylic acid,is a chemically modified form of salicylic acid, a chemical extractedin the early 19th century from willow tree bark, which had beenknown for centuries to reduce fevers. Today, aspirin is chemically

22

Natural Products as Drugs

2

synthesized from simple starting chemicals, a process that costsless than growing willow trees. We can thank both the willowplant and advances in chemistry for the availability and low costof aspirin.

FROM DYES TO DRUGS

The modern pharmaceutical industry began in Europe whenresearchers developed methods to isolate and determine the struc-ture of complex chemicals from natural sources, and to build thesecompounds from inexpensive and readily available starting materi-als. Soon, industrial chemists were isolating many useful chemicalsfrom coal tar, a by-product of the industrial use of coal for fuel, anddeveloping methods to make many new products, including textiledyes, from scratch.

Traditionally, textile dyes were extracted from plants, requiringaccess to scarce, often exotic, raw materials. The development ofmethods to make chemicals inexpensively from cheap raw materi-als spawned several entirely new industries, including the phar-maceutical industry. Advances in chemical dye methods werequickly applied to medicine, beginning in the early 19th century,when chemists isolated the drugs morphine, quinine, and digitalis

from their plant sources: poppies, cinchona tree bark, and thefoxglove plant, respectively (Figure 2.1). Today, chemists usesophisticated and powerful tools, but the basic principle is oftenthe same. Working from knowledge of the medicinal properties ofa particular plant or microorganism (a living thing too small tobe seen without a microscope), chemists isolate an active drug,

23Natural Products as Drugs

Stop and ConsiderDoes describing a drug as “natural” mean it is safe to use? Providesome examples.


Figure 2.1 The foxglove plant, a member of the snapdragon family,grows in Europe and was the original source for the heart drug digitalis.Digitalis is now manufactured synthetically.

determine its structure, and develop reliable and economical waysto produce it from inexpensive materials.

In some cases, the medical use of a plant extract was discov-ered long after it had been used for other purposes. Morphine,now used to treat severe pain, was isolated in the 19th centuryfrom opium, a drug that has been used and abused for centuries.Several plant extracts now known to have effects on the heartwere used as arrow poisons by tribal peoples around the world. InA.D. 1250, a Welsh physician wrote about the use of the foxgloveplant to treat accumulation of fluid in the tissues, which can becaused by the weakening of the heart muscle. Digitalis, a heartmedication used today, was isolated from the foxglove plant.Chemists isolated quinine, now used to prevent and treat malaria,from the bark of the cinchona tree, used for centuries by SouthAmerican tribes to treat malaria and to bring down fevers. Today,these drugs are produced by chemical methods, without relyingon harvesting wild or cultivated plants.

FINDING MEDICINES IN NATURE

Plants have traditionally played a major role in medicine, with herbsand other plants providing teas, balms, and salves. Although wemight like to think that modern science has led us away from theseseemingly simplistic sources for healing, one of the most effectivemodern cancer drugs came out of a massive government search fornew cancer medicines from plants, a search that ranged around theglobe. Paclitaxel (Taxol®), a drug used to treat cancer of the ovary,breast, and certain forms of lung cancer, was produced through ajoint effort of the National Cancer Institute (NCI) and the Depart-ment of Agriculture (USDA). From the early 1960s to 1981, plantexperts at the USDA traveled the world searching for new plants,and NCI scientists tested extracts of those new plants for the abilityto kill tumor cells. The chemical responsible for killing tumor cellswas then isolated from the extract. Although hundreds of thousands



In many countries, including the United States, drugs are only available if a govern-ment agency has determined that they are safe and effective. In the United States,the Food and Drug Administration (FDA) is responsible for approving drugs for sale.The FDA decides whether to approve a drug based on a large amount of informationfrom laboratory, animal, and human studies. Laboratory studies with cells, as well asanimal studies, provide clues as to the drug’s potential usefulness and possible toxiceffects. Human studies, sometimes called clinical trials, may begin only after theFDA has reviewed all the laboratory and animal studies. Clinical trials are done inthree phases. Studies in Phase 1, generally performed on a small number of healthyvolunteers, are designed to show how the body takes up and eliminates the drug, andto find out what toxic effects the drug might have in humans. In Phase 1, the drugis given in increasing doses, starting with a very low dose identified to be veryunlikely to be toxic in humans from the results of the animal safety studies. Phase2 studies, performed with a small number of people who have the condition the drugis intended to treat, compare the new drug to a standard drug for the condition or, ifthere is no approved drug for this condition, to a placebo—an inert substance suchas a sugar pill. Phase 2 trials, which are the first human tests of whether the drugwill benefit patients, are often double-blind tests, meaning that neither the subjectsnor the physician researchers measuring the drug’s effects know who is getting thenew drug and who is getting the control drug, whether approved drug or placebo.Phase 3 trials, also blind and controlled, are generally larger and performed atseveral different medical centers. The results of all the clinical trials are analyzedusing mathematical methods to see if the studies support the usefulness of the drug.During the entire clinical testing period, data are collected on any harmful effectsand these results must be reported to the FDA. The pharmaceutical company mustalso demonstrate that it can manufacture the drug at a consistently high level ofpurity and that the drug can be stored without breaking down. FDA scientists,sometimes with advice from outside medical experts, review all the information and,based upon these reviews, the FDA decides whether the results support the safetyand efficacy of the new drug. Only if the results are positive may a company offerthe drug for sale. Information on any harmful effects of the drug will continue to becollected by the company and reported to the FDA. If necessary, this information willbe provided to physicians to help them prescribe the drug safely. Severely harmfuleffects that outweigh the potential benefit of the drug may eventually cause the drugto be withdrawn from the market.

FDA Approval of New Drugs

of plant extracts were tested, only a few provided useful drugs; oneof these was Taxol.

The NCI scientists discovered that extracts of the bark andneedles of a yew tree, Taxus brevifolia of the Pacific Northwest,killed tumor cells. Fresh samples were obtained from the forests inthe state of Washington in August 1962. Paclitaxel was firstisolated from yew tree extract in 1967, and retested on cells in thelaboratory. After it was found to be effective in tests on animalswith tumors, paclitaxel was studied in a large number of humancancer patients and finally approved by the Food and DrugAdministration (FDA) in 1992 for use in treating cancer in people.

Paclitaxel was first manufactured by extracting the active drugfrom the bark of the Pacific yew tree, but that approach was unac-ceptable, both for the manufacturer, Bristol-Myers Squibb, and for


Drugs may be approved for sale only after they have been shown through experiments to

be safe and effective in humans. Since the end of World War II (1945), human experi-

mentation of any kind has been regulated by strict rules protecting the subjects. Partic-

ipation must be voluntary. Subjects must be informed of the potential risks and benefits

of their participation, must give written consent, and must be able to withdraw from the

study at any time without penalty. An independent committee of physicians, other

healthcare professionals, and nonmedical community representatives must review and

approve the detailed plan for the study, including the written description of the risks that

is used to obtain written consent from subjects. The consent material must be written

in a language and at an educational level suitable for potential participants. Subjects

must be treated fairly, with compassion, and with respect for their autonomy—their ability

to make their own decisions. Individuals who are unable to give informed consent

because of age, illness, or mental disease may only participate in clinical trials if an

appointed legal guardian consents. Bioethicists—professionals trained in medical science,

moral philosophy, and legal and psychological aspects of human experimentation—work

with physicians and researchers to ensure that experiments involving humans are

conducted with compassion, fairness, and respect for the test subjects.

Protection of Human Test Subjects

environmentalists, because this process killed the slow-growing andscarce yew tree. Researchers eventually succeeded in synthesizingpaclitaxel from a chemical precursor found in the needles ofanother yew tree, Taxus baccata, which grows abundantly in Asiaand Europe. The needles could be harvested and the drug made ina factory without sacrificing trees. Scientists have not yet succeededin producing paclitaxel from scratch in the lab or in producing thedrug or a precursor from plant cells grown in large vats.

THE DISCOVERY OF ANTIBIOTICS

Antibiotics have a long history, and represent another highly suc-cessful application of conventional biotechnology. In China, Egypt,and among some native South American tribes, molds were used totreat rashes and severe skin infections, such as boils. The modernantibiotic era began with British bacteriologist Alexander Fleming’sserendipitous discovery of penicillin in 1928, the first successfulresult of a 50-year search for chemicals produced by one micro-organism that were able to kill another organism, or at least stopits growth (Figure 2.2). In the struggle to survive in competitiveconditions with limited food sources, molds, fungi, and bacteria

discharge antibiotic substances into the local environment. Manyantibiotics currently in use, including penicillin, were discovered byobserving the ability of a colony of mold or fungus to prevent thegrowth of bacteria (Figure 2.3). Cephalosporin, the first of a seriesof related and widely used antibiotics, was isolated in 1948 from afungus discovered from the sea near Sardinia, an island off the westcoast of Italy. The story is that the sample was taken from the seanear the outlet from a sewage treatment plant!

Many medically useful antibiotics are first discovered by puttingbacteria in a culture dish with molds or fungi to see whether the moldor fungus kills the bacteria or slows its growth. But finding deadbacteria on a lab dish may not necessarily mean that a useful drugis being produced. Today, most of the clinically useful antibiotics


are manufactured semi-synthetically, meaning that the producingorganism is grown in huge industrial vats under very controlledconditions. The antibiotic is purified from the liquid in which thebacteria grow, and is then chemically modified to make it moreuseful as a drug. These changes may make the antibiotic less expensive


Many of the medicines used in the United States come from plants or microorganisms

found in the environment. This includes medicines ranging from aspirin to antibiotics and

even Taxol, one of the most widely used cancer drugs. Plants and animals were widely used

in traditional medicine, and nature’s “medicine cabinet” was the source for many early

drugs as chemists learned how to isolate the specific compounds that made medicinal

plants useful in treating human illness. Not surprisingly, pharmaceutical and biotechnology

companies still search all over the world today for new and better drugs.

These searches are based both on folk medicines and on systematic tests of extracts

from previously unknown plants and microorganisms. The search for a new drug from these

extracts involves many thousands of laboratory tests that use robots to run the tests and

computers to analyze the results. Because the diversity of plant and animal species is great-

est in the tropical rain forests in relatively underdeveloped parts of the world, the ethics of

exploiting that diversity, and of wealthy companies using folk medicine traditions, has been

challenged. Several international agreements, such as the General Agreement on Tariffs and

Trade (GATT) and the Convention on Biological Diversity (CBD), have supported sustainable

commercialization of biological resources and patenting of discoveries to encourage sharing

the benefits with the country of origin and the indigenous people whose traditional knowl-

edge may have formed the basis for the product. The CBD, not signed by the United States,

encourages large companies to recognize the right of each country to control access

to the biological resources within its borders. The CBD also created expectations that

bioprospecting companies would share with each country the benefits of the discoveries, in

the form of compensation and transfer of useful technologies, but these expectations have

not always been met. Several large pharmaceutical companies have provided funds, equip-

ment, and training to a private nonprofit association in Costa Rica in exchange for access

to its forests. It is not yet clear whether populations of the underdeveloped or developing

countries with the sought-after native biological resources and indigenous medical traditions

will benefit from these activities.

Who Owns Nature’s Medicine Cabinet?

to form into a pill, more stable in the acidic conditions of thestomach, and more likely to be absorbed from the stomach into thebloodstream. They also may make the antibiotic less susceptible tobeing broken down by the bacteria being targeted, make it effectiveagainst more types of bacteria, and make it less likely to harm thepatient. All these changes help a health-care provider match theappropriate antibiotic to the patient’s infection.

The discovery of antibiotics has had a major medical impact.Between 1900 and 1996, U.S. death rates due to infection dropped


Figure 2.2 Alexander Fleming, the discoverer of penicillin, with a bacterial dish containinga ring used to test antibiotics. The ring would be soaked with a solution of the testcompound and placed on a plate with the bacteria to see if, after a day or so, thebacteria growth was stopped near the ring.


Figure 2.3 An illustration of a bacterial plate contaminated with an antibioticproducing mold (top) and Fleming’s actual plate (bottom). Notice the absenceof bacterial colonies surrounding the mold.

from 800 per 100,000 to less than 60 per 100,000. The antibioticstreptomycin was introduced in 1944 to treat tuberculosis (TB),caused by infection with Mycobacterium tuberculosis. Between 1945


The story of Alexander Fleming’s discovery of penicillin in 1928 is well known. Going

on vacation, he left his laboratory, where he was studying Staphylococci bacteria, but

failed to put a Petri dish containing a sample of the bacteria in the incubator. When he

returned, a mold colony, which perhaps had been blown in through an open window, was

growing on the culture plate, but the area around the mold colony was clear, indicating

that the bacteria had dissolved. The possibility that one microorganism might produce

compounds that could destroy other microorganisms was not a new idea. In 1877, French

scientist Louis Pasteur, originator of the idea that many diseases were caused by germs

(infectious agents too small to be seen with the naked eye), noticed that anthrax

bacteria would grow easily in sterile urine, but would not grow if he added what he called

a common bacterium. Other scientists had found that a sterile filtrate of the broth in

which bacteria had been grown would dissolve bacteria taken from patients with dysen-

tery (an intestinal infection). When Alexander Fleming tested extracts from cultures of the

Penicillium notatum mold in his Petri dish, he found that they were effective in killing a

number of different bacteria. However, he and his colleagues were unable to purify the

active compound he named penicillin (after the mold it came from), perhaps because they

did not have sufficient resources to purify the very small amount of the active compound

in the culture. No one seemed to think this discovery was important enough to spend

money researching until just before World War II began in 1939. Then Ernst Chain, a

German-born chemist who had emigrated to England after the Nazis came to power, and

Howard Florey, an Australian-born biologist working at Oxford University, purified a small

amount of penicillin and showed that it could treat an infection in mice that was lethal

without treatment. The amounts Chain and Florey purified were too small to be useful for

humans, but as impending war became a reality, pharmaceutical companies began to

mass-produce penicillin, first in the United States, and then in Great Britain.

By D-day in June 1944, when the United States and its Allies invaded France,

enough penicillin was being produced in the United States and Britain to treat all of the

Allied servicemen who needed it. In 1945, Fleming, Florey, and Chain were awarded the

Nobel Prize in Physiology or Medicine for their efforts.

Alexander Fleming and the Discovery of Penicillin

and 1955, the death rate from TB in the United States fell from39.9 deaths per 100,000 to 9.1 per 100,000.

CONNECTIONS

Historically, plants and other living creatures have been used asmedical treatments, and early chemically produced drugs werebased on or identical to compounds extracted from natural sources.Nature continues to provide modern drugs, and searches stillbegin with systematic laboratory testing or by following clues fromtraditional folk healers. Modern chemical methods are used toimprove upon what is found in nature. Some of these drugs, such aspaclitaxel, provide major improvements in medical care.


Stop and ConsiderWhat role does an antibiotic play for the organism producing it?Why is this important?

FOR MORE INFORMATIONFor more information about the concepts discussed in this chapter,search the Web using the keywords:Food and Drug Administration (FDA), antibiotics, Taxol

INOCULATION: MEDICAL BREAKTHROUGH AND SOCIAL FAD

Several hundred years ago, inoculation parties were all the rage in theTurkish countryside. Families gathered around an old womanwith nutshells full of scrapings from the skin of people who hadsmallpox. The most likely participants were young women, sincecatching smallpox and being left with a pockmarked face coulddrastically reduce a young woman’s chance of marrying well. Eachperson to be inoculated would hold out an arm, allow a vein to besliced open, and then a small bit of the scrapings from the nutshellwould be placed in the open vein. Tradition held that the scrapingswould protect the person from smallpox, a disease that scarred andkilled large numbers of people who caught it naturally. Everyoneknew that those who survived smallpox were protected the nexttime the disease appeared. The inoculation party was an acceptableand effective, though somewhat risky, way to be protected against

34

Large Molecules

3

the disease. (It could be risky because people who were inoculatedsometimes developed full-blown smallpox.) The wife of the Britishconsul in Constantinople (now Istanbul) reported this practice ofinoculation in her letters home and, soon, after some initial testingon royal children and convicted felons, the practice becamewidespread in England, France, Russia, and North America.

In 1798, Edward Jenner, an English country physician, reportedsuccess in providing protection from smallpox by scratching theskin with a pin that held scrapings from the skin of dairymaidswho had cowpox, a mild disease the women contracted by handlingthe udders of infected cows. Farmers knew that dairymaids whodeveloped cowpox could not catch smallpox. Jenner did his firstexperiment on a young boy, scratching the boy’s skin with a pinthat held cowpox material from an infected dairymaid. Six weekslater, Jenner repeated the process, scratching the boy with small-pox, rather than cowpox, material on the pin. The child did not getthe small sore that the smallpox scratch usually caused, which sug-gested that the boy was protected against smallpox. More studiesfollowed, and smallpox vaccination with cowpox became routine(Figure 3.1).

VACCINATION: LESS RISKY AND MORE EFFECTIVE

The word vaccination comes from vaccinia, the name of the virusnow known to cause cowpox (vaca is the Latin word for “cow”). Theterm vaccination is now broadly used to describe the process ofcausing a mild disease in order to protect a person from a moredangerous disease. Vaccination is one form of immunization, expos-ing the body to a material to stimulate a protective response fromthe immune system. Vaccination is routinely used to prevent manyillnesses, including measles, mumps, German measles (rubella),chicken pox, and polio. Many of these illnesses have disappeared orbecome very rare in developed countries that provide widespreadvaccinations. Smallpox has been eradicated worldwide, thanks to

35Large Molecules


Figure 3.1 This painting depicts the first cow pox vaccination by EdwardJenner. The child being vaccinated is held down, while his arm isscratched with a needle containing cow pox. On the right is a milkmaid who is rewrapping her hand, presumably covering the cow poxpustules from which the vaccination was taken.

whole population vaccination programs organized by the WorldHealth Organization (WHO).

Other immunizations use substances taken from the micro-organism that causes the disease, and some even use whole killeddisease-causing bacteria. The DPT shots that children receive beforeentering school are made up of proteins isolated from the bacteriathat cause diphtheria and whooping cough (pertussis), plus killedtetanus bacteria. The pertussis and diphtheria proteins used in the

37Large Molecules

The immune system of humans and other animals consists of a series of specialized cells

and proteins that provide powerful defenses against infectious diseases. Immune system

cells develop in the marrow, the soft tissue inside the bones, and in the thymus, a small

organ just in front of the heart. When immune system cells mature, they move to the

spleen, a large organ in the abdomen; to lymph nodes, small organs located throughout

the body; to the appendix; and to the blood. When you have a sore throat or cough and

the doctor pokes and prods your neck, he or she is trying to see if the lymph nodes in

your neck are swollen, which would indicate that they are fighting an infection. You have

probably also heard of tonsils and adenoids, immune system tissues in the throat

and nose that are rich in infection-fighting cells. The purpose of that look into your

throat is to see if your tonsils are swollen and red, another sign that the body is fighting

an infection.

Immune system cells provide both general responses to infections and responses

precisely targeted to the specific infecting virus or bacteria. The infection-specific cells,

called lymphocytes, work to attack and remove infecting pathogens.

Another important defense tool of the immune system consists of specialized

proteins called antibodies, or immunoglobulins, that are produced by lymphocytes and

can recognize and bind to proteins on the surfaces of microorganisms, resulting in their

destruction and removal from the body. The disease-fighting lymphocytes that produce

antibodies are able to “remember” previous exposure to a protein or other substance

and respond quickly if it reappears in the body. Vaccination and other immunizations

that prevent disease cause the immune system to develop the appropriate set of specific

lymphocytes and antibodies that can quickly attack an infection.

The Immune System—Our Best Defense

injections are the toxins—proteins that make us sick if the diphtheriabacteria grow in our bodies. In response to the series of smallinjections of these proteins, our bodies develop antibodies, protec-tive proteins produced by our immune system in response to aninfection by a microbe. Once a person has been vaccinated (or hasrecovered from a particular disease), the antibodies remain in thebody, on the lookout for the same microbe to invade again. If itreenters the body, the antibodies react and help remove it.

In addition to preventing disease, antibodies can also beinjected to treat a disease. People who develop diphtheria infectionmay receive antibiotics and serum, the fluid part of blood, contain-ing antibodies from animals that have been repeatedly injectedwith small amounts of the poisonous protein from diphtheriabacteria. The antibodies in the animal serum bind to the toxinprotein in the patient, making it harmless. These animal sera(plural of serum) are prepared very carefully to make sure they aresafe. That was not always the case. In St. Louis in 1901, during adiphtheria epidemic, the serum of a retired milk wagon horsenamed Jim, which was infected with tetanus, was used to manu-facture the diphtheria antitoxin. After receiving the contaminatedvaccine, 13 children died of tetanus. The scandal led to the passageof the 1902 Biologics Control Act, which gave the federal govern-ment control over the production of biologic products, includingserums, vaccines, and antitoxins. Antivenoms—serum preparationsfrom horses or sheep that have been repeatedly injected with smallamounts of venom proteins—are used around the world to treatsnake and scorpion bites.


Stop and ConsiderHow do childhood vaccinations help prevent serious diseases?Can you provide some examples?

THE USE OF INSULIN: REPLACING WHAT IS NOT WORKING

Biologic sources have long provided replacement proteins formedical conditions caused by absent or defective proteins. Onesuch condition is the type of diabetes that occurs in young people,which is caused by destruction of the pancreas cells that produceinsulin. The pancreas, a gland in the abdomen, secretes insulin, aprotein hormone that allows the body to break down the sugarmolecule glucose. If it cannot create insulin when needed, thebody wastes away because sugar from food cannot be processed toprovide energy and to build and maintain muscle. In addition,without insulin, the glucose produced by the digestion of food mayrise to such high levels in the blood that the patient may becomeunconscious and die very quickly. Before insulin injections becameavailable, people with this form of diabetes could only be treatedby a very restrictive diet that only postponed death for a shortwhile. Then, in the 1920s, a team of Canadian researchers producedinsulin from calf pancreas and, soon after, pharmaceutical compa-nies were able to supply cow and pig insulin to diabetics. Animalinsulins can be used for humans because the amino acid sequenceof insulin from cows and pigs is very similar to that of humaninsulin. Animal insulin did cause problems for some diabeticpatients, particularly in the early years when the insulin preparationswere not entirely free from other proteins. Some diabetic patientswho received animal insulin, even highly purified preparations,developed antibodies to the insulin, which blunted its effectiveness.A few developed serious allergic reactions. Sometimes this occurredonly in the skin where the insulin was injected, but in some cases,people had severe allergic reactions that tightened the throat andbecame life-threatening.

THE USE OF HUMAN GROWTH HORMONE

Some children do not grow at the normal rate, and are the size ofchildren who are several years younger. This may occur because

39Large Molecules

they have too little growth hormone. Growth hormone is a proteinproduced by the pituitary gland, located at the base of the brain(Figure 3.2). Growth hormone influences the development of


Imagine your doctor tasting your urine to find out what was making you constantly thirsty

and hungry and wasting away to skin and bones! For hundreds of years, this was a fairly

common practice. Diabetes had been known for centuries, and one advance came when

physicians realized that patients with diabetic symptoms often had high levels of sugar

in their urine. In the 11th century, someone took a sip of the urine and the condition was

named diabetes mellitus (from the Latin word for “honey” or “sweet”).

Until the 1920s, other than ordering a very restricted diet with little carbohydrates

or sugar and lots of fat and protein, the physician could do little or nothing to prevent

the death of a diabetic patient within a few months or years. In 1920, Frederick Banting,

a young physician on the staff of Western University in London, Ontario, Canada, read

about a recent study that had shown that diabetes develops only when distinctive cells

in the pancreas, called the islets of Langerhans, were damaged. Banting became

determined to isolate or purify the substance found in the islets of Langerhans and

test it to see whether diabetes could be reversed. In the spring of 1921, he was given

some laboratory space and hired an assistant named Charles Best. Working over a hot

summer and without salaries, Banting and Best removed the pancreas of dogs to cause

diabetes, then reversed the condition by giving the newly diabetic dogs fluid from the

islets of Langerhans of healthy dogs. With this initial success, they won the support of

J.J.R. MacLeod of the University of Toronto and a biochemist named J. B. Collip. They

switched to using islets of Langerhans from slaughterhouse calves, and had further

success in dog experiments with the extracts and subsequently with concentrated mate-

rial they called iseltin, because it was obtained from islet cells. Other researchers

had worked to purify the active material from calf pancreas, and the name “insulin”

had been proposed as early as 1906. In 1922, a teenager in a diabetic coma became

the first human to receive an injection of insulin. His condition improved with the

injections. When reports of his treatment spread, the challenge became to produce

enough insulin to treat all the diabetics who wanted it. By 1923, insulin was widely

available. In February of that year, Banting and MacLeod were awarded the Nobel Prize

in Physiology or Medicine.

The Discovery of Insulin: A Lifesaver

41Large Molecules

Figure 3.2 The pituitary gland is a pea size gland located at the base ofthe human brain. The pituitary gland has two rounded projections orlobes. Cells of the anterior lobe produce growth hormone and five otherprotein hormones involved in regulating various body functions, whenstimulated by specific signals from the hypothalamus. The optic chiasmais where the optic nerves from each eye cross before entering the brain.

nearly every organ and tissue in the body except for the brainand eyes. Unlike insulin, growth hormone from animals doesnot work in humans. From 1963 to 1985, the U.S. Public HealthServices (PHS), part of the U.S. Department of Health andHuman Services, provided American physicians with humangrowth hormone (HGH) purified from the pituitary glands ofhuman cadavers (dead bodies). A total of 7,700 children whowere too small for their age and had low blood levels of growthhormone levels were treated with this material. Many of themgrew significantly.

However, in 1985, scientists learned that at least three men whohad been treated as children with the cadaver-derived humangrowth hormone had developed a very rare and fatal degenerativebrain disease called variant Creutzfeldt-Jakob disease (vCJD). Similardiscoveries were made in France, Great Britain, New Zealand,Brazil, and several other countries that had used the procedure.Although some individuals who developed vCJD in other countrieshad received human growth hormone from the same laboratorythat provided the PHS material, others had received human growthhormone produced in their own country. When told of the devel-opment of vCJD in the three men, the PHS stopped providing theHGH and notified all physicians who had received it to stop usingit on patients. By 2004, the National Institutes of Health (NIH)had tracked down 6,272 of the 7,700 people treated with U.S.cadaver growth hormone and found that 32 of them had developedvCJD. When the PHS began distributing growth hormone fromhuman cadavers, no one suspected that preparations from the


Stop and ConsiderShould all short children be treated with growth hormone? Why orwhy not? What are some of the advantages and disadvantages?

brains of some people might cause vCJD, because the possibilitythat there might be an unknown infection in the brain tissue wasnot understood.

CONNECTIONS

The real and potential risks of serious health problems from the useof protein-based medicines isolated from animal or human tissue,

43Large Molecules

Transmissible spongiform encephalopathies (TSEs) are brain diseases that can be

transmitted from one animal to another. In these diseases, many of the nerve cells in the

brain are destroyed. When viewed under a microscope, the brain tissue of animals and

people with TSE resembles a sponge. Human TSEs include the variant Creutzfeldt-Jacob

disease (vCJD) that occurred in a small number of children treated with growth hormone

or brain tissue from human cadavers, and kuru, a disease found among the Fore tribe in

Papua New Guinea, who practiced ritualized cannibalism in which they ate the brains of

deceased relatives. Sheep and goats can develop a TSE called scrapie, and cows develop

bovine spongiform encephalopathy, or BSE, sometimes called “mad cow disease.”

Human and animal TSEs are spread by exposure to the brain tissue of an infected

individual, though scrapie spreads from mother to offspring through the placenta and

placenta fluids, and to other animals through consumption of infected brain tissue.

The nature of the agent that actually causes the TSEs is a matter of debate. Viruses,

bacteria, and fungi—all of which contain nucleic acids, the material that makes up

genes—cause most infectious diseases. After 30 years of searching, no one has yet

been able to find nucleic acid in the infectious material that causes TSEs. Beginning

in the 1960s, scientists began to propose that a protein material alone caused these

diseases. In 1981, Dr. Stanley Prusiner coined the name “prion” to describe the protein-

only infectious material believed to be responsible for TSE. According to Prusiner’s

hypothesis, the infectious prion protein enters nerve cells and changes the way that

related normal proteins fold, a change that causes the cells to die. All mammals have

genes for normal prion proteins; the genes are similar but not identical among different

species, and the differences seem related to the ability of prions from one species to

infect another species.

Prion Diseases

and the limitations of the use of animal proteins, were strong spursto the establishment of the biotechnology industry in the 1980s. Atfirst, there were not many ways to change the proteins isolated fromthese sources to make them more useful as drugs. Engineering—specifically genetic engineering—held the promise of helping scien-tists design protein drugs that would be extremely effective.


FOR MORE INFORMATIONFor more information about the concepts discussed in this chapter,search the Web using the keywords:proteins, amino acids, prions, immune system, insulin, diabetes, pancreas,infectious disease

PROTEIN FACTORIES

On television, you have probably seen factories that are vast computer-controlled, super-clean spaces with equipment tended by techni-cians in space suits, booties, and hoods. This is an accurate imageof manufacturing plants that work in the modern biotechnologyindustry. Picture an enormous room full of shiny stainless steelvats, each two stories tall and containing 5,000 to 10,000 gallons ofa broth—composed of water, salt, and sugar—in which bacteria aredividing again and again. Pretty soon there are millions, billions,and trillions of bacteria, all the same and all busily producinghuman insulin (Figure 4.1). The vats are connected to a network oftubes and devices to withdraw the insulin from the broth, removealmost everything else, and emit a concentrated solution of insulin.This solution is then sent to another set of machines to be mixedwith preservatives and a few other chemicals to make it suitable for

45

Types of Recombinant Drugs

4


Figure 4.1 Shown here are industrial biotechnology reactors used togrow cells for production of biotechnology products. Temperature, pH,and other conditions are carefully monitored and controlled. Industrialbiotechnology reactors can hold thousands of liters and stand twostories high.

injection into diabetic patients who need it. After samples are testedto make sure everything is in order, the vials are ready to be shippedto a drug distribution warehouse.

Bacteria at Work

Many types of recombinant biotechnology products are availabletoday, but at the outset, the major spur to adopt the technologycame from the search for safe, efficient, and economical ways toproduce protein drugs. Small chemical drugs could be synthesizedin the laboratory and factory from inexpensive materials, butsuch methods were ineffective for proteins. Over the years, bio-logical researchers had identified hundreds of proteins that werepotentially useful for treating disease, but producing them in thelarge amounts needed for testing and use was difficult, and often theanimal protein would not work in humans. In the first years of theindustry’s existence, the 1980s and early 1990s, most biotechnology-derived protein drugs were produced in bacteria, particularly in astrain of the bacterium Escherichia coli (E. coli) that had beenchanged so it could not cause disease. We all carry large numbers ofE. coli bacteria in our intestines, where they help digest our food.The strains of E. coli in our intestines do not cause disease unlessthe bacteria somehow escape to other tissues or organs. A seriousinfection can develop if a wound in the intestine allows E. coli andother bacteria to leak into the abdomen. Some strains of E. coli docause disease even if they do not leave the intestines. You may haveheard of a type of E. coli that can cause severe food poisoningif someone eats undercooked, contaminated meat (most bacteriacan be killed if meat is cooked thoroughly). This strain of E. coliproduces a poisonous protein, called a toxin. When someone eatsfood contaminated with this strain of E. coli, the bacteria growrapidly and the toxin they emit can cause severe diarrhea, kidneydamage, and even death. The strain of E. coli used to manufactureproteins is very different from the type that causes food poisoning

47Types of Recombinant Drugs

as well as the type that grows naturally in our intestines. IndustrialE. coli have been genetically changed so they cannot grow outside ofa carefully controlled laboratory setting and cannot cause disease.

Changing the Bacterium’s DNA

Biotechnology uses a series of techniques to harness a bacterium’sability to increase quickly to very large numbers in a solution ofinexpensive chemicals, and to produce large amounts of protein.With the toolbox of recombinant DNA technology, the genetic mate-rial of the bacterium is changed through the addition of a segmentof DNA that carries instructions for the protein that will become adrug; in this case, human insulin. Each bacterium becomes a verysmall production “factory” for the protein that is then purified, orfreed from all the other chemicals.

Changing the Protein

Other steps may be needed to actually make the protein useful. Forexample, the protein may need to be treated to make it on take thecorrect shape, or to make it fold the right way (Figure 4.2). In thecase of insulin, something else is needed, something that is notrequired to make pig or cow insulin useful for humans. When theislet of Langerhans cells in the pancreas of cows, pigs, or humans“read” the gene for insulin to create a protein, the first product is alarge protein. The starting protein is trimmed of a precise section ofamino acids while it travels in the islet cell to the spot where it willbe packaged for transport into the bloodstream. In that package, theprotein is again clipped at two spots with great precision to produceinsulin. Insulin consists of two short peptides, one of which is 21amino acids long and the other 30 amino acids long. The peptidesare held together by weak chemical bonds. To produce insulin inE. coli, scientists knew that the bacteria could not process the startingprotein into insulin on their own, so they came up with a solution.They inserted two different plasmids into E. coli, one carrying the


DNA coding for the 21-amino-acid chain and the other carryingthe DNA sequence coding for the 30-amino-acid chain. In bothplasmids, the DNA sequence was linked to instructions for anotherprotein, an enzyme protein. The bacteria produced two fusedproteins of enzyme and one of the two insulin chains.


Figure 4.2 This three-dimensional image of a protein shows the many twists andfolds in its structure. The coils, called alpha helices, and the ribbons, called betapleated sheets, are generally determined by the amino acid sequence of the proteinand how the amino acids in different parts form weak bonds with each other. Theshape of a protein is often critical for its function.

One more trick allowed scientists to control when the insulinpieces would be produced. Both enzyme-insulin chain DNA cas-settes included a promoter that would trigger the production of thefused proteins when a simple chemical was added to the bacteria.When the bacteria had grown to a high concentration in the vat, thechemical was added to trigger the production of both enzyme-insulin chain fusion proteins. The mixtures of the two proteins arepurified and treated to clip off the enzyme protein from bothinsulin chains. The liberated chains join together through the weakchemical bonds and take the shape of insulin. Yeast have also beengenetically engineered to produce human insulin.

The Shape of Proteins

In this business, size and shape are critical. Most proteins, likeinsulin, will only have the right effect on cells if they have the correctsequence of amino acids and the appropriate three-dimensionalshape. This is because, in order to work, the protein must fit neatlyand precisely into the pocket of another protein, called its receptor.Insulin has effects on various cells because those cells have a dockingprotein for insulin—the insulin receptor—on their outer mem-branes. The receptor is connected inside the cell with biochemical“toggle switches” that signal that insulin has arrived. Insulin must fitinto the receptor like a key in a lock in order to cause very specificbiochemical changes in the receptor and trigger its effect. Thewrong key works poorly, if at all (Figure 4.3).

There are thousands of sets of signal proteins, like insulin andits receptor. These systems of paired protein-control moleculesand their receptors have evolved over millions of years andprovide the very precise orchestration of thousands of differentchemical reactions that are required to keep our bodies alive andworking. Although illness that develops because of a failure inthese systems may seem like a terrible betrayal of how thingsshould work, the fact that so many complex systems in so many


cells work correctly just about each and every day can seem evenmore remarkable.

Over many decades, scientists have worked to understand howeach of these systems in each cell and in the whole organism


Figure 4.3 A prototype signal protein and its receptor is illustrated here.The human body relies on hundreds of different signal proteins dockinginto very specific and selective cell membrane receptor proteins tocontrol which cell proteins are made or broken down and how the cellfunctions by sending specific chemical signals to other parts of thecell. The signal proteins may be produced by a nearby cell or reachits target from a distant cell through the blood stream.

works—what component does what and how. With a growingunderstanding of how proteins work, physicians and scientists suchas Banting sought to replace a missing or malfunctioning protein.An animal protein could not correct every missing or defectiveprotein in a human patient, however, because, in some cases, theanimal version of the protein is too different in shape to fit correctlyinto the human cell receptor. Pig insulin differs from human insulinby only 1 of its 51 amino acids, so it works well on human cells. Notevery animal protein is as similar to its human counterpart, though,so deliberately producing the human protein itself seemed like agood idea. The recombinant DNA methods that were developedbeginning in the 1970s made that possible.

Another Kind of Factory: Producing Sugars

Some human proteins produced in a bacterium will not work evenif the amino acid sequence is identical to the human protein. Thisis because our cells, and the cells of plants, animals, and yeast,add sugars to most of the proteins they produce. There are manydifferent kinds of sugar molecules, and the type of sugar added andthe place in the cell and on the protein where the sugars are addedvary among cells for different species. If the correct sugars are noton the correct spot on the protein, the protein may not fit into thereceptor pocket correctly, and thus not have the desired effect. Also,without the added sugars, the enzymes in our blood may destroythe protein before it can get to the appropriate spot to bind to thecorrect receptor.

One way to overcome this problem is to make the protein incells from organisms that do add sugars to their proteins, as ourcells do. To accomplish this, scientists have developed ways to putthe genetic information for the drug protein into an animal, plant,insect, or yeast cell so that the protein will be made with sugaradded. But because different types of cells and even the same cellsunder different conditions may attach different sugars in different


spots, there is no guarantee that the sugars will be in the right placeto make the protein useful.

Producing a protein drug from a genetically changed cell(animal, insect, plant, or yeast) has required scientists to inventnew ways to deliver the genetic information for the protein prod-uct to the factory cell so that it becomes a stable part of thecell’s genetic material, copied every time the cell divides and readconsistently by the cells’ protein-making machinery. Technolo-gists also had to develop methods and equipment to allow cells toincrease in number and produce the desired protein in largeamounts in the laboratory. The genetically changed plant, insect,animal, or human cells must emit the protein into the broth inwhich they are growing or accumulate the protein in a part of thecell without doing too much damage. Making a protein in aeukaryotic cell is not the biotechnologist’s first choice for anumber of reasons. The broths, or culture media, for animal,insect, and human cells are more complex and expensive than thebroth in which bacteria or yeast will grow, but if the protein is notmanufactured, embellished with sugar, and folded correctly, thenthe less expensive ways will not do.

USING ANTIFREEZE TO KEEP PROTEINS IN THE BLOOD

In some cases, recombinant proteins created in E. coli or other cellsystems can be changed after production to increase the amount oftime they remain in the blood by adding units of ethylene glycol—more commonly known as antifreeze. When strung together andthen attached to a protein with some careful chemistry, one or morestrands of polyethylene glycol may increase the length of time theprotein remains in the circulating blood by 5 to 10 times. Theseaddition of polyethylene glycol appears to protect the protein frombeing digested by enzymes in the blood, so that a protein drug mayrequire less frequent injections. There is another potential benefitfrom adding polyethylene glycol to a protein drug. The immune


system reacts to foreign proteins and protein drugs that are notnative human proteins. If linked to polyethylene glycol, foreignproteins are less likely to be taken up by the cells of the immunesystem and therefore are less likely to trigger an immune response.

CHOOSING A PRODUCTION SYSTEM

The biotechnologist who wants to produce a recombinant proteinhas to make a series of choices based on what is known about thepotential protein drug, how it works, how “fussy” its receptor is,whether the protein will be chewed up by enzymes in the blood,how long the protein must stay in the blood or in other places inthe body to have an effect, and much more. Practical questionshave to be asked, including: How expensive would it be tomanufacture the protein in one cell system or another? Doesthe protein need to be sweetened with sugars to work? Shouldpolyethylene glycol be added to increase the time the protein staysin the body? Would the production of large amounts of theprotein damage the bacteria or cell system used for production somuch that the cells would die before enough protein was made?Should the protein be produced all the time or should productionjust be “switched on” after the number of bacteria or other cellshas increased greatly? What signal will be used to “turn on”production of the protein? Although there may be no one perfectset of answers to these questions for any particular proteindrug, pharmaceutical biotechnologists must make some educatedguesses and test them by creating the genetic constructs, deliver-ing them to the candidate cell system, and running an experimentto see whether the amount of protein created is enough to beeconomically feasible and whether the protein product can bepurified. Most importantly, experiments must be conducted tosee if the test material works. Development of a suitable produc-tion system for a recombinant protein drug can take many triesover a period of many, many months.


THE PRODUCTION OF ANTIBODIES

Although the serum of animals immunized with small amountsof toxins has been used for many years to help people recoverfrom diphtheria or to provide protection against snake or scor-pion venom, there have been other situations where a specificantibody was needed in a concentrated form. Unfortunately, therewere limits to what animal antibodies could do. First, the animalserum preparations, even with repeated injections, were mixturesof antibodies—not collections of many of the same antibody.That is just the way the immune system works in animals, includ-ing humans. In addition, there was always the danger of takingthe serum from a diseased animal; remember the case of Jim, thehorse with tetanus!

As with penicillin and insulin, serendipity rewarded preparedminds. Georges Kohler, a Swiss postdoctoral fellow working atCambridge University in England, with Argentine-born ProfessorCesar Milstein, wanted to understand how the production ofantibody proteins was controlled within immune system cells. Inthe late 1950s, scientists had discovered that any single antibody-producing cell made only one form of an antibody protein, andthat some blood cancers produced large amounts of a single typeof antibody protein. In fact, physicians could diagnose this type ofblood-cell cancer by showing that the serum of the patients wasnot filled with the usual mixture of antibody proteins, but insteadhad one predominant antibody protein.

The science of growing blood-cell cancers had advanced to thepoint that cultures of such cancers from mice or humans could beeasily grown in the lab. Normal antibody-producing cells frommice that had been immunized to produce antibodies to a specificprotein did not survive in the laboratory, but antibody-producingcancer cells grew just fine, emitting lots of antibody protein. Kohlerand Milstein wanted to know what changes allowed the antibody-producing cancer cell to survive and grow in the laboratory and


produce antibodies, and whether these abilities could be sharedwith normal antibody-producing cells from an immunized mouse.To find out, they used two technologies: cell fusion and cell cloning.They found that if they immunized a normal mouse with a partic-ular substance and then took the mouse’s antibody-producing cellsand fused them with mouse blood-cancer cells, some of the fusedcells would survive and produce antibody protein—not the anti-body protein of the tumor cell, but one of the antibody proteinsthat the immunized mouse produced. The scientists could clonethe antibody-producing fusions, creating cultures of millions ofidentical cells from a single fused pair. The culture medium of theclones contained many millions of molecules of identical antibodyprotein. The antibody-producing cells were called hybridomas andthe antibodies they produced were called monoclonal antibodies,because they were the result of genetic instructions from a singleantibody-producing cell (Figure 4.4).

The potential uses of monoclonal antibodies were not lost onthe scientific, medical, or business communities. Soon, the methodwas being used to produce monoclonal antibodies for labora-tory tests and treatments for a wide variety of diseases. In 1984,Milstein and Kohler were awarded the Nobel Prize in Physiologyor Medicine.

Different Animals and Different Antibodies

There was a problem with using mouse monoclonal antibody pro-teins to treat some human diseases, however. The human immunesystem recognizes the mouse antibody as the foreign protein it is,


Stop and ConsiderWhy was the invention of monoclonal antibodies important? Whatdoes the story of how the process of making monoclonal antibodieswas developed tell you about basic scientific research?


Figure 4.4 The process of developing a mouse monoclonal antibody is illustratedhere. Antibody -producing cells from a mouse immunized with material containingthe intended antibody target are fused with tumor cells to produce hybridomas.The hybridomas are cloned and the culture fluids are tested to find the cloneproducing the desired antibody. Large amounts of the monoclonal antibody canthen be isolated from the culture medium.

and, useful or not, produces antibodies against it. These antibodiescapture the useful antibody, rendering it useless and sending it onits way to destruction. So mouse monoclonal antibodies could notbe effectively injected over and over again.

Scientists have invented several ways to get past this problem.The portions of the antibody protein that allow it to bind to a specificchemical structure are very small bits located at one end. The rest ofthe antibody molecule allows the antibody to work, directing cellsto remove the foreign molecule or cell or triggering the death ofan infecting bacterium or virus (Figure 4.5). Methods were devised toisolate the genetic instructions for the targeting end of the mousemonoclonal antibody and insert it into the genetic instructions fora human antibody protein. This meant that only a very small bitof the engineered, now “humanized,” antibody was not human,and the monoclonal antibody would be much less likely to trigger animmune response that would prevent it from being used repeatedly.The genetic information to produce an antibody that was mostlyhuman could be inserted into an animal cell for manufacture.Another solution was the development of methods to fuse humanantibody-forming cells with blood-cancer cells so that the mono-clonal antibodies were not just humanized, but actually human.

Researchers are also testing minibodies—small pieces of anti-bodies engineered to be produced in bacteria or animal cells.Because of their small size, minibodies may be able do things to cellsthat larger, bulky antibodies cannot do. Such a minibody hasrecently been produced and tested in animals, and in the future mayhelp patients with certain kinds of bleeding disorders.


Stop and ConsiderWhat concerns do you have about humans creating new microorganismsthrough genetic engineering?


Figure 4.5 The most common antibody molecule is a complex combinationof two identical light and two identical heavy chains, held together byweak bonds formed by sulfur-containing amino acids. The four variableregions form the antigen binding site; the constant regions allow theantibodies to trigger the cell-damaging complement cascade and signalphagocytic cells to engulf and break down invading microbes.

CONNECTIONS

In 1982, the FDA approved human insulin made in E. coli, the firstrecombinant protein drug to gain approval. Since then, biotech-nology has provided more than 90 new medications and manydiagnostic laboratory tests using these basic building blocks, tools,and tricks. But producing a protein drug is far from a sure thing.When scientists propose that a recombinant protein may be usefulfor preventing, treating, or diagnosing a disease, the challenge is tofind a way (through both established and new molecular biologymethods) to produce a protein economically and to show thatthe drug has the desired effect on cells in laboratory and animaltests. Many months of experiments are required to develop a cost-effective, reliable, and safe production method. Sometimes newfactories must be built just to perform these experiments. The FDAalso requires drug manufacturers to show that any drug producedis free of potentially harmful contaminants. Only then may humantrials begin to test whether the drug is safe and effective. Becausebiotechnology drugs are produced from living organisms, specialsteps must be taken to show that the FDA’s standards for purity andsafety have been met. Biotechnology drugs can be more expensiveto make than conventional drugs synthesized in the laboratoryfrom simple chemicals because of the time, effort, and costs ofdeveloping the production process, creating large amounts ofa protein drug and meeting FDA requirements. Biotechnologydrugs, however, may provide treatments that would not otherwisebe available and in some cases may provide life-saving options.


FOR MORE INFORMATIONFor more information about the concepts discussed in this chapter,search the Web using the keywords:monoclonal antibodies, bacterial transformation, transfection of cells

PIONEERS AND MEDICAL ADVANCES

The first modern biotechnology drugs, human insulin and humangrowth hormone, were replacement proteins for conditions that hadbeen treated with proteins extracted from animal or human tissues.In 1982, recombinant human insulin was approved to control bloodglucose levels, and in 1985, recombinant human growth hormonewas approved to treat children who were growing too slowly becauseof a lack of growth hormone. Previously, insulin was extracted fromanimal tissues and human growth hormone was extracted from thebrains of human cadavers. Physicians and patients were familiarwith the older versions of these drugs, and the recombinant prod-ucts, though pioneering, were not considered dramatic medicalbreakthroughs. Animal insulin was widely available and workedquite well for the vast majority of insulin-dependent diabetics, andalthough the lack of growth hormone might have presented social

61

Uses for Recombinant Protein Drugs

5

and emotional problems for some people of short stature, theconsequences were not life-threatening. The older treatment forgrowth hormone deficiency was dangerous. Human growthhormone from cadavers could be contaminated with a mysteriousinfectious protein that led to dementia and death.

The development and approval of the recombinant versions ofthese drugs was the culmination of years of work by scientists. It alsopresented a problem for the FDA. How would the agency reviewapplications for approval of drugs produced using recombinantDNA methods? The FDA recognized that, though the method ofproduction of the new recombinant drugs might be different, theagency’s focus needed to stay on the product, rather than on the wayit was produced. The key questions for the reviewers were 1) whetherthe product was safe and effective, 2) whether it could be manu-factured so that it would be consistently pure, and 3) whether themanufacturer had provided satisfactory written evidence for thesefacts. The FDA’s decision to focus on product rather than sourceallowed the field of recombinant medicines to move forward morerapidly than other applications of biotechnology.

REPLACING MISSING PROTEINS

Several recombinant drugs treat inherited conditions by replacingmissing or malfunctioning proteins. Several of these are enzymes,proteins that drive biochemical reactions. The body has manydifferent enzyme proteins, each of which performs a specific jobin the construction or breakdown of chemicals. Some inheritedconditions are caused by a destructive buildup of substances, abuildup that occurs because of an error in the gene for a particularenzyme that breaks down that chemical.

One example is an enzyme replacement drug used to treat aform of Gaucher disease, which is caused by an inherited error inthe gene coding for the enzyme that breaks down the fatty sub-stance cerebroside. In Gaucher disease, certain immune system cells


called macrophages fill up with cerebroside, and large numbers ofthese fat-loaded cells settle in the liver, bone marrow, and spleen(the large blood-forming organ located above the liver). InGaucher disease, patients’ bones may not develop normally andmay break without trauma, because macrophage-related cells areinvolved in bone formation and destruction. The Gaucher cellsmay also cause severe pain, because macrophages carry proteinsthat cause pain, which they can emit where they accumulate. Thenew treatment for this inherited disease is an example of amodern biotechnology drug replacing a conventionally deriveddrug, much like insulin and growth hormone. In 1991, researchersproduced large amounts of the normal form of the enzyme fromhuman placentas (the organ that delivers nutrients to the fetuswhile it is inside the womb) but the enzyme as isolated did notwork as a treatment because the accumulated cerebroside is insidethe Gaucher cells and the isolated enzyme could not enter thecells. To solve this problem, scientists attached sugar molecules toone end of the enzyme protein—not just any sugars but those thatwould specifically trigger the Gaucher cells to suck in the enzyme.The scientists knew which sugars instructed macrophages to con-sume things. The particular sugar they attached fit neatly into areceptor on the surface membrane of the macrophage/Gauchercells and when the sugar-linked enzyme landed on the receptor,the cell membrane folded into a little balloon and engulfed thesugar/protein package.

The placenta-derived enzyme was treated to make any associ-ated risk of viral infections low, but a small risk of infection fromhuman tissue remained, so scientists developed a recombinantreplacement enzyme, with the right sugar embellishment, producedfrom a laboratory source. Unfortunately, about 15% of patientstreated with the replacement enzyme develop antibodies to theprotein that can reduce the usefulness of the injections and pose arisk of mild to severe allergic reactions. At the moment, however,

63Uses for Recombinant Protein Drugs

enzyme replacement seems to be the most promising treatment forthis rare and potentially lethal inherited disease.

Like many recombinant treatments for chronic diseases, therecombinant replacement enzyme for Gaucher disease is veryexpensive: A year’s treatment can cost over $150,000, though mostprivate insurance companies will reimburse patients for its use.


PRO OR CON?

Are the Prices for Biotechnology Fair?

Biotechnology drugs can cost a lot. Should they?This is not a simple question. Biopharmaceuticals—usually large

and complex protein drugs—can cost patients, or their insurancecompanies, tens or even hundreds of thousands of dollars for ayear’s treatment, or in some cases, for just a few weeks’ course oftreatment. These drugs may also be the only option to save a life, orat least to extend, a patient’s life for a few weeks, months, or years.Whether the patient is old or young, a felon or an upstandingcitizen, how does society put a price on those weeks, months, oryears? The biotechnology drug may provide the most effective wayto treat the pain and stop the crippling effects of a chronic diseasesuch as multiple sclerosis or arthritis. The costs of discovering,manufacturing, and testing a biotechnology drug are high, possiblyeven higher than the $200 to $800 million estimated cost ofbringing any new drug, biotechnology product, or small chemicalto the market. Often, a company spends a quarter to half a billiondollars to build a special factory to meet federal regulations and tosafely produce required amounts of needed proteins. Biotechnologyis a financially risky business; a drug can fail at any stage of testing.Biotechnology companies may not make a profit for many years,even after one or more biopharmaceuticals is approved for sale. Onthe positive side, from a business point of view, a single successfulbiotechnology drug can bring in hundreds of millions, even billions,of dollars in sales.

THE NEED TO MAKE TREATMENTS SAFE

Treating Hemophilia

In the early 1980s, the development of HIV/AIDS in young bloodtransfusion patients was a powerful incentive to find other sourcesfor the blood-derived proteins used to treat hemophilia, a group ofinherited disorders affecting the clotting of blood. Hemophilia has


The FDA does not set the price for a drug; the manufacturersets the price after considering the costs of developing thedrug, the relative benefit of the drug compared with alterna-tives, and the amount insurance companies reimburse foralternative drugs. Because of patents and FDA rules, for several years after a drug is approved for sale, the pharma-ceutical company usually has an exclusive right to sell thedrug before exact copies of the drug, called generics, may be sold. When generics enter the market, competition usuallydrives down a drug’s price. To gain FDA approval to market a generic small molecule drug, a manufacturer only has toshow that it can consistently manufacture the drug to highstandards of purity, and that the generic version of the drug is taken up and eliminated from the body in the same way asthe original drug—tasks that may be more difficult to do forbiotechnology drugs. Currently, the FDA is considering whatthe rules should be for a generic biotechnology drug. But rules allowing the sale of generic biotechnology drugs will not necessarily drive down the price. Some biotechnologydrugs treat rare diseases, and manufacturers may not invest in producing generic biotechnology drugs unless a large numberof people need the drug. The National Organization of RareDisorders (NORD) works with a number of pharmaceutical andbiotechnology companies to provide financial assistance forpeople who need particular medications.

TREATING HEMOPHILIA

been recognized from ancient times as an inherited tendency(mainly in males) to bleed excessively even after a minor wound.This life-threatening condition affected the last Russian royalfamily (the Romanovs, who died in 1918) and many of their rel-atives among other European royalty. There are about 20,000people, mostly men, living with hemophilia in the United States.Worldwide, the prevalence of the disease varies from country tocountry, but there are probably 200,000 to 400,000 people aroundthe world with hemophilia.

Many proteins and cells are involved in the complicated processthat causes blood to change from a liquid to a solid, which is whathappens in blood clotting. Errors in the genes that code for any ofthese proteins may put a person at risk of severe bleeding—evenbleeding to death—from a minor cut. Hemophilia A and B, themost common forms, result from errors in two different clottingprotein genes carried on the X chromosome. Because the genes areon the X chromosome, males (who have an XY chromosomearrangement) only have to receive one defective gene to suffer frombleeding problems. Carrier females (women have two X chromo-somes) with one normal and one defective copy of the genegenerally do not experience bleeding problems, but their sons havea 50% chance of inheriting the defective gene and suffering from thedisease. Women can have hemophilia, but because they must haveinherited a copy of the defective gene from both parents, it is veryrare. Hemophilia A and B are the result of inherited defects in twodifferent proteins, called factors, both part of the cascade of stepsthat allows blood to clot. Males with hemophilia A have inherited adefective version of the gene for the Clotting Factor 8; those with adefective copy of the gene for Clotting Factor 9 have hemophilia B.

Hemophiliacs are treated with clotting factors when they havesevere bleeding episodes, and are also treated to prevent bleeding ifsurgery or any other activity that might lead to bleeding is planned.Before recombinant technology, the fluid part of normal human


blood was the only source for the replacement clotting factors. Thefirst version was fresh frozen plasma from donated blood. Plasma isthe fluid part of blood that has not clotted, which would use up theclotting proteins. Fresh frozen plasma has to be kept cold to remainactive and useful, and the low concentration of proteins in theplasma meant that a large volume—a quart or so—had to beinjected slowly into the patient’s vein. Storage and treatment athome were impractical.

In the 1960s and 1970s, concentrated clotting factors weredeveloped, and storage and treatment at home became possible—a welcome advance because it meant fewer trips to hospital emer-gency rooms for people with hemophilia. However, in the early1980s, it became clear that commercial sources for the concentratedfactors were infecting hemophiliacs with HIV because some of theblood used to prepare the concentrates had been donated by peopleunknowingly infected with HIV. Back then, the virus had not yetbeen identified and there was no way to detect it. Because of thedanger of using commercial concentrates, hemophiliacs were onceagain forced to make frequent visits to the emergency room.

Something had to be done to protect hemophiliacs from seriousbleeding problems without infecting them with a deadly virus.Better methods for preparing clotting factors from blood andthe development of recombinant clotting factors provided thesolutions. Methods of detecting, inactivating, and removing viruseswere improved, and none of the hemophilia replacement products—conventional or recombinant—has transmitted either HIV orhepatitis since 1987. As an alternative, recombinant clotting factors8 and 9, produced in animal cells, were approved in 1992 and 1997,without the risk associated with human blood products.

WORKING WITH BLOOD CELLS

Our blood cells do many different types of work: They carry oxygen,fight infections, and help repair leaks in blood vessels. The cells also


share another quality—they don’t stay around for a very long time.Sometimes they die in the work they do, but they have a short lifeexpectancy in any case. This may be good from a biological pointof view, but it can also cause trouble. Red blood cells live for about120 days, and white blood cells, the first responders to an infection,only live for 1 to 1 1/2 days. This means that we must constantly beable to replace blood cells, and we can. The bone marrow, the softtissue inside the larger bones in our body, manufactures these cellsand is normally very good at it. For example, every day, the bonemarrow produces about 200 billion red blood cells to replace thosethat are dying. Having too few blood cells creates problems andso does having too many, so our bodies have a system of growthfactor proteins that instruct the bone marrow to produce more ofa particular type of blood cell when and only when its numbersdrop. Many different bone marrow growth factors have beenfound. Each works by docking at a specific receptor protein on animmature bone marrow cell and triggering it to divide and developinto the next stage, resulting in the production of the type ofcell the body needs. This system of matched signal proteins andreceptors is finely controlled, and the supply of cells normallykeeps up with the body’s demand.

If something happens to cause a dramatic drop in the numberof blood cells—a drop too large to wait for normal production tokick in—then a dose of the appropriate blood cell growth factormight help. This is where biotechnology steps in. These proteins,which trigger the cell division and the specialization of cells(Figure 5.1), are present at very low levels in the blood. We haveseen in the discussion of hemophilia how trying to replace ablood protein can lead to different kinds of problems. Blood cellgrowth factors are present in very small amounts in the blood, sopurifying them from blood is impractical. Instead, scientists haveisolated the genes that direct the production of a number of theseblood-cell growth proteins, engineered them into an appropriate


(continued on page 72)


Figure 5.1 Growth factor receptors are illustrated here. Docking proteins—receptorsfor protein growth factors—are embedded in the outer membranes of cells. Binding ofthe specific growth factor triggers a cascade of biochemical signals that cause the cellto divide and express the proteins that give the cell specialized properties.


Millions of our blood cells die and are replaced every day. The production system for thesecritical cells is an orchestrated process of growth and development of specialized cells fromimmature precursors, driven by protein factors. This only happens once we are adults. Thegeneral process is named for the differentiation—the change from an unspecializedcell to a specialized cell able to do a job because of the presence of particular proteins.

A single type of precursor cell, the hematopoietic stem cell, gives rise to red bloodcells, white blood cells to fight infections and populate our immune system, and plateletsto help heal wounds and plug up leaks in blood vessels.

Except for lymphocytes, each specialized blood cell is a workhorse at the end of its road;each remains in the circulatory system or in a tissue and then dies, perhaps as a result ofdoing its job. Red cells (erythrocytes) have lost their nucleus, and platelets are fragmentsof precursor cells. Because they have no nuclei, human red cells and platelets cannot divide.

The drivers of the cell division and differentiation of each cell are signal proteins thatdock onto the membrane of a less specialized cell and trigger that cell to go to the nextstep to make the particular required proteins; for example, erythropoietin triggers thedeveloping red cell to manufacture hemoglobin. The cells in the intermediate stage,those moving from hematopoietic stem cells to more committed cells, have on theirmembranes the docking proteins needed to allow the cell to respond to the proteintrigger for the next transition.

Neutrophils, eosinophils, and basophils are infection-fighting cells that develop froma common precursor cell. Each has distinctive granules in its cytoplasm and is named forthe way those granules take up certain dyes. A protein called granulocyte-stimulating factor(G-CSF) causes the final step (Figure 5.2). The process can be traced further back to the pro-duction of the shared granulocyte precursor cell, which is triggered by granulocyte-monocytestimulating factor (GM-CSF). These factors were named “colony stimulating factors” becausethe scientists who discovered them relied on the ability of these factors to cause colonies,or groups, of the particular cells to grow in laboratory cultures. Erythropoietin drives develop-ment of a process through which precursor cells eventually give rise to red cells throughseveral steps. The same precursor cell, if triggered by different protein factors—interleukin-11 and thrombopoietin—develops into a cell that clips off bits of itself to make platelets. Thenames may seem complicated, but they make sense if you know their sources. Interleukinis the general name for proteins produced by one white cell that influences another;11 indicates that it was the 11th such white cell signal protein to be discovered; poietin atthe end of the names comes from a Greek word that means “make more;” erythro means“red;” thrombo means “clot;” and “leuko” comes for the Latin word for white.

The Production of New Blood Cells


Figure 5.2 All types of blood cells are formed from uncommitted blood (hematopoietic)stem cells in a process called differentiation. Specific protein factors drive the developmentof erythrocytes (red blood cells), platelets, and the white blood cells including neutrophilsand eosinophils, basophils, all with multi-lobed nuclei, and the mononuclear monocytesand lymphocytes that provide specific protein and cellular defenses to the body.

cell production system, and produced the specific recombinantproteins to stimulate production of red cells and several kinds ofwhite blood cells.

Red Blood Cells and Erythropoietin

The kidney normally manufactures erythropoietin, the growthfactor for the production of red blood cells. In fact, erythropoietinwas first isolated from the urine of patients with anemia, a con-dition characterized by too few red blood cells. Red cells carryoxygen to the body’s tissues, and if too little oxygen is deliveredto them, certain kidney cells produce erythropoietin. Most of thissubstance goes into the blood, where it circulates to the bonemarrow and other tissues and triggers increased production of redcells from immature cells. Some erythropoietin spills into theurine. The concentration of erythropoietin in the blood is verylow. The concentration is even lower in urine, but urine is easy,safe, and cheap to collect, and it does not contain a large numberof other proteins.

The first successful scheme to purify erythropoietin from urinestarted with 2,550 liters of urine, and through a series of steps toremove other proteins based on what was known about erythro-poietin, scientists produced only enough of the substance to conductsome laboratory tests. This was not a practical way to get the growthfactor, so scientists engineered animal cells to produce recombinanthuman erythropoietin (Procrit®/Epogen® and Aranesp®) to treatpeople who have anemia. Anemic patients often feel very weak andtired because their muscles do not receive enough oxygen. Redblood cells are filled with hemoglobin, a protein that shuttles oxygenfrom the lungs to the tissues and moves waste CO2 from the tissuesto the lungs. Anemia occurs in patients whose kidneys have failed(and thus do not produce erythropoietin), and in patients receivingcertain cancer drugs that slow the bone marrow’s production of redcells. The same form of erythropoietin is marketed to treat cancer


(continued from page 68)

patients (Procrit) and patients with kidney failure (Epogen). Toproduce darbepoietin (Aranesp), a sweetened form of erythro-poietin, scientists changed the gene sequence so that the proteinhas two more places to which the producing animal cell wouldautomatically attach chains of sugars. The added sugars makeAranesp stay in the blood two to three times longer than Epogenor Procrit so that it can be injected once a week rather than two orthree times a week.

Helping the Body Fight Infection

Three recombinant protein drugs—Leukine®, Neupogen®, andNeulasta®—are used to stimulate the formation of infection-fighting white blood cells in patients undergoing chemotherapy forcancer treatment. The goal is to make sure patients have enoughwhite blood cells to attack infecting bacteria. Several differenttypes of infection-fighting white blood cells come from one pre-cursor cell, and sargramostim (Leukine) stimulates the productionof the shared precursor. Produced in yeast cells, sargramostimdiffers from the native form of the protein by one amino acid.Filgrastim (Neupogen) and pegfilgrastim (Neulasta) are two formsof a natural protein that stimulates production of infection-fightingwhite cells at the last step. Both are produced in E. coli, but peg-filgrastim is tagged with polyethylene glycol, making it stay inthe blood five times longer or even more, thus allowing a moreconvenient schedule of injections.

Platelets, small cell fragments produced from bone marrowcells, work with the cascade of proteins in the formation of bloodclots. If platelet counts are low, leaks in blood vessels that wouldnormally be small can lead to the loss of large amounts of blood.Certain chemotherapy drugs knock out the production of thecells that produce platelets. Oprelvekin (Neumega®), produced inE. coli, stimulates bone marrow to produce that very importanttype of cell.


IMMUNE SYSTEM DRUGS

The immune system has been a prime area of research for recom-binant biotechnology drugs, particularly as scientists found cluesto the identity and workings of the cells and proteins of this verycomplex system. Like many complicated biological systems, theimmune system has complementary features—systems to speed itup and others to slow it down. Modern biotechnology exploits bothsides for different purposes. If there is a threat from an infection ora tumor cell, the goal is to strengthen the immune system. If theimmune system itself is going haywire and mistakenly targetingthe body’s own tissues for destruction, as in autoimmune diseases

like rheumatoid arthritis or multiple sclerosis, the goal is to dampenthe system. When a kidney, liver, heart, lung, or other organ istransplanted from one person to another, the immune system ofthe patient receiving the transplant must be controlled so that thegenetically different tissue will not be rejected, its cells attacked andkilled by immune system’s cells and proteins because the bodyrecognizes the transplanted tissue as foreign. Biotechnology methodshave provided several treatments to suppress the immune responseto let the body accept a transplanted organ or to reduce tissuedamage caused by autoimmune diseases.

Suppressing the Immune Response

Preventing the Action of T Cells

Muromonab (Orthoclone OKT3®) is a mouse monoclonal antibodythat kills T lymphocytes, cells that are a part of the immuneresponse. Muromonab, the first monoclonal antibody approved foruse as a drug, is used to treat rejection of a donated kidney, liver, or


Stop and ConsiderHow has the immune system provided the opportunity for so manybiotechnology drugs?

heart graft. Daclizumab (Zenepax®) and basiliximab (Simulect®) aremonoclonal antibodies that bind to the docking protein for inter-leukin-2 (IL-2), the key growth signaling protein for T lymphocytes,also called T cells. If T cells do not receive the IL-2 trigger, they donot increase in number and an effective immune response does notoccur. These monoclonal antibodies, each made more like humanantibodies in slightly different ways, prevent the effective docking ofIL-2 and are used to prevent rejection of organ grafts.

Stopping Immune Attacks Against the Body

Interferons are a family of immune system signal proteins that playmany different roles in our bodies. Interferons were originallynamed because they interfered with the ability of viruses to infectcells. They also have been genetically engineered to provide treat-ments to weaken or strengthen the immune response. One form ofinterferon, interferon-beta, slows the immune response and restoresbalance to an immune system directing a destructive attack againstthe body’s own tissues. Such an attack plays an important role inmultiple sclerosis (MS), a disease in which the immune systemattacks myelin, the fatty insulation around nerve fibers in the brainand spinal cord. As a result of the loss of myelin, people withMS can experience attacks of weakness, eye problems, difficultywalking, and even paralysis. Several forms of interferon-beta(Betaseron®, Avonex®, and Rebif®) are used to reduce the frequencyof attacks in multiple sclerosis and slow the development of handi-capping disabilities.

Controlling Hepatitis

A type of interferon produced by white blood cells, alpha interferon,has been engineered and produced to keep the progression ofhepatitis C virus, a serious liver infection, under control. The firstalpha interferons were slightly modified forms of natural interferonalpha produced in E. coli. More recent versions, peginterferon and


peginterferon alfa-2b (Pegasys® and Peg-INTRON®), also producedin E. coli, are alpha interferons linked to polyethylene glycol chainsto lengthen the time the protein stays in the blood 20-fold, so thatinjections need be given only once a week rather than every otherday. A chemical drug to inhibit hepatitis virus production is usuallygiven along with the interferon to help keep the number of virusesdown and to slow liver damage.

Suppressing Inflammation

Cells and proteins of the immune system can trigger a set ofresponses that together are called inflammation. Inflamed tissue iswarm, red, swollen, and painful because an injury or a wound callsin cells that make small blood vessels swell and leak blood fluids.Inflammation is what creates the redness, warmth, swelling, andpain. How does inflammation happen? The white blood cells thatgather at the site of the threat produce several proteins that not onlysignal to other white blood cells but can also damage surroundingcells and tissues. Rheumatoid arthritis (RA) is an autoimmunedisease in which immune system cells attack tissues in the joints. Thisattack triggers inflammation, causing pain, swelling, and, if leftunchecked, crippling damage to the joints of the hands, arms, andlegs. The nonprescription anti-inflammatory drugs aspirin andibuprofen, along with several prescription anti-inflammatory drugs,are sometimes enough to treat rheumatoid arthritis, but in severecases, these drugs may be unable to control the damage. Severalrecombinant proteins that target inflammation are used to treat RA.All are directed at proteins that play a part in inflammation.

Etanercept (Enbrel®) is an engineered protein that combines thetail of an antibody with a part of the receptor for tumor necrosis

factor (TNF). TNF is one of the cell-damaging proteins involved ininflammation. It got its name because the first thing scientistsdiscovered that it did was kill cancer cells. Killing cancer cells is onlyone of its skills, however, and that may be something that happens


only in the laboratory. Regardless,TNF is one of the major playersin inflammation. Two other biologic drugs that target TNF are usedto treat RA. Both are monoclonal antibodies that bind to TNF itselfand take it out of action and eventually out of the body. Infliximab(Remicade®) is a monoclonal antibody to TNF, engineered so thatonly the TNF binding ends of the antibody contain the mousesequence; the rest of the antibody looks like a human antibodyprotein. This reduces the chance that patients treated with inflix-imab will develop an immune response to it. Infliximab is alsoused to treat Crohn’s disease, an inflammatory condition thataffects the intestines. Another TNF-targeting antibody used inRA, adalimumab (Humira®), was designed so that it is essentiallyentirely a human antibody.

Scientists have also developed the ability to engineer monoclonalantibody molecules into plants. Although no plant-produced anti-body has been tested in humans, a plant-produced human mono-clonal antibody to the rabies virus was able to protect hamsters fromrabies after they were exposed to the virus. Development in this area hasbeen slowed by technical issues of efficiency, economics of productionof monoclonal antibodies in plants, as well as environmental and safetyconcerns about growing genetically engineered antibody-producingplants in open fields. Biotechnologists must first overcome the tech-nical problems that to date have prevented plant production frombeing economically competitive with production in cell culture.

Vaccines

Vaccines made with recombinant proteins marshal an immuneresponse to specific viruses to treat or prevent disease. Vaccinesto prevent infection with the liver-damaging hepatitis viruses(Twinrix®, Recombivax HB®, and Engerix-B®) include a recombi-nant version of a hepatitis virus B protein. Recombinant hepatitisB protein is also included in some combination vaccines given tochildren. Comvax® also includes a recombinant flu virus protein,


and Pediatrix™ adds recombinant hepatitis B protein to theisolated bacterial proteins and killed bacteria of the DPT shot andinactivated poliovirus.

Researchers are working to produce recombinant proteins fromviruses in plants so that the leaves, fruit, or root (such as potatoes)would be edible forms of vaccine. A vaccine that is eaten may bemore appealing and suitable than injections, particularly in poorparts of world with limited access to skilled health-care profession-als. But there are barriers to the development of plant vaccines.First, there are technical issues. For example, would conditionswithin the stomach allow the immune system to respond to the pro-tein to provide protection? Additionally, some people are concernedabout the environmental and health risks of growing vaccine-producing plants in fields. Could the food be safely processed andshipped? While the development of plant-based vaccines has been aresearch success since first reported in 1992, it remains uncertainwhether this form of biotechnology will eventually have a majorimpact on public health.

TREATING HEART DISEASE

Heart disease, particularly clogged blood vessels, is also treatedwith recombinant products. Alteplase (Activase®), a human recom-binant protein that breaks down fibrin, is used immediately after astroke or heart attack to break down platelet-trapping clots in smallblood vessels of the heart or brain and thus improve the patient’schances for recovery. Purified enzymes from bacteria are used forthe same purposes. Abciximab (ReoPro®), a monoclonal antibody to


Stop and ConsiderWhat are the advantages and disadvantages of a recombinant vaccineproduced with plants?

platelets, is used to keep the blood vessels of the heart open after theyhave been unblocked by the insertion of a small balloon, a procedurecalled balloon angioplasty (angio means “blood vessel” in Greek).

CANCER TREATMENT

Few diagnoses trigger as much fear or have inspired as much litera-ture and so many rousing military metaphors as cancer. Named forthe Greek word for “crab,” the assorted diseases known as cancershare the problem of cells growing without normal controls butdiffer from each other in many ways, based on the type and originof the cells that are growing abnormally.

Our understanding of the basis for the loss of ordered cellgrowth has expanded as both industry and government havepumped money into cancer research. Still, cancer remains a wilyadversary. The problem is that cancer is not a single disease witha single cause and single biology, and so no single cure or treat-ment is likely to work. Nonetheless, research has led to newtreatments, some of which advance patient care and improve thechances of survival. Some of these new cancer drugs are based onrecombinant biotechnology.

One form of interferon, interferon-alpha (Roferon-A® andIntron-A®), produced in E. coli, is used to treat some leukemias—cancers that develop from white cells in the bone marrow. Interleukin-2 (Proleukin®), the growth-triggering signal protein for T cells,engineered into E. coli, is used to treat melanoma, an aggressive skincancer, as well as some types of kidney cancer. Conventional cancerchemotherapy drugs are cell poisons, slightly more deadly againstcancer cells than normal cells. But anyone who has known some-one undergoing cancer treatment will know that slightly is animportant word. The loss of hair, severe nausea and vomiting, andinsufficient white blood cells to fight infections that often occurwith chemotherapy are dramatic evidence that normal body cellsalso fall victim to these therapeutic poisons.


Scientists have long hoped that biologic-based cancer treat-ments would provide a deadly blow to the cancer cells while leavingnormal cells unaffected, thus sparing patients these devastatingand sometimes lethal side effects. That ideal has proven difficultto achieve, in part because some of these biologic-based cancertreatments rely on signal proteins that have multiple functions.Interleukin-2 (Proleukin) is a good example of the narrow windowbetween benefit and harm that new cancer therapies share with theold. Developed because it was believed to trigger an immune systemattack on tumor cells, interleukin-2 treatment produces a range ofside effects: fevers, aches and pains, diarrhea, nausea and vomiting,very low blood pressure, difficulty breathing, and many more. Thesymptoms can be nearly unbearable and even life-threateningbecause interleukin makes the small blood vessels in the lungs leakfluids. Depending on the kind of cancer, 2–4% of patients treatedwith interleukin-2 die as a result of the treatment. Interleukin-2is also used in denileukin diftitox (Ontak®), a recombinant proteindrug that combines interleukin-2 with the cell-killing part ofthe diphtheria toxin protein. Denileukin diftitox is used to treat arare form of skin cancer called cutaneous T cell lymphoma thatcomes from T lymphocytes. Because these cancer cells may displayreceptors for interleukin-2 on their membranes, interleukin-2becomes the missile that delivers the toxin warhead, killing thecancer cells. Denileukin diftitox shares many side effects withinterleukin-2.

Monoclonal Treatments for Cancer

Monoclonal antibodies are used in a number of cancer treatments.They can target particular molecules that are found only or mostoften on certain cancer cells. Gemtuzimab ozogamicin (Mylotarg®),used to treat a form of leukemia, consists of a cell-killing cancerdrug purified from bacteria chemically linked to a monoclonalantibody that reacts with a protein present on the leukemia cells


and on some white blood cells. The antibody delivers the drug tothe cells and shuttles the whole thing inside, where the drug isclipped off and then binds to and damages the cell’s DNA, thuskilling the cell.

Antibodies can also be effective without a linked “warhead.” Insome situations, the tail end of the antibody that has attached to thetumor cell starts a process that utlimately kills the cell. Rituximab(Rituxan®), a monoclonal antibody that binds to CD20, presenton antibody-producing white blood cells—B lymphocytes, or Bcells—and on the surface of solid tumor cells derived from Blymphocytes, is used to treat B cell solid tumors.

Other antibodies used to treat cancer work by binding to adocking protein for a growth factor receptor, thus preventing thegrowth factor from binding. Trasuzumab (Herceptin®) is used totreat breast cancer that has spread throughout the body, and cetux-imab (Erbitux®) isused for tumors of the digestive tract. Both aremonoclonal antibodies that bind to two different receptors forepidermal growth factor, a protein hormone that triggers celldivision. By occupying the receptors and denying access to thegrowth factor, the antibodies cause tumor cells to die. When usedwith chemotherapy drugs, these antibodies administer a double blowto these advanced tumors.

Both normal cells and tumor cells require blood circulationto provide the oxygen and the nourishment they need to survive.Bevacizumab (Avastin™) is used to treat advanced forms of cancerof the digestive system; it is a reengineered mouse monoclonalantibody that binds to a growth factor receptor required for thedevelopment of blood circulation around a tumor.


Stop and ConsiderWhat advantages might factory-produced biotechnology drugs haveover proteins purified from humans?

CONNECTIONS

Recombinant DNA technology has provided many drugs to treatserious medical conditions. Although early biotechnology drugswere replacements for protein drugs produced from animal orhuman tissues, other recombinant proteins and monoclonalantibodies are novel and, through precise targeting of cell structuresuncovered by modern biologic research, provide powerful and safetreatments for a wide range of conditions.


FOR MORE INFORMATIONFor more information about the concepts discussed in this chapter,search the Web using the keywords:genetic disorders, HIV, AIDS, autoimmune diseases, monoclonal antibodies,cancer treatment

THE ASHANTI DE SILVA CASE

It is a warm September day in 1990. Inside a hospital room inBethesda, Maryland, Ashanti de Silva, a 4-year-old girl who is small forher age, lies wide-eyed as doctors, nurses, and her parents stand aroundher hospital bed, watching a nurse hook up something to the needle inher arm. She has experienced only a few healthy days throughout muchof her short life and has frequently been subjected to poking, prodding,and injections. We can imagine their thoughts. She doesn’t understandwhat is going on, but her parents do. Ashanti knows the look on herfather’s face, but he says over and over that this will not hurt; it is justanother needle in her arm and she is getting used to that. The worriedlook on Ashanti’s dad’s face comes from knowing that what thedoctors are doing to his daughter has never been done before.

The doctors are injecting Ashanti’s own blood cells into herarm. The blood cells have been treated in a lab with a virus related

83

Gene Therapy to Treat Disease

6

to HIV. Ashanti has an inherited defect in the production of matureimmune system cells, so she is dangerously vulnerable to virusesthat would be nothing more than a nuisance to a healthy child.Children with severe combined immunodeficiency, the condition thataffects Ashanti, can die, and have died, from a chicken pox vacci-nation. Ashanti’s father has read about HIV, but the doctors havetold him that this virus will not hurt Ashanti. The treated cells aresupposed to be little factories to produce the protein that Ashantineeds to make her immune system work. All those blood transfusions

and other injections she had in the past did not help her for verylong. Despite the treatments, she could not go to nursery school oreven play with her cousins when they came to visit because shemight get a cold or a case of chicken pox that could kill her. Thisnew treatment is called gene therapy, and the doctors think it mightcure Ashanti.

Proteins are the workhorses of the body. Genes carry informa-tion in their DNA sequence about the structure of the protein, aswell as instructions for when and where to make it. Errors in theDNA sequence coding for a particular protein can make the proteinfail to do its job or be missing entirely, as in people with hemophilia.The first uses of recombinant technology in medicine replaced amissing protein or a protein that did not work correctly, but scien-tists soon got the idea that they could replace a miscoded gene witha correct one. In fact, the possibility was first discussed in 1966, just13 years after James Watson and Francis Crick reported that theyhad determined the structure of DNA, and nearly a decade beforeanyone learned how to move a gene from one organism to another.It took a long time to work out how gene therapy might safely betried in human patients; the first government-approved clinical trialof gene therapy began in 1990, with 4-year-old Ashanti.

More than 15 years and hundreds of clinical trials later, theFDA has not yet approved any gene therapy product. It has notbeen for lack of trying. By 2004, there were more than 600 human


gene therapy trials worldwide, either completed, enrolling patients,or waiting for permission to proceed from the National Institutesof Health Human Gene Therapy Subcommittee. Although mostgene therapy trials now focus on treating cancer, the earliest stud-ies of gene therapy were designed to treat inherited diseases such ascystic fibrosis and immune deficiency disorders. As scientists pin-pointed the specific miscoded genes for inherited diseases andlearned to change the genetic coding of cells in the laboratory, theythought it would be both possible and useful to insert a correctgene into the genome of the cells affected by the disorder. If theprocess worked with cells in the laboratory, then getting it to workin the body would not be so difficult, but only if the cells affectedby the inherited defect were easily reached. For example, in themost common form of dwarfism, the inherited defect occurs in agene that provides a docking protein for a growth factor that isresponsible for the development of bones in fetuses and children.It would be very difficult to replace the docking protein everywherein the body. In contrast, Ashanti’s immunodeficiency is the resultof something missing in the formation of her immune systemcells. Researchers knew that the condition could be treated witha transplant of bone marrow cells from a suitable donor, so theyneeded to target only the bone marrow, and they had learned howto do that from over 30 years of using bone marrow transplants totreat leukemia and other blood disorders. The sequencing of thehuman genome, completed in late 2003, may still open up manymore targets for gene therapy.

The challenge is to get the genetic construct into the appropri-ate cell, and have it settle down in the cell to be copied faithfullyevery time the cell divides. Most importantly, it must be placedwhere it would direct the production of the correct protein so thatthe protein would be produced in the right amount and in theproper location within the cell. So far, gene therapy has not hadmuch success.

85Gene Therapy to Treat Disease

VECTORS: GETTING GENES INSIDE CELLS

The system used to deliver the desired gene into the cells, called thegene therapy vector, may be a virus, a plasmid, or even just the“naked” DNA. The choice of vector is based on the difficulty ofgetting the gene into the cell, the amount of DNA the vector cancarry, the size of the gene sequence needed to provide the correctprotein, and the effects the vector may have on the body. Eachtype of vector has advantages and disadvantages.

Viruses are very important as gene therapy vectors. Over themillennia of their existence, they have evolved to be very good at


The Human Genome Project is a decades-long international effort by hundreds of

laboratories and thousands of scientists to determine the sequence of human DNA, at

least the part that codes for functional genes, working with robots and computers. The

human genome is 3 billion base-pairs long, but surprisingly, contains only about 25,000

genes to direct the production of the 100,000 or so proteins in our bodies. Many genes

can code for different proteins by cutting and pasting different parts together. The genome

of any individual human differs from that of another by less than 0.1%, and the human

genome differs from that of chimpanzees by only 2%, which suggests that even very small

differences may have very big impacts.

The completion of the Human Genome Project has set the stage for the discovery

of new ways to diagnose and treat diseases, and new ways to predict who will develop a

particular disease. But this will require not only a file with the bases all in a row, but an

understanding of how the genes are organized within that sequence and how the genes

that make proteins are read.

Just as the entire genetic makeup of an organism is called the genome, the entire

set of proteins that an organism makes is called the proteome. Scientists are working to

understand how and where each protein works, and how different proteins interact with

each other. To produce a complicated working body of 3 billion cells—a body that can

see, hear, walk, talk, feel, and eat—means that the cells, genes, and proteins must inter-

act well together from the time of conception to our last breath. Researchers seek to

understand how these processes are orchestrated and what goes wrong when we get ill.

The Human Genome Project

inserting their genetic information, normally instructions to makemore virus particles, into the cells that they infect. The gene therapyviral vectors retain the ability to insert their own genetic informa-tion into the cell’s genetic information, but the instructions to makemore viruses have been removed and replaced with the therapeuticgene, called the payload.

Most gene therapy trials have used RNA viruses as vectors.RNA viruses, also called retroviruses, use RNA rather than DNAas their genetic material. The RNA viral genome must be copiedinto a DNA sequence before it is inserted into the cell’s geneticmaterial. Although well suited for introducing genes into divid-ing cells, such as blood-forming cells from the bone marrow,the retroviral vectors are too fragile to be injected directly intothe body. Retroviral vectors are mixed with blood-forming cellsremoved from the patient’s bone marrow or blood. After thevector payload has been delivered to the cells, the cells are re-introduced into the patient’s body through a vein in the same waythat a blood transfusion is given. Retroviral vectors are preparedto receive the payload by removal of the genes the viruses useto instruct an infected cell to produce more virus particles. Retro-viral vectors are efficient at getting genes into the blood-formingcells and result in the stable insertion of the payload geneticmaterial into the cells’ genetic material. Every time the blood-forming cell divides, the inserted gene is copied, and the genedirects the formation of the desired protein. However, the inser-tion of the new genetic material may change the cell’s geneticinformation in harmful ways (Figure 6.1).

Two types of DNA viruses have also been used in human genetherapy trials. Adenoviruses, double-stranded DNA viruses, canefficiently carry a larger gene into cells even if they are not dividing,but the genetic information does not become inserted into thecell’s genetic material and the information may rapidly be lost.Adeno-associated virus vectors, made from small single-stranded



Figure 6.1 An RNA viral gene therapy vector, engineered to carry thegenetic information for a protein product, is incubated with blood or bonemarrow cells removed from a patient. The foreign DNA sequence integratesinto the cell’s genetic material and when the cells are returned to the patient,they direct the production of the protein product. RNA gene therapy vectorsare engineered to be unable to direct the production of new virus particles.

DNA viruses, can be engineered to insert small DNA sequencesinto a cell’s genome. Both adenovirus and adeno-associatedviral vectors can withstand injection into the body. Thesevectors do have drawbacks, though. Adenovirus vectors cancause dangerous reactions of tissue swelling and damage.Adeno-associated vectors may cause damaging rearrangementsof chromosomes.

DNA alone, or trapped inside a small fatty balloon that willmelt into the cell’s outer membrane, is also a possible vector. Thesevectors can carry large payloads, but because they do not includethe viral genetic information, they are not very good at actuallydelivering the genetic material.

PROBLEMS WITH GENE THERAPY

The idea of gene therapy has fostered great hope and not a littlehype because it seems to promise precise, effective, and long-lasting treatments for devastating diseases in children and adults.Unfortunately, as with many new technologies, the idea and thereality are sometimes very far apart. Just because a vector “works”in a test tube—meaning that the gene gets into the cells and thenew protein is produced—does not mean that it will successfullycure a patient of a genetic disease. First, the engineered vector hasto get to the right part of the body. It is not simple to get a large,complicated gene therapy vector to the exact spot that needs help,so the earliest human trials of gene therapy were targeted atdiseases in which affected cells were accessible or, even better,could be removed from the body, engineered, and then returnedto the patient. In 1990, Ashanti de Silva, the 4-year-old girlwith inherited immunodeficiency resulting from the absence of afunctional adenosine deaminase (ADA) enzyme, was given backher own T cells that had been engineered with a retroviral vectorcontaining a gene for ADA, an enzyme required to break downchemicals that are lethal to certain immune system cells. Over


the next 23 months, Ashanti received 10 more treatments, plusthe weekly injections of cow ADA linked to polyethylene glycol(PEG-ADA) she had already been getting. Did the gene therapysucceed? It is hard to tell. Twelve years after her first gene treat-ment and ten years after her last, she appeared to be doing well,and about 20% of her T cells carried the ADA gene. However,based on lab tests, her immune cells are not working well. She stillreceives PEG-ADA every week.

Cystic fibrosis (CF), an inherited condition affecting the lungsand other organs, is another genetic disease targeted by early genetherapy efforts. In 1989, researchers identified the defective proteinthat leads to CF, a protein that normally moves chloride into andout of cells, and controls the movement of other molecules acrossthe cell’s outer membrane. In CF patients, the cells lining thepassageway that carries air into the lungs produce mucus so thickthat the lungs become clogged, making breathing difficult andinfections frequent. Pancreas cells also do not work correctly inpeople with CF, failing to deliver enzymes that break down food.The air passage cells were a reasonable first place to test genetherapy in CF patients, because nose drops and sprays could deliverthe vector, and the cells could be checked by a simple biopsy tosee if the vector got into the cells and produced the correct CFprotein. Unfortunately, despite great efforts to design a CF genetherapy vector, and after at least 19 clinical trials, no satisfactoryvector has been found that can provide safe and reasonably stableproduction of the normal protein in airway cells. Research continues;at least scientists now know many approaches that do not work.


Stop and ConsiderWhy do you think there was so much initial excitement aboutgene therapy?

UNINTENDED CONSEQUENCES OF GENE THERAPY

Immune Deficient Children

In 2000, French researchers announced the first gene therapy curein nine children with X-linked severe combined immune deficiency

(X-SCID). This rare condition is caused by the inherited loss of aprotein that is part of the docking site for critical immune systemsignal proteins. Because of this defect, children with X-SCID haveno mature, working lymphocytes—critical immune system cells.As a result, they are so susceptible to viral and bacterial infectionsthat they rarely survive infancy. In the French scientists’ research,blood stem cells were removed from an affected child, treated witha retroviral vector carrying a normal docking protein gene, andreturned to the child. Nine out of ten children treated in thisway developed functional, mature immune system cells, whichprovided them with protection against infections. News articlesproclaimed that a cure had been found.

However, within a few months, two of the nine children devel-oped a form of leukemia that had been triggered by the insertion ofthe payload gene too close to a gene that controlled the division ofthose cells. Uncontrolled increases in the number of white blood cellscause leukemia. The two children were treated with chemotherapyfor the leukemia. One patient’s leukemia returned and the child wasthen treated with a bone marrow transplant, but subsequently died.The same study reported that a third child showed evidence of uncon-trolled growth of white blood cells. In addition, a U.S. researcherreported that a monkey treated with cells changed by a similar vectordied of a white blood cell tumor. The FDA called a halt to human


Stop and ConsiderWhat would you want to know before you took part in a genetherapy trial?

trials using a retroviral vector to treat X-SCID and convened anexpert committee to review the data and give advice as to whether tomake the hold permanent. The committee suggested that the FDApermit the use of such vectors only for X-SCID patients with no othertreatment option, such as a bone marrow transplant from a relative.This failure was another blow for gene therapy. The unexpectedproblem has made researchers focus on better understanding and con-trolling where a payload gene is inserted in the target cells’ genome.

Death of a Gene Therapy Volunteer

In 1999, Jesse Gelsinger, an 18-year-old from Arizona with amild form of an inherited deficiency of the liver enzyme ornithine

transcarbamylase (OTC), died during a gene clinical trial at theUniversity of Pennsylvania, triggering a tightening of the reviewprocess and oversight of such research. He was enrolled in an earlystage trial to determine the safety of treating OTC deficiency bydelivering an adenovirus vector that carried the gene for OTC to theliver. Severe forms of OTC deficiency can result in brain swelling,coma, and death soon after birth, but mild forms can be controlledwith changes in diet and with drug treatment.

Although Gelsinger had the mild form of OTC deficiency,he volunteered for a University of Pennsylvania trial to test thesafety and efficacy of increasing doses of an OTC vector becausehe wanted to help severely affected newborns. He died four daysafter the vector was injected into a blood vessel in his liver. Anautopsy showed that he died of a severe inflammatory responseto the adenoviral vector, which led to a blood reaction that causedmost of his organs to shut down.

The media coverage of Gelsinger’s death was extensive, andinvestigations by federal agencies discovered several serious lapsesin following the rules for conducting human trials. The Universityof Pennsylvania clinical gene therapy unit had failed to disclose touniversity safety monitors, to federal regulators, and to Gelsinger


and his family, signs of toxicity its researchers had seen with lowerdoses of the vector. Additionally, the trial’s principal investigatorhad treated Gelsinger with the vector despite lab test results thatshould have disqualified Gelsinger for the trial. These findings ledto changes in how applications to perform gene therapy clinicaltrials are reviewed, how local and federal agencies monitor trials,and how adverse events among subjects in trials are reported. Thestudy protocols for all proposed clinical trials, including thoseinvolving gene therapy, are reviewed for soundness of the science aswell as risks and benefits to the subjects, the study staff, and societyas a whole. Clinical study protocols must include backgroundjustification for the trial and criteria for enrolling or excludingsubjects, as well as information about exactly what the subjects willbe given, what tests will be done, and how the safety of the subjectswill be monitored and protected. Subjects in clinical trials must giveinformed written consent after they have received all the availableinformation about the treatment plan, communicated in a languagethey can understand.

Since Jesse Gelsinger’s death and the ensuing investigations,human gene therapy trials have been watched much more closely.Groups reviewing proposals for gene therapy clinical trials includethe Recombinant Advisory Committee of the NIH; the Centerfor Biologics Evaluation and Research of the FDA; the hospital’sInstitutional Review Board, which is responsible for assuring thathuman subjects will be protected; and the Institutional BiosafetyCommittee, which assesses the safety of the patient, the researchstaff, and the public. During the clinical trial, an independent safetyboard of experts, established by the hospital, monitors patient datafor evidence of serious adverse events and for evidence that theagreed-upon study protocol is being followed. Currently, the FDArequires several months of follow-up for each subject before a newsubject may begin treatment in a gene therapy trial, a situation thatwill slow the rate at which the field advances.



PRO OR CON?

Children in Clinical Trials

Should new medical treatments be tested on children? This isnot a simple question. Adults, protected by all the federalrules about how clinical trials should be handled, are generallyconsidered capable of giving or withholding consent to participatein a trial, after being informed of the potential risks and benefits.Children under the age of 18 are thought to be too immatureto understand what they are being told and to judge the risks.Therefore, their parents or guardians must give consent for them,but some people question whether the parents of a sick childcan make an objective decision about such an issue. Parents maywant to believe that the doctor knows best and would not suggestthat a child take part in a trial if it were not in the child’s bestinterest. Children are also seen as too fragile to withstand therisks of experimental treatments, so for many years, childrenwere not included in studies of new drugs. However, becausedrugs were not tested on young people, no one really knew if aparticular drug was safe and effective for children. Children arenot just small adults. They may have distinct ways of absorbingand removing drugs from their bodies. The amount of the druggiven and the timing of its administration may be inappropriate,even if a child’s size is taken into account. In addition, somediseases appear more often or have a different pattern inchildren. In 1998, the FDA and the NIH began to require thatchildren be included in clinical trials if the treatment wasintended to be used in children. The inclusion of children has tobe scientifically and ethically justified and parental consentmust be sought and obtained. In addition, unless a child’sparticipation in a trial is essential to his or her welfare, theAmerican Academy of Pediatrics recommends that a child’srefusal to participate be respected.

CONNECTIONS

The potential for gene delivery to actually become gene therapyseemed very clear decades ago when biotechnology was a youngscience, at least in the modern sense. But reality has clouded thepromise. The challenges of delivering the correct gene to the appro-priate cells and tissue, leading to production of enough protein fora long period of time, and doing so without causing more harmthan good, have proven to be significant. Laboratory studies, animaltests, and human trials continue, though the latter are moving moreslowly than in the past because of unforeseen problems. The nextfew years will show whether these approaches will prove to be safeand effective. The increased review, oversight, and caution that weretriggered by Jesse Gelsinger’s death and by the leukemia in theFrench children may be necessary in order for regulators and thepublic to regain confidence in procedures used to protect subjects.


Stop and ConsiderDo you think the current slow pace of gene therapy is a goodthing, or will the caution slow the availability of treatments fordevastating disease?

FOR MORE INFORMATIONFor more information about the concepts discussed in this chapter,search the Web using the keywords:gene therapy, cystic fibrosis, severe combined immunodeficiency disorder

(SCID)

Trials of gene therapy for inherited conditions have captured the mostmedia headlines, good and bad, but they account for less than 10%of the 987 gene therapy trials done worldwide between 1989 and2004. While some of the other 90% of gene therapy trials aredirected at chronic diseases such as arthritis, multiple sclerosis, andheart disease, over two-thirds of such trials are directed toward thetreatment of cancer. Cancer gene therapy trials fall into two majorcategories: those aimed at creating or strengthening an immuneresponse to cancer, and those targeted to a genetic alteration orsusceptibility of cancer cells (Figure 7.1). Such trials build on ourgrowing understanding of the immune system and/or insights intogenetic changes that take place within cancer cells. Though bothhave been exciting areas of research, a great deal about the biologyof cancer cells and their interactions within the human body is notyet fully understood.

96

Gene Therapy forCancer Treatment

7

97Gene Therapy for Cancer Treatment

Figure 7.1 Some of the approaches to cancer treatment using genetherapy are illustrated here. Gene therapy research for cancer treatment hasfocused on boosting the immune response to tumors by delivering immune-activating signal proteins or by delivering a gene based vaccine. Another focushas been the direct delivery of genes to convert inactive drugs, block the growthpromoting effects of oncogenes, or replace a mutant tumor suppressor gene.

IMMUNE-BASED CANCER GENE THERAPY STRATEGIES

Many cancer cells are sufficiently different from related normal cellsthat our immune system can recognize the differences and shouldbe able to attack the tumor as the unwanted interloper that it is. Butsometimes the differences may not be great enough, or the tumorcells—wily creatures that they are—may have developed the abilityto ward off an immune system attack. Cancer is not one disease, butmany, and in most cases, specific changes in the genetic makeup ofcancer cells are responsible for the uncontrolled growth of that formof cancer. Strategies to unleash an immune response to a particularkind of cancer must take into account the type of cancer and itsgenetic changes.

One strategy for immune-based gene therapy for cancer isdelivery to tumor cells of a gene for an immune system signalprotein that will kill the tumor cells or call up an immune attack.Because immune system signal proteins such as interleukin-2 haveso many different kinds of effects, they are generally too toxic to beadministered to the whole body. Delivering the gene construct totumor cells so that they produce the protein themselves makesmore sense. Several immune system signal protein genes, includinginterleukin-2, are being tested in this way, either alone or incombination with conventional chemotherapy drugs or radiation.

A specific immune response requires the delivery of a small bitof the target protein, the antigen, to immune system cells. Anotherimmune-based gene therapy approach being studied for cancer is toengineer a patient’s antigen-presenting cells outside of the bodywith the tumor antigen gene, and then return the altered cells to thepatient to efficiently deliver the “call to arms” to the immune system


Stop and ConsiderWhy do you think there are so many gene therapy trials for cancer?

cells. These approaches seem logical and have worked in one ormore animal tests, but still remain unproven in humans, despitesome small human studies.

The specific genetic changes responsible for the uncontrolledgrowth of cancer cells are found in oncogenes, genes everyone hasthat promote the growth of tumors if the sequence changes, andtumor suppressor genes that normally suppress the growth of tumors.Some of the tumor suppressed genes that are changed in cancer cellsare those that normally prevent the death of cells by suicide ortrigger cell death if the cell DNA is damaged. This programmed cellsuicide is called apoptosis (Figure 7.2). Several human tumors havemutations in the tumor suppressor genes that prevent those genesfrom functioning. Delivery of normal, unchanged tumor suppressorgenes to trigger apoptosis has been promising as a cancer treatmentboth in animal tests and in limited human trials. For example, anadenovirus vector carrying the p53 tumor suppressor gene reducedthe size of the tumors when injected directly into human tumors.Three months after treatment with the p53-carrying adenovirus,combined with radiation, 63% of patients with a form of lung cancerhad no detectable tumors. Another gene therapy approach beingexplored for cancer is delivery to tumor cells of a gene for an enzymeprotein that changes an inactive form of a drug to the active drugthat kills the tumor cell. The tumor cell is thus made into the engineof its own death, which is why this type of trial is sometimes calleda “suicide gene” trial. The enzyme genes are derived from viruses ornon-mammals, such as a gene for an enzyme that converts a drugused to fight virus infections into a drug that is toxic to cells.

Tumors are masses of cancer cells and can only survive if nutri-ents and oxygen are provided by blood. Researchers are developingpromising drugs, including recombinant proteins, that deprivetumors of this sustenance by preventing the development ofblood vessels at the tumor site. The growth of blood vessels is calledangiogenesis. Gene therapy strategies and vectors are being developed



Figure 7.2 Programmed cell death (PCD) is also called apoptosis. Theprocess is shown here. In programmed cell death, a cell dies throughstructural changes and the breakdown of the nucleus is followed by ingestionof the cell by scavenging white blood cells. PCD is a normal process indevelopment and in response to DNA damage that cannot be repaired.

to block angiogenesis by delivering to a tumor a vector with a genethat would prevent angiogenesis as the tumor increases in size, thusstarving the tumor. This method has been effective in animal testsbut has not yet been tested on humans.

The large number and types of gene therapy trials for cancersreflect both the potential opportunities to develop treatmentsand the fact that a single strategy will not likely work for all formsof cancer.

The Use of Antisense

Another promising molecular approach to treating cancer, studiedfor decades, uses specific RNA molecules to target oncogenes andother genes that permit a cancer cell to thrive and grow. The goal isto prevent the production of the protein that causes the uncontrolleddivision of tumor cells. The idea behind this approach is that a shortpiece of DNA or RNA would bind specifically to a messenger RNA,founded on its sequence of bases, and prevent the message frombeing used to make the protein. This would stop the cell division ofcancer cells and possibly cause cancer cells to die.

Synthetic RNA and DNA drugs have been named antisense

because they were crafted to bind to the single strand of the RNAmessage, the “sense” sequence that would normally be translatedinto protein. As more and more oncogenes were implicated in theability of specific cancer cells to divide and increase in numberwithout normal controls, efforts were made to produce an RNAantisense drug that stopped that growth. Although test-tube studiesin the lab have often been successful, antisense drugs faceformidable challenges. They must resist being broken down byenzymes in the blood. They must also be able to get to andinto the cells. They also need to be able to clamp onto the targetedmessage once they get inside the cell.

A number of different chemical modifications of the basic RNAantisense have shown promise in the lab and in animal test systems,


(continued on page 104)


Cancer cells of all kinds share the capacity to increase in number, free of the normal

controls on cell division. They also have the ability to survive for very long periods of

time. Normal cells generally divide and increase in number only when the body tells

them to do so through chemical signals. Cancer cells have acquired the ability to divide

without outside signals, as long as they have proper nutrition. The cancer cells get this

capacity for growth from genetic changes. Two different types of genes are changed in

cancer: oncogenes and tumor suppressor genes.

Oncogenes are mutated forms of protooncogenes—normal genes that stimulate cell

division. Studies of how certain animal RNA viruses caused cancers in animals led to

the discovery of oncogenes and protooncogenes. Scientists suspect that the viruses

picked up the oncogene sequences during their evolution. There are many different

protooncogenes. They either code for proteins that are part of the cell’s internal machinery

for cell division (Figure 7.3), code for proteins that are part of the machinery that a cell

uses to respond to an outside growth signal, or code for proteins that normally prevent

the cell from dying. The mutated forms may allow the cell to survive and divide repeat-

edly, even in the absence of the growth protein. A single copy of a mutated oncogene is

enough to give rise to cancer.

Tumor suppressor genes normally function as gatekeepers to prevent cell division

when the cell’s DNA is damaged or when conditions are not right—for example, when

there is a shortage of nutrients or when a protein signal required for cell division is

missing. Mutated tumor suppressor genes allow cells with damaged DNA to survive

and go through many cycles of cell division, thus increasing the chances that a mutated

cell that cannot properly control cell division will survive and increase in number. The

changes found in the genetic material of cancer cells may be very extensive. Both copies

of a tumor suppressor gene must be mutated in order to allow cells with such changes

to survive.

Because they are mutations that add properties to a cell, oncogenes may be seen

as more difficult to correct, or turn off, through gene therapy approaches. Because they

represent a loss of function, mutations in tumor suppressor genes would appear to be

easier to correct through gene therapy techniques that put the normal gene back where

it belongs.

Cancer: Done in by Genes


Figure 7.3 The cell cycle is illustrated in this figure. Cell division proceeds throughdiscrete phases: G1 during which the cell grows and prepares for division; the S phasewhere the DNA content and chromosomes double; G2 where the cell develops thestructures needed for cell division; and the M phase where the nucleus splits intotwo and the cell divides into two daughter cells.

and some antisense molecules are now being studied in humancancer patients. However, the only FDA-approved antisense drug isfomiversin (Vitravene®), which is used to treat cytomegalovirusinfection of the eye. (Cytomegalovirus [CMV] is a common DNAvirus related to the viruses that cause chicken pox, mononucleosis,and fever blisters. CMV does not usually make people sick, but itcan hide out in the body, and if the immune system is weakened, itcan cause illness and damage to the retina.) Fomiversin is injecteddirectly into the eye.

Discovered in the 1980s, ribozymes are RNA molecules with avery distinct hammerhead structure. They function as enzymes anddirectly cut RNA. Synthetic ribozymes targeted to specific messen-ger RNAs have been used in many laboratory studies with cells.Efforts to develop ribozyme treatments targeted to specific cancergenes and for other uses have not succeeded in clinical trials, partlybecause the structure of the ribozyme that is needed to allow it towork as an enzyme was destroyed when it was injected.

Over the last few years, research has suggested that antisensedoesn’t work simply by interfering with the ability of the protein-making machinery to read the messenger RNA. Instead, it mustactually set up the message to be destroyed. Laboratory experimentswith cells indicated that in some cases, the single-stranded antisensewas less effective in preventing the production of the targetedprotein than a double-stranded RNA made up of the antisense andsense sequences. Double-stranded interfering RNA has become avery useful laboratory tool for studying the function of a protein.This is because the message for the protein targeted by the interfer-ing RNA is destroyed and the protein production is stopped, or atleast severely curtailed. If you knock out the protein and see whatgoes wrong, you can understand more about what the protein does.However, as with vector-based gene therapy, fooling Mother Natureis not so easy. First, if double-stranded RNA is delivered to cells attoo high a concentration, it is not specific and may damage other


(continued from page 101)

cells. In addition, if large double-stranded RNA is delivered to awhole animal, it will activate some immune system responses.Researchers are trying to learn how to use appropriate doses ofsmall interfering RNA (siRNA) in animal experiments to treat certaincancers, liver damage caused by virus infections, shock caused bypotentially lethal bacterial infections, and possibly HIV. The poten-tial of siRNA seems very great, but only careful tests in whole animalmodel systems and human trials will eventually prove whetherthis seemingly surgically precise molecular clipper can work.

CONNECTIONS

Over the last few decades, several types of gene-directed strategieshave been proposed as cancer treatments, based on scientists’understanding of the genetic changes in tumor cells that allowthem to grow out of control. Despite many years and many trials,gene therapy, antisense, and ribozymes have so far failed to providea useful anticancer drug. Newer approaches, particularly siRNA,are currently poised for critical testing. Experience with olderapproaches may provide lessons for researchers that increase thechances for success against cancer—one of our most formidablemedical adversaries.


Stop and ConsiderWhy are cancer cells attractive candidates for gene-specific therapies?

FOR MORE INFORMATIONFor more information about the concepts discussed in this chapter,search the Web using the keywords:cancer genes, oncogenes, tumor suppressor genes, angiogenesis, small

interfering RNA

BLOOD TRANSFUSIONS

A little sheep’s blood may be just the thing to calm a distractedstudent. At least that was the idea proposed at the English RoyalSociety in 1667, the same venue where, in 1628, Dr. William Harveydescribed the circulation of blood for the first time. A transfusionof 12 ounces of sheep’s blood was administered to a divinitystudent who was said to be “crack-brained;” apparently that meanthe was inattentive and disruptive. The volunteer seemed to beno worse after the procedure, but he did refuse any further trans-fusions. By 1678, the transfusion of blood from animals to humanshad sickened and killed several people, and was outlawed inEngland and France.

Since that time, transfusion of human blood has become safeand widely available. Advances that made this possible includethe development of antiseptics to reduce infections from person

106

Replacing Cells

8

to person during blood transfusions, the discovery of the ABO blood

groups, the recognition of the importance of ABO matching toprevent deadly transfusion reactions, and the discovery of simpleways to keep blood from clotting (Figure 8.1). Today, human bloodis routinely used to replace blood lost in accidents, surgery, orchildbirth, or to supplement lack of certain blood components.

107Replacing Cells

Figure 8.1 When a person receives blood, it is essential that the ABO bloodgroups are compatible. ABO Blood Group testing for blood transfusions isillustrated here. Antibodies in the serum (the clear part of blood) form clumpsof red blood cells when they come in contact with red blood cells of an incom-patible blood group. For example, the sera of O and B transfusion recipientswould cause clumping of red cells from donors whose blood is type A or AB.

Blood is also regularly tested, not just for blood group compati-bility, but also for infections carried in the blood such as humanimmunodeficiency virus (HIV) and hepatitis B and C viruses.Early in the AIDS epidemic, before the AIDS virus was identifiedand a test developed to detect whether a person has been exposed tothe virus, patients did contract HIV through blood transfusions.Today, every unit of donated blood is tested for the presence ofHIV, as well as for hepatitis B and C viruses.

But why transfuse blood? If your body is not able to deliverenough blood to vital organs, you can become unconscious and die.Whole blood is rarely used for transfusions today. Immediatereplacement of the fluid volume for substantial blood loss is criti-cal, but a sterile salt solution can be used for this purpose. Blood iscomposed of both a fluid part and cells. The fluid part of blood, theplasma, contains many different proteins, including disease-fightingantibodies and proteins that help the blood to clot (Figure 8.2). Thered cells are the most numerous, but various kinds of white cells areimportant for fighting infections. The red cells carry oxygen fromthe lungs to the tissues and take waste carbon dioxide from thetissues to lungs. A substantial loss of red blood cells in an accidentor during surgery may require a transfusion of red blood cellssuspended in a small volume of salt solution. The proteins in thefluid portion of the blood, which can take the form of fresh frozenplasma or concentrate, may be used to help the blood of hemophiliapatients to clot. Platelets—the small bits of cells critical for bloodclot formation—are removed from donated blood, stored in a pre-serving salt solution, and transfused into patients who have troubleproducing their own platelets because they have blood cancer or areundergoing cancer treatment. Additionally, infection-fighting whiteblood cells may be obtained from a donor and transfused into apatient who is unable to produce white blood cells. Recombinantdrugs to stimulate the body’s ability to form red or white blood cellsmay also be used in patients.


Despite all the advances in storing or distributing blood, pro-viding life-saving red blood cell transfusions in disasters and on thebattlefield remains a challenge because facilities are not readilyavailable for cold storage of large quantities of red cells. Researchershave worked for decades to come up with a red blood cell substitute,

109Replacing Cells

Figure 8.2 A developing blood clot is shown in this picture. A blood clot ismade of platelets, membrane fragments of a bone marrow cell, and a networkof insoluble proteins, particularly fibrin generated from a precursor protein,fibrinogen, through the work of a cascade of protein clotting factors. Severalbleeding disorders result from inherited deficiencies in clotting proteins.

both before and after the introduction of biotechnology techniquesthat let scientists design protein at will. Scientists focused first onhemoglobin purified from human blood, and then on forms ofhemoglobin engineered in the laboratory. Their goal was to comeup with a protein that could be dehydrated for storage at room tem-perature and dissolved in a salt solution to provide the life-savingcapacity to transport oxygen similar to that of intact red blood cells.Researchers have even packaged the hemoglobin in a fat and proteinsack to mimic the structure of a red blood cell. Despite all theelegant and laborious efforts, no red cell substitute has yet provensafe and effective. Now researchers are analyzing how hemoglobinis tethered inside red cells so that it is efficient at picking up anddelivering the oxygen and carbon dioxide as needed.

STEM CELLS

Blood cells are not the only type of cell therapy on the horizon.Scientists are now working on another type of cell therapy, calledstem cell therapy, which would take immature cells and coax theminto becoming specialized cells in the laboratory to repair damagedor poorly functioning organs. Stem cells are potentially the rawmaterial that could make medical repairs that are currently impos-sible with drugs. To use these cells, scientists must understand howstem cells have the ability to divide repeatedly without specializing,yet under the right conditions, turn into all kinds of cells: liver cells,heart muscle cells, bone-producing cells, and so forth.

The human body’s entire system of a billion or more cells devel-ops from a single cell—the egg fertilized by the sperm. As thiscell divides to form all the different tissues and structures of thegrowing fetus, the daughter cells become specialized in the kinds ofproteins they produce. Think of the entire set of genes as inheritedinstructions to form more than 100,000 proteins when and wherethey are needed. Going from the single-cell embryo to the enor-mous collection of specialized cells that make up our body is an


orchestrated process of calling up particular sets of those instruc-tions and manufacturing the proteins as instructed so that theresulting specialized cells can perform particular functions. In verysimple terms, the control of the process is what makes a liver cellperform liver functions instead of growing hair. This specializationdoes not occur in a single step. Instead, it happens as a series ofdiscrete steps that the cells take as they commit to becoming aparticular kind of cell. This process of commitment to specializa-tion is called differentiation. The embryo cell, and the cells producedduring the first few rounds of cell division, retain the ability tobecome any type of cell in the body. As the cells of the embryogo through more rounds of cell division, the cells become morespecialized and the kind of tissue or organ they can build appears tobecome more limited (Figure 8.3).

111Replacing Cells

Few things have stirred more debate than the prospect of human cloning—producing

an exact genetic copy of a person from his or her cells. There is little or no support for

cloning to produce a child, because of both safety and ethical concerns. However, the

potential of embryonic stem cells and therapeutic human cloning to provide treatments

for a number of devastating and untreatable conditions, such as Parkinson’s disease,

has received substantial support and media attention. Animal experiments suggest that

embryonic stem cells may be able to provide cells to treat Parkinson’s disease, multi-

ple sclerosis, brain and spinal cord injury, diabetes, hearts damaged by heart attacks,

and many other conditions. Scientists have suggested that somatic nuclear transfer

(SNT) be used to generate embryonic stem cells to avoid the risk that the patient’s

immune system will attack and destroy the transplanted cells.

In 2001, President George W. Bush developed a U.S. policy regarding work with

human ES cells. He proclaimed a ban on the use of federal funds for work on human

ES cell lines that were not generated before August 9, 2001. Federally funded

researchers may work on human ES cell lines created before that date. Research on

human ES cells is going on without these conditions in several other countries. Several

states, including California, have passed laws providing funding for work on human

ES cells within the state.

U.S. Policy on Stem Cell Research


Figure 8.3 Specialized cells and tissues in our body develop in stages. The embryoinner cell mass develops into three layers: the outer layer, or ectoderm, that will becomeskin, eyes, and nerves; the inner cell layer, the endoderm, that develops into the lungs,liver, and the lining of our digestive system; and the middle layer, the mesoderm, thatdevelops into bones, muscle, and blood.

Blood-forming Stem Cells

Scientists have known for a long time that stem cells taken from the bonemarrow, the soft tissue inside the hollow part of most bones, can developinto all the different types of blood cells. These blood-forming, orhematopoietic, stem cells are now the most widely used stem cells inmedicine. Most types of blood cells survive for only a short time and thehematopoietic stem cells are constantly replacing both themselves and thedying blood cells. Blood-forming stem cells are normally present in verysmall numbers in the blood, but will increase if a person is treated withrecombinant forms of protein growth factors (described in Chapter 5)that dock onto a protein on the surface of the cells and trigger the cells todivide and become mature blood cells.Another source of blood-formingstem cells is the blood in a newborn’s umbilical cord.

Hematopoietic stem cells are used to treat people whose ownblood-forming cells fail because of a rare condition called aplastic ane-mia, or to help people who have been accidentally exposed to very highdoses of irradiation. Hematopoietic stem cells are most often used aspart of the treatment for certain forms of cancer. Sometimes cancerpatients are given very high doses of irradiation and/or chemotherapydrugs that destroy the blood-forming stem cells in the bone marrow.Transplants with the patient’s own blood stem cells that were removedbefore the treatment, or stem cells from a healthy donor, allow thepatient to recover. The transplant process is very simple: The cells ina salt solution are slowly injected into a vein just like a blood trans-fusion. If the blood stem cells come from a donor, then the donor andthe patient must share certain inherited proteins to make sure thatthe donor’s immune system cells will not attack the treated patient.This condition, called graft versus host disease, can severely damagethe intestines, liver, and other organs, and may be fatal.

Multitalented Stem Cells

Recently, scientists have also become very interested in other, moreversatile, kinds of stem cells—stem cells that may be able to develop

113Replacing Cells

into many different types of specialized cells. Two different types ofcells are the focus of interest, embryonic stem (ES) cells and adult stem

cells. The ES cells are found in the very early-stage embryo. Adult stemcells refer to cells found in one tissue that may be able to develop intospecialized cells of another tissue or organ. Think of a cell found inliver that, under the right circumstances, might be persuaded todevelop into a nerve cell. In the laboratory, ES cells can divide overand over again, under the right conditions, producing many moreES cells that, with the addition of certain chemicals, can change intoone of many different kinds of specialized cells. Animal experimentshave shown that a single embryonic stem cell can become any cell inthe body. Because, as the source of the entire adult body, ES cells canbecome every kind of cell, they are called totipotent.

Adult stem cells are tucked away in specialized tissues andorgans, such as bone marrow, skin, liver, fat, kidney, and even thebrain. The accepted and established role of adult stem cells appearsto be to help maintain the organ in which they are found and toallow that organ to repair itself if damaged. But is the potential ofadult stem cells limited to just a few options? Some scientists believethat stem cells in some adult tissues may have the ability, under theright conditions, to become many different kinds of specializedcells and not just the cells of the tissue in which they are found.That would mean that some adult stem cells, though not totipotentlike embryonic stem cells, are pluripotent, meaning that they couldchange into a number of different types of specialized cells, giventhe right circumstances.


Stop and ConsiderWhat are the possible uses of ES cells in healthcare? What aresome of the scientific barriers to the potential of ES cells? Whatapproaches are being explored to overcome these barriers?

The ability of adult stem cells to become something other thanwhat they were destined to be is controversial. One team of scien-tists has reported that a particularly promising adult stem cell,isolated from bone marrow and called a multipotent adult progenitor

cell (MAPC), appears able to develop into many different kinds ofspecialized cells in the laboratory. Other scientists have not beenable to reproduce these results. Additionally, scientists havereported that stem cells found in fat can become muscle cells,nerve cells, or even pancreas cells able to make insulin, under theright laboratory conditions.

Researchers in Germany treated a girl who had a massive skullinjury from a fall with bone-repair cells grown from her own fatplus a graft of her own bone. The story is an example of both theheroic efforts made on behalf of a patient when standard treatmentfails and also of the uncertainty of whether these uses of the stemcell make a difference. Immediately after the fall, the child haddeveloped increasing pressure in her skull and the surgeons had toremove pieces of her skull bone. They stored the pieces in a freezerfor three weeks and tried to use them with plates of titanium toprovide a protective covering for her brain. But the repair becameinfected and the bone graft failed. Next, a team of surgeons andtechnicians worked in the operating room to build an ingenious andnovel graft. They spread a paste made from a piece of the girl’s hipbone onto a mold made of sheets of dressing that would eventuallybe broken down. They put the paste-covered mold in place, andcovered it with more protective dressing. None of this was newtechnology—but then they added stem cells. During the surgery,they had taken a little bit of fat from the girl’s hip and had isolatedstem cells from it. When the molded graft was in place, the doctorsinjected the stem cells into holes in the protective sheet and thensprayed the whole thing with a sticky spray made from the girl’sown fibrin, a blood protein involved in blood clotting and woundhealing. After six weeks, the patched area was strong that the

115Replacing Cells

child no longer had to wear the helmet she had worn for theprevious year since her fall. At three months, scans of her skullshowed bone formation where the defect had been. This was quitean amazing procedure, but there is no way to be sure that theaddition of stem cells made a difference in the result. New methodswill have to be developed to track the stem cells to see if they becamepart of the final graft. Early efforts like these provide hope that itmay be possible to incorporate the use of stem cells into complexmedical procedures, but like bone marrow transplants in theirearly days, it will take many years and controlled clinical trials tohave full confidence in the role of adult stem cells.

In a general way, the question about the versatility of adult stemcells comes down to whether the library of genetic instructions isirreversibly changed as cells specialize, and whether some parts thenbecome unusable. This is a fundamental question that scientistshave been studying for many years, and the answers are not yetcertain. It is also a practical question, since if stem cells from one ormore adult tissue are pluripotent, then such cells might be takenfrom an individual and used to repair and replace any, or at leastmany, of his or her tissues that are not working correctly.

POSSIBILITIES OF STEM CELL THERAPY

Excitement about ES-derived cells has been fueled by severalreports of laboratory and animal studies. In Parkinson’s disease,symptoms result from a loss of cells that produce a critical signalmolecule. Cells that produce the signal were created in the labfrom mouse ES cells. When injected into the brain, they reducedsymptoms in mice with a form of Parkinson’s disease. Strains ofrats and mice have been developed or discovered that are unableto produce myelin, the fatty insulation that normally covers thenerve fibers of the brain and spinal cord. Injection of insulation-producing cells generated from mouse ES cells produced myelin onthe nerve fibers of these animals.


These results raise the possibility that stem cells might providetreatment for spinal cord injury and multiple sclerosis. Severalgroups of researchers have been able to produce working heartmuscle cells from mouse and human ES cells. One study withmouse ES-derived heart cells found that the cells did not substitutefor damaged heart cells but did trigger repair of the damagedmuscle when injected into a mouse with a damaged heart. Mouse ES-derived insulin-secreting pancreas cells have worked when injectedinto mice whose own insulin-producing cells had been destroyed,though the experimental diabetes was not entirely reversed. Theseare just a few of the possibilities currently being studied.

Challenges That Face Stem Cell Research

There are many scientific challenges to the use of either adult orembryonic stem cells, including establishing conditions that willallow scientists to produce large numbers of stem cells in the lab.Scientists must learn what needs to be done to allow stem cells toincrease in number without dying off or changing, and what con-ditions are required to cause the stem cells to turn into one of thedifferent types of specialized cells. Finally, researchers need to learnhow to get the specialized cells to go to the part of the body wherethey are needed and to function correctly. The safety of laboratory-derived specialized cells for treating human disease is alsounknown. The long-term safety of these cells has not been testedin animals. Will it be possible to produce specialized cells free ofother kinds of unwanted or unnecessary cells? Will the specializedcells—whether liver, heart muscle, or pancreas cells—remain justthat, or will they revert to a more primitive cell? That is, will theyacquire genetic changes that lead them to go through rounds ofcell division, free of the normal signals that restrain and regulatecell division? The concern is that such a cell might act like atumor. Finding the answers to these questions will take a lot morework and time.

117Replacing Cells

Immune System Problems

The use of specialized cells produced from embryonic stem cellsfaces another challenge: The patient’s immune system may destroythem. Because of inherited transplant proteins, specialized cellsdeveloped from embryonic stem cells may be attacked and destroyedby the immune system of the person who receives such cells. Somescientists believe that this kind of an attack would not happen,because they have found that embryonic stem cells and the special-ized cells produced from them in the laboratory do not make enoughof the transplant proteins to trigger such an attack. If this is notthe case, however, there may be a possible solution: a process calledtherapeutic cloning. In therapeutic cloning, the nucleus of a donatedegg cell is replaced with a nucleus from a patient’s cell. The resultingcell would be grown in the lab through several rounds of celldivision to produce a very early embryo from which embryonic stemcells would be taken and treated further to generate the specializedcells for treatment, whether insulin-producing cells, heart musclecells to replace cells damaged in a heart attack, or something else.Because the nucleus used for the technique is taken from a somatic

cell, a cell not destined to produce eggs or sperm, the process is alsocalled somatic nuclear transfer (SNT). The embryo created in the labwould be, in genetic characteristics, a clone of the donor of thenucleus, the patient him- or herself. The transplant proteins made bythe specialized cells would perfectly match the patient’s because thegenes directing their production would be the patient’s own.

Ethical Arguments

Research on human embryonic stem cells and therapeutic cloning


Stop and ConsiderWhy do some scientists view adult stem cells as more promisingthan embryonic stem cells?

is controversial. Gaining access to embryonic stems cells to developcells for treatment requires the destruction of an embryo. Therapeu-tic cloning involves creating a very early embryo in the laboratorythat would be destroyed to obtain the embryonic stem cells.The idea of destroying an embryo, or creating an embryo for thesole purpose of harvesting cells, is profoundly troubling to manypeople. Many people, for religious or other reasons, believe thathuman life begins at fertilization and that it is morally wrongto create an embryo only to destroy it to obtain the ES cells. Toovercome these problems, adult stem cells may provide useful celltreatments without the destruction of an embryo, if they can bereprogrammed in the lab to unlock the genetic instructions thatwere thought to be unavailable.

CONNECTIONS

Cell treatments are as simple and routine as a blood transfusionand as uncertain as the use of specialized cells produced in the lab-oratory from adult or embryonic stem cells. The history of bloodtransfusion suggests that it will take a lot of research and perhapsa long time to solve the mysteries of these stem cells. From the firstsheep blood transfusion, it took several hundred years for physi-cians to learn how to transfuse blood safely. Even today, it takesconstant vigilance and research to make sure a blood transfusionis safe, a lesson learned tragically in the early years of the AIDSepidemic. Blood stem cell transplants, though life-saving in somesituations, can pose the risk of potentially deadly graft versus

119Replacing Cells

Stop and ConsiderThink about your beliefs on the issue of human embryonic stemcells. Do you support their use? What kind of laws should we have inplace to regulate the work? Where would the possibility of cures fordevastating illness like Parkinson’s disease fit into your consideration?

host disease. How to work with other types of stem cells presentsmany challenges, both scientific and social. Stem cell technology iscutting-edge science and, with some luck and the work of a lot ofsmart people, we may someday be able to learn how to use thetechnology wisely.


FOR MORE INFORMATIONFor more information about the concepts discussed in this chapter,search the Web using the keywords:embryonic stem cells, adult stem cells, blood stem cells, cloning, therapeutic

cloning, blood transfusion

ORGAN TRANSPLANT SUCCESSES AND FAILURES

It has been over 50 years since the first successful human organtransplant was done—a kidney transplanted from one identical twinto another—and the procedure has become almost routine. Thelist of organs transplanted includes not just kidneys, but hearts,livers, lungs, and the pancreas (Figure 9.1). The number of trans-plants performed is impressive, considering both how complicatedthe surgery is and how strong a fight the immune system launchesagainst the new organ. More than 325,000 transplants were per-formed in the United States from 1988 through August 2004. Theaverage number per year is now about 25,000. Kidney transplantsaccount for more than half of all transplants; liver transplants makeup about 20%, hearts 10%, and lungs 5%. The number of trans-plants may seem large, but an even bigger number includes thosepeople who are on a waiting list for an organ—more than 86,000

121

Organ Transplantation

9

people right now. Because human beings have two kidneys and canfunction just fine with only one, kidney transplants can come fromliving donors. In recent years, methods to transplant just a part of aliver have succeeded because the liver can repair and regenerateitself. A few hundred people each year, often children, receive alobe of a liver from a family member. All the other organs, however,


Figure 9.1 In this heart transplant, a surgeon holds the donor heart as a colleagueprepares to connect its blood vessels to the blood vessels of the recipient.

must come from people who signed a donor card before they diedor whose family agrees to the organ donation. The gift of an organat the sad time of the sudden loss of a family member in an accidentis an act of great generosity. Despite these gifts, every year a short-age of healthy organs causes many more sad results—the death ofpeople on the waiting list. In 2003, more than 6,000 people diedwhile waiting for an organ.

Human-to-human organ transplantation has risks. The humanimmune system is finely tuned to recognize and destroy invaders,and because it carries different forms of transplantation markersfrom those of the recipient, the transplanted organ is seen as aninvader, unless the donor and recipient share exactly the same genes,as in that first successful kidney transplant between identical twins.A major risk exists if antibodies to the donor cells are present in therecipient’s blood at the time of transplant. If donor-reactive anti-bodies are present when the blood connection to the organ is madeduring surgery, the reaction against the new organ may be so rapidthat the blood vessels are blocked and the organ cells die. This rapidantibody reaction to the cells lining the organ blood vessels is calledhyperacute rejection. Tests for antibodies lurking in the recipient’sblood that could cause hyperacute rejection are performed beforethe transplant to determine who receives a donated organ. The ABOblood group system, critical in blood transfusion, is also importantfor some, but not all, transplanted organs. An organ donor mustbe a suitable ABO type for the patient or ABO antibodies in therecipient’s blood will cause hyperacute rejection.

After the surgery, new antibodies and killer lymphocytes thatcause rejection may develop within days. To prevent this from hap-pening, or at least reduce the chances of it, scientists have discoveredand developed a number of immunosuppressive drugs that help extendthe life of the transplanted organ and, thus, the life of its recipient.Corticosteroids and the cancer chemotherapy drug azathioprinewere the first drugs used to suppress the immune system for organ

123Organ Transplantation

transplants. Although their long-term use can have serious sideeffects, steroids such as prednisone are still widely used. In the1970s, the introduction of cyclosporine, the product of a soil fungus,dramatically improved one-year graft and transplant patientsurvival. Other widely used chemical immunosuppressive drugsinclude tacrolimus, mycophenolate mofetil, and sirolimus. Severalmonoclonal antibodies that remove or shut down T lymphocytes(such as muromonab, daclizumab, and basiliximab) are used toprevent or treat rejection (Chapter 5). A preparation of animalantibodies raised against human lymphocytes is still used for thesame purpose. Despite all these tools, slow or chronic rejection ofthe organ remains an ongoing problem.

The success of organ transplantation is measured by organ andpatient survival. Over 80% of kidney patients and 65% of theirgrafts survive for five years. Patient survival is higher than kidneygraft survival, because kidney graft failure means that patients mustgo back onto chronic dialysis and usually back onto the waiting listfor another transplant. Five-year graft and patient survival rates arelower for other organs. Because there is no counterpart to dialysisthat provides long-term support for those with a failing liver,lungs, or heart, patients who need these organs often die without asuccessful transplant.

TAKING ORGANS FROM OTHER ANIMALS

Because the transplant waiting list continues to grow, scientistshave explored nonhuman animals as a possible source of organs.Despite the shock and repulsion it sometimes causes, the idea ofxenotransplantation, or transplantation of an organ from one speciesto another, deserves some serious consideration.

Organs from Primates

At first, it seemed reasonable to look toward nonhuman primates,such as chimpanzees and baboons, as organ donors. With experience,


however, it became clear that nonhuman primates pose significantmedical, economic, and ethical problems as alternate sources fororgans. Transplants of organs from nonhuman primates would stillrequire the use of immunosuppressive drugs, perhaps at even higherdoses than are used for human-to-human transplants. Also, becauseof our genetic similarity to other primates and because the immunesystem has been turned off, any unknown virus or microorganismthat the organ harbored might jump to humans and cause seriousdisease. There is strong evidence that HIV, the virus that causes AIDS,originally moved from chimps to humans, so this concern cannot beeasily dismissed. Human-to-human transplants do carry the risk ofviral infections, but the viruses in question are known (hepatitisviruses, HIV, and cytomegalovirus, among others) and donors can betested to rule out infections. An unknown virus that does not causeillness in a nonhuman primate might infect a human organ recipientand then go on to infect other people and cause serious humandisease. Economic and social factors have also discouraged theidea of using nonhuman primates as organ donors. Nonhumanprimates are expensive to breed and care for, and some species areendangered. Many people find the idea of sacrificing these closeanimal “relatives” as organ sources morally unacceptable becausethey are so similar to humans.

Successes and Failures of Primate Organ Transplants

There have been attempts to use nonhuman primates as tissue andorgan donors. In the 1960s, several surgeons transplanted kidneysfrom baboons or chimps into humans, and the patients survivedonly a few months. Born with a malformed heart, Baby Faereceived a baboon heart transplant in 1984. The procedure, her


Stop and ConsiderWhat factors have led researchers to explore xenotransplantation?


PRO OR CON?

Ethical Issues of Animal-to-Human Transplants

The debate over the animal rights ethics of xenotransplantation

is an extension of the general debate about the use of animals

in biomedical research. Most people believe it is alright to use

animals for the benefit of humans, with a minimum amount of pain

and suffering. They accept the breeding and sacrifice of animals

to replace failed kidneys, hearts, lungs, or livers, or to provide

cells to treat diabetes and Parkinson’s disease. However, some

animal rights advocates believe that the shortage of human organs

can be met in other ways, such as campaigns to encourage people

to sign donor cards or the possibility of using organs from people

whose hearts have stopped beating before the organs can be

harvested. Those who oppose animal transplantation believe it is

unethical to treat animals as a commodity to be killed for human

benefit. They hold the belief that animals have moral value

like that of humans and, just as it is unethical to sacrifice one

human being to provide organs for another, so it is wrong to kill

an animal for the same purpose. Because they are so similar to

humans, the use of nonhuman primates for this purpose is

particularly abhorrent to many people, but even the use of

pigs or other barnyard animals as organ and cell donors for

humans is unacceptable to some. As scientific progress appears

to promise improved ways to prevent and treat disease to avoid

the need for replacement of organs or cells, and as animal

rights advocacy grows, it may become more and more difficult

to overcome arguments against the wholesale breeding and

sacrifice of animals to benefit ailing humans. But the bonds

of kinship that make our loyalty highest to other humans

will continue to temper this trend. Neither the science nor

the ethics of xenotransplantation is yet mature.

three-week survival, and her ultimate death were watched by thewhole world. After her death, it was learned that a simple ABOincompatibility, rather than the fact that the donor was a baboon,had doomed the procedure.

Two baboon-to-human liver transplants were performed bytransplant pioneer Dr. Thomas Starzl in 1992. When both patientsdied of overwhelming infections within two months, Starzl decidedthat further organ xenotransplantation should be stopped and moreresearch done.

In 1995, Jeff Getty, a 38-year-old AIDS activist from SanFrancisco, received a baboon bone marrow transplant from a teamfrom the University of Pittsburgh and the University of Californiato try to replace his immune system, which had been destroyed byHIV. The baboon cells survived for just a few weeks, but Gettylived for several more years.

Organs from Non-primates

Researchers began to look elsewhere for possible nonhumandonors. The animal that seemed most promising for xenotrans-plantation was the pig. Pigs are easy and relatively inexpensive tobreed, and they produce large litters of offspring. Although theusual breeds of pigs grow to a very large size, tipping the scales at1,000 pounds (454 kg) or more, breeds of miniature swine growto about 300 pounds (136 kg) as adults. Their organs are just theright size for humans. The anatomy and physiology of the pigkidney, in particular, makes it especially suitable for transplanta-tion into humans. Whether pig livers would work in humans isunknown. Pigs can be bred and raised in sterile facilities to reduce


Stop and ConsiderWhy are nonhuman primates no longer considered as possible organdonors for humans?

the risk of infection. However, researchers have recently discov-ered that pigs harbor in their genome the sequence for severalRNA viruses, which, when activated, may infect humans andcause disease.

Another problem with using pigs as organ donors is the veryvigorous immune attack that would have to be blunted. Humanblood normally contains antibodies to sugar molecules present onthe surfaces of pigs’ cells. If the antibodies latched onto the cells thatline the blood vessels of the pig organ, hyperacute rejection wouldoccur. In addition, several types of destructive lymphocytes arepoised to attack organs and tissues from species that are as differentfrom us as pigs are. Some researchers have tried to genetically engi-neer pigs to reduce the antibody problem. Techniques have includedputting human proteins on the surface of the pig cells that preventactivation of complement proteins or disabling the pig gene for theenzyme that puts the antibody-targeted sugar on the cell surface. Toblunt the cell-based attack, several researchers have developedmethods to replace some of the immune system cells in the poten-tial organ recipient with pig immune-system cells in an effort tomake the recipient better tolerate the pig tissue. This approach hassucceeded in experiments with pig-to-monkey transplants.Whether these maneuvers will prevent hyperacute or quick cell-based rejection in humans is unknown, though experiments withpig cells have been encouraging.

A number of small biotechnology companies and academicresearch teams are working on these problems. However, worriesabout the pig RNA viruses have cooled enthusiasm for xenotrans-plantation. Although some laboratory work continues, there appearto be no immediate human xenotransplant studies on the horizon.Some researchers have, however, proposed using pig liver cells in adevice kept outside the body to help remove toxins from the bloodof patients whose liver has failed, to help the patients survive whilethey wait for a human liver transplant.


CONNECTIONS

The shortage of suitable organs for transplantation has led to effortsto see if animals might provide an acceptable alternate source. Despiteseveral attempts—some of them infamous—to use nonhumanprimates as organ donors for human patients, medical, economic,and social issues have led researchers to look to other animals.Recently, the pig has become the most promising species for xeno-transplantation, although there are serious barriers to using pigorgans in people, including the risk of a severe rejection response andthe possibility of human infections with potentially dangerousviruses. Research to solve these problems continues, but at a greatlyreduced level because of concerns about the potential for a seriousviral infection coming from the transplanted pig organ. Meanwhile,the waiting list for organs continues to grow.


Stop and ConsiderWhat makes pigs possible sources for organs? What problems mightthere be with pig-to-human transplants?

FOR MORE INFORMATIONFor more information about the concepts discussed in this chapter,search the Web using the keywords:xenotransplantation, transplant rejection, immunosuppressive drugs

Modern biotechnology has had a profound impact on the tests used inhealthcare, whether the test is done at home, in a doctor’s office,or in a commercial or hospital laboratory. Doctors rely on manydifferent tests to find out what is causing a patient’s symptoms.In the past, many of these tests were time-consuming andrequired both expensive equipment and trained technicians toget a reliable answer. The application of modern biotechnologymethods, however, has provided relatively inexpensive tests thatsave money, time, and, in many cases, have reduced the amountof blood needed.

MONOCLONAL ANTIBODY TESTS

Monoclonal antibodies have allowed for the development ofhundreds of new tests that are accurate, fast, and inexpensive.

130

Lab Tests UsingRecombinant Components

10

Diagnosing Infections

Fast diagnosis of some infections is important to allow timely treat-ment. Accurate and easy-to-use test kits allow clinic and emergencyroom staff to identify or rule out an infection suspected because ofthe patient’s symptoms. For these tests, a small sample of blood orother body fluid is put into cellulose-bottomed wells on the sideof a cigar-shaped plastic device, and tandem pairs of monoclonalantibodies lock onto different parts of the infecting bacterium,fungus, virus, or other infection, signaling the presence of thepathogen. In a typical kit, one monoclonal antibody linked to agold-colored particle that traps the intended target, and the mixtureis wicked by the cellulose to a band or spot where the other antibodyis stuck. If the target of the two antibodies is present in the sample,the spot or band will change color because the colored complex isconcentrated in a small area. Kits using this technology allow for aquick diagnosis of influenza and malaria.

Other Diagnostic Uses

Hospital and commercial diagnostic testing laboratories rely onmonoclonal antibody tests to measure the amounts of specific proteins,hormones, or drugs in blood. Monoclonal antibodies tagged to fluo-rescent dyes are also used with lasers to determine the kind of tumor apatient has, to track the number of tumor cells, and to monitor the levelof immune system cells. The CD4 count test, important to patients withHIV infection, uses monoclonal antibodies and a laser-driven devicethat checks cell by cell for the CD4 protein, the marker for the criticalimmune system cell. The same technology and a set of antibodies toimmune system cell proteins are used to diagnose children suspectedof having inherited an immune system deficiency.

Home-based Tests

Test kits based on paired monoclonal antibodies are so reliable and

131Lab Tests Using Recombinant Components

simple to use that they are approved to be sold for home use. Theover-the-counter pregnancy test kits sold in drug stores use pairedmonoclonal antibody reactive with human chorionic gonadotropin, aprotein hormone that appears in the serum and urine of a pregnantwoman 6 to 15 days after conception (Figure 10.1). A similar technol-ogy is the basis of some home glucose-monitoring devices for diabeticswho must match their insulin dose to their blood-glucose level.

DNA SEQUENCING TESTS

New, powerful methods of analyzing DNA and RNA have addedto the doctor’s tools for detecting and predicting illness. Thesemethods also have presented profound challenges.

Testing for HIV

The routine test for infection with the human immunodeficiencyvirus (HIV) measures whether a person’s blood contains antibodiesthat react with HIV proteins. Newer tests allow the detection of theHIV antibody in saliva. Antibody tests are not useful for trackinghow well treatment for HIV infection is working, particularly withthe development of effective drugs that control the ability of thevirus to increase in number. Physicians needed sensitive methods todetect small numbers of HIV virus in the blood. Three differentFDA-approved tests provide a precise count of the number of HIVparticles by measuring how many copies of the viral RNA genomeare present in the blood plasma, the clear fluid part of the bloodfrom which the cells have been removed. All of the tests useprobes targeted to sequences of the bases in the viral RNA genome,and each uses different powerful molecular methods to detect a viralcount as low as 50 copies per milliliter of plasma. In some tests, atechnique called PCR (polymerase chain reaction) makes manycopies of the virus genetic material so that an accurate virus countcan be made with a small sample of blood. These methods can alsodetect which type of HIV is present in the sample.



Figure 10.1 Home pregnancy testing devices, like the one seen here,utilize biotechnology techniques. This test uses paired monoclonalantibodies and colored beads to indicate increased human gonadotropinin urine. The second round well is a control, indicating the device isworking properly by trapping a common urine protein.

Tests for Genetic Conditions

Tests for inherited conditions that are apparent at birth have beenused for many years to help physicians and families choose appro-priate treatments. Other inherited conditions do not show upearly in life, but DNA-sequence differences allow detection beforesymptoms appear. The question of using the tests usually comesup when a family member is diagnosed with one of these condi-tions. The genetic tests may allow family members, particularly thechildren of those diagnosed, to know if they are at high risk. Genetictests are available for some families that have a history of breastand ovarian cancer, for a neurologic condition called Huntingtondisease; and for a disease of the colon called familial adenomatous

polyposis, in which many small growths that can turn into cancerdevelop in the colon. The use of these tests is complicated, bothmedically and psychologically.


DNA tests rely on two basics facts, 1) the distance a molecule of DNA moves in a thin slap

or small column of gelatin-like material when an electric current is passed through it

depends on the length of the piece of DNA, a process called electrophoresis and 2) single

strands of DNA will bind to each other if they have complementary base sequences: An

A will pair with a T, a T with an A, a G with a C, and a C with a G.

PCR, or polymerase chain reaction, is used to make many copies of one or more

important stretches of the DNA extracted from the sample. To see if the PCR product

contains a specific, inherited sequence for medical or forensic purposes, the PCR

product is heated to separate the two strands of DNA and treated with a probe, a short

piece of DNA complementary to the target sequence and tagged with a dye. If the spot

changes color, then the targeted sequence is present. The target may be a mutant form

of a breast cancer susceptibility gene, a tissue transplant compatibility gene, or a gene

for a blood enzyme known to be different in different people.

PCR is also used with specific probes to detect the presence of a virus or other infec-

tion in the blood or tissue and to determine how many virus particles are present.

Many of these tests are automated so that a technician need only place the extracted

DNA in a small tube, instruct the machine which tests to run, push a button, and wait

for the printout.

What Is PCR?

Breast and Ovarian Cancer

Genetic changes linked to an increased risk of breast and ovariancancers are found in only about one in ten of women with thesecancers. Everyone inherits two copies of the BRCA1 and BRCA2genes (the breast cancer genes), but mutations in one copy meanthat a woman has 3–7 times greater a risk of developing breast orovarian cancer. In family members of a woman diagnosed withbreast or ovarian cancer due to one of the mutated forms ofBRCA1 or BRCA2, genetic testing may allow relatives to find outif they have inherited an increased risk for breast or ovariancancer. The options for those with a positive test are not simple orentirely effective, however. More frequent and thorough physicalexams will possibly detect a cancer at an earlier, more treatablestage. Some women choose to have surgery to remove ovaries andboth breasts before cancer has a chance to set in. These are drasticsteps that do not even guarantee that a tumor will not develop,because it is surgically impossible to remove all of the tissue thatmight become cancerous. Treatment with drugs to reduce the riskis not consistently effective in those with the BRCA1 and BRCA2mutations. Given that these treatment options are not completelyeffective, the psychological disturbance caused by a positive testmay be greater than the peace of mind obtained from a negativetest result. Before the test is done, physicians and families need toconsider the consequences for the whole family if the womandiagnosed with breast cancer is tested.

Huntington Disease

Huntington disease presents an enormous family challenge becausethe symptoms do not develop until later in life. The mutated geneis dominant (as opposed to recessive), which means that the risk ofdeveloping the disease is 100% for people who inherit just onecopy of the mutated form of the gene. Children of a person withHuntington disease have a 50% chance of inheriting the mutated


gene. Beyond supportive medical care and counseling, there is notreatment for this progressive neurologic disease in which mentaland physical disturbances limit and shorten life. Deciding whoshould be tested and when the testing should be done is notsimple. A positive test imposes a burden on family relationshipsand threatens educational and other life choices. Testing a youngchild is not recommended because it may rob the child of the rightto accept or reject knowledge of the future he or she faces.

FAP

Familial adenomatous polyposis (FAP) is a disease for which genetictesting can provide useful information. Ninety-five percent of thosediagnosed with FAP have a dominant mutation in a gene, called theAPC gene. Most will develop colon cancer between the ages of 35and 45, if not properly treated, usually with removal of the colon.Children of an affected individual have a 50% chance of inheritingthe mutation. Routine examinations of the colon for polyps afterthe age of 12, and surgical removal of the colon when polyps appear,can greatly reduce the risk of developing colon cancer. People cansurvive without the colon. The remaining end of their digestive tractis attached to an opening created on their abdomen, and feces emptyinto a bag attached there. The procedure, called an ostomy, allowspeople to live long and essentially normal lives. There are some drugsthat may reduce the development of polyps in people with FAP.These are difficult choices to put before a child, choices that mayforever change the way that child has bowel movements, rigged witha plastic bag that holds feces. However, knowledge in this case maybe life-saving.


Stop and ConsiderWhat questions would you ask before agreeing to a genetic test toevaluate your risk of a disease?

DNA PROVIDES CLUES ABOUT COMMON ILLNESSES

Over the last decades, as the human genome was sequenced,scientists have assembled a vast library of small DNA-sequencedifferences that are precisely located within the genome. Themarker sequences were used for the reassembly of the sequencedpieces of the 3 billion base pairs. Some of these markers are foundwithin a gene that has changed in people with an inherited condi-tion. Other markers are just that—small sequence differences thatmay not by themselves contribute to an inherited condition.Depending on their location, they may or may not be inheritedby family members with a known inherited condition. Thesesmall sequence differences are sometimes just the substitution ofone nucleotide for another; for example, a G instead of a C. Ineach person’s DNA, there are millions of these single nucleotide

polymorphisms, inherited differences among individuals (calledSNPs), in about 1 out of every 1,200 bases.

Scientists are very interested in knowing whether single SNPs orsets of them could provide clues to common illnesses. Many com-mon human diseases are thought to be the result of the interactionof one or more genes with environmental factors such as infections,pollution, or smoking. Scientists are interested in testing peoplewith conditions such as heart disease, high blood pressure, cancer,and autoimmune diseases to see if any set of SNPs is found moreoften in those who have one of these conditions than in thosewho do not. In the future, using such information and powerfulmethods of detecting small differences in the DNA sequence, physi-cians may be able to determine if a person has an increased risk ofa condition such as heart disease, based on the pattern of markers.These markers may also provide clues as to who will or will notbenefit from or be harmed by a particular drug. Some people see thetesting for SNPs and other markers and the collection of inheriteddifferences in databases as potentially valuable, but others are con-cerned about the collection and possible abuse of such information,


which could lead to people being stigmatized by employers, healthinsurance companies, or others.

DNA Marker Tests

In the future, DNA markers may help predict who is likely to havea heart attack or develop arthritis, or even whose arthritis painmight be eased with a specific pill. Today, DNA markers are verypowerful tools to identify with a great degree of certainty whether


Many experts, including Dr. Francis Collins, director of the National Human Genome

Institute, have raised concerns that genetic tests could lead to genetic discrimination.

They worry that insurance companies may deny insurance or that an employer may deny

employment to an individual found to have inherited a gene that gives him or her an

increased risk of developing a disease. Current laws prevent discrimination against

people with medical conditions when it comes to health insurance, under the 1996

Health Insurance Portability Act (HIPPA), and in employment, under the Americans with

Disabilities Act (ADA). What about someone who is not currently ill but is identified as

having inherited an elevated risk of disease? Most Americans obtain health insurance

through their employers. HIPPA does protect against denial of group health insurance

based on an employee’s genetic information, without defining whether the risk is based

on family history or the result of a genetic test. HIPPA does not address individual health

insurance. The ADA deals with workplace discrimination for individuals with existing

disabilities, not potential ones. Even though genetic testing is not yet widespread, a few

anecdotal cases of genetic discrimination have been reported.

The Senate passed a bill in 2003 prohibiting discrimination based on the results of

a genetic test, but the House of Representatives has not yet considered the issue.

Although HIPPA strengthened the requirement to protect the privacy of personal medical

information, including family history and results of genetic tests, an insurance company

would know that the genetic test had been performed if it was asked to pay for it.

The results of genetic tests can have an emotional and medical impact on a whole

family. Physicians and genetic counselors work with the patient and the entire family to

make sure the medical and social significance of the results is understood. As more

genetic tests are developed and methods are established to reduce the inherited risk, the

issue will have to be addressed, or people will avoid tests that might allow treatments to

lengthen or improve their lives.

Could the Results of a Genetic Test Be Used to Harm You?

a particular person committed a crime or is the father of a child.Conventional fingerprints have been used for more than 100 yearsby law enforcement officials to identify a person who touchedsomething. The whorls and swirls of fingerprints, created when weare still in the womb, distinguish us from one another, but theyprovide little more than a “yes or no” answer—providing a matchor not for the fingerprint taken from a crime scene. DNA markertests used for legal purposes distinguish between all people exceptidentical twins. With databases of the markers found in large num-bers of people, a DNA marker match can provide a mathematicalestimate of the chance that the blood, semen, or even a dandruffsample at the scene of a crime could have come from someoneother than the suspect.

Similar tests are also used to determine if a particular man is achild’s biological father. DNA markers are inherited and when thechild’s DNA marker pattern is compared with the mother’s and thealleged father’s, it is easy to see whether the child inherited a markerthat is not present in either the mother’s or the man’s pattern. If so,the man cannot have fathered the child. If the man is not excluded,using the same mathematical methods used for crime scene inves-tigations, the scientist can provide an estimate of the chance thatanother man could be the child’s father and could have provided theDNA marker pattern the child inherited from his father.


The target sequence for DNA profiling that is most widely used for forensic purposes has

no known function. Our genome contains many regions in which short base sequences

are repeated several times. The number of repeats is inherited. Several different short

tandem repeats (STRs) provide powerful forensic tests. To obtain STR profiles, the PCR

products generated using primers specific for each STR are clipped by restriction

enzymes that cut the DNA on either side of the run of repeats. The resulting pieces are

separated by size by exposing them to an electric field, and the size of the piece that

binds to a probe of the repeating sequence is compared with standards to indicate the

number of repeats.

How Are Forensic DNA Tests Done?

For both crime scene investigation and paternity testing, lab-oratories use a panel of DNA markers that are very likely to bedifferent from one person to another. If the alleged father orsuspect is not excluded by the discovery in the child of a marker theman does not have, or in the sample from the crime scene, thenthe scientist can calculate the odds against someone else havingthe same pattern of markers. The chances of someone else havingthe set of markers may be one in millions or even billions. Therecan be problems with these calculations because the frequencies ofmarkers vary among different ethnic groups. If the database usedfor the calculations does not include enough representatives of thesuspect’s or alleged father’s ethnic group, then the calculations mayseriously underestimate the possibility that someone could havehad the same marker results.

To help in law enforcement, a federal law was enacted in 1994 thatestablished a Federal Bureau of Investigation (FBI) national DNAdatabase called CODIS (Combined DNA Index System). By 1998, all50 states had passed laws that require all persons convicted of serioussex offenses and other crimes to provide a sample of blood for DNAanalysis. The marker results are entered into the CODIS database,along with the results of crime scene samples. The methods and panelof markers used are standardized for all states so that results froma sample tested in one state can be compared with all the files inthe database. Some groups argue that requiring a blood sample is a


Stop and ConsiderSome states have passed laws that require that everyone arrestedfor certain serious crimes provide a DNA sample for analysis andinclusion in CODIS (see below). What rules should there be forsaving and sharing DNA profiles in law enforcement databases fora person arrested but acquitted of a crime?

unwarranted invasion of privacy. Another practice that disturbs somepeople is when law enforcement agencies keep convicts’ DNA samplesfor later analysis. The situation is further clouded by laws passed inLouisiana and Texas that require DNA samples from people arrestedfor certain offenses, even if DNA analysis is not required for theprosecution of the offense. As with the introduction of any newtechnology in law enforcement, these issues will likely wind theirway through the state and federal courts over the coming years.

The Use of DNA Microarray

The way a cell or tissue looks under a microscope can provide use-ful information in diagnosing disease or in choosing an appropriatetreatment for an illness. New methods that provide a detailedaccounting of what genes are being read to produce proteins in atissue sample also may provide important information to a doctor.These tests, using devices called DNA microarray or gene chips, havebecome important laboratory research tools and are beginning to beapplied to medical care (Figure 10.2).

The tests are based on information gained from the humangenome project and computer chip manufacturing technology. Themessenger RNA copy of a gene used to make a protein in a cell iscomplementary to and will bind to the DNA gene. To find outwhich genes are being used, the cell’s RNA is copied into fluorescentdye-tagged DNA using PCR with a collection of fluorescent-dye-linked primers for a large number of genes. A robotic machinedeposits a defined array of small amounts of all the different genesto be tested onto a piece of glass or nylon. If the PCR products bindto a spot on the chip, that spot—the particular gene—will becomefluorescent. The chip is then analyzed to provide a list of the genesthat the cell is using to make proteins.

Scientists have developed a DNA microarray test that predictswhether a woman with a certain type of breast cancer will have thecancer recur after the tumor is removed. This helps physicians and


patients decide if further drug treatment is necessary. DNA micr-oarray technology is also used to tell drug researchers what form ofseveral genes a subject has inherited—information important inhow the body breaks down drugs. This may predict whether the drugwill build up in the body, leading to toxic effects. Drug companiesare working to see if these methods will allow drugs to be tested andeven used more safely (Figure 10.3).


Figure 10.2 This scientist is examining a microarray slide. The patternof binding of the test samples, to the array of DNA on the slide, isdisplayed on the computer screen. Libraries of small chemicals can alsobe analyzed for their ability to bind to DNA or protein microarrays in asearch for potential new drugs.


Figure 10.3 Microarrays can be used to determine which genes arebeing “read” to make messenger RNA by a cancer cell. This processis illustrated here.

CONNECTIONS

Biotechnology tools and methods have provided many new andimproved laboratory tests. Diagnoses can be made more rapidlyand with greater precision, so that appropriate treatment can bestarted and potentially useless treatment avoided. Family memberscan find out if they are at high risk of contracting a devastatingdisease discovered in a relative. Law enforcement has new toolsto identify the perpetrators of violent crimes. A child’s biologicalfather can be identified with confidence. Some of these tests,because they probe the details of our personal genome, raise ques-tions and concerns about the consequences of knowing, especiallywhen there is little that can be done to change the outcome. Theyalso raise questions about the potential misuse of genetic informa-tion in employment decisions as well as access and cost of healthand life insurance. Debates will continue about the proper use andlimits of this technology. The potential of these tests to uncover ourgenetic makeup and our risk of developing a serious disease—andthus, in a sense, to uncover who we are and to predict our future—can be disquieting.


FOR MORE INFORMATIONFor more information about the concepts discussed in this chapter,search the Web using the keywords:genetic tests, breast cancer genes, Huntington disease, familial adenomatous

polyposis, polymerase chain reaction (PCR), forensic DNA tests

C. 4000-2000 B.C. Yeast used to leaven bread and make beer and wine

C. 500 B.C. Moldy soybean curds used to treat boils (first antibiotic)

C. 8000 B.C. Crops and livestock domesticated

C. 100 A.D. Powdered chrysanthemums used as first insecticide

1590 Microscope invented

1600 Beginning of the Industrial Revolution in Europe

1663 Cells discovered

1675 Anton van Leeuwenhoek discovers bacteria

1797 Edward Jenner inoculates child to protect him fromsmallpox

1857 Louis Pasteur proposes microbe theory for fermentation

1859 Charles Darwin published the theory of evolutionthrough natural selection

1865 Gregor Mendel published the results of his studies onheredity in peas

1890 Walther Fleming discovers chromosomes

1914 First use of bacteria to treat sewage

1919 Term biotechnology was coined by Karl Ereky, aHungarian engineer

1922 First person injected with insulin, obtained from a cow

1928 Alexander Fleming discovers penicillin

1933 Hybrid corn commercialized

1944 Oswald Avery, Colin MacLeod, and Maclyn McCartyprove that DNA carries genetic information

1953 James Watson and Francis Crick publish paperdescribing the structure of DNA

145A HISTORY OF BIOTECHNOLOGY

1961 Bacillus thuringiensis registered as first biopesticide

1966 Marshall Warren Nirenberg, Har Gobind Korhana, andRobert Holley, figure out the genetic code

1973 Herbert Boyer and Stanley Cohen construct firstrecombinant DNA molecule and reproduce

1975 First monoclonal antibodies produced

1975 Asilomar Conference held; participants urge U.S.government to develop guidelines for work withrecombinant DNA

1977 Human gene expressed in bacteria

1977 Method developed for rapid sequencing of long stretchesof DNA

1978 Recombinant human insulin produced

1980 U.S. Supreme Court allows the Chakrabarty patent for abacterium able to break down oil because it contains twodifferent plamsids

1980 Stanley Cohen and Herbert Boyer awarded first patentfor cloning a gene; Paul Berg, Walter Gilbert, andFrederick Sanger awarded Nobel Prize in chemistry forthe creation of the first recombinant molecule

1981 First transgenic animals (mice) produced

1982 Human insulin, first recombinant biotech drug,approved by the FDA

1983 Human immunodeficiency virus, the cause of AIDS, isidentified by U.S. and French scientists

1983 Idea for PCR conceived by Kary Mullis, an Americanmolecular biologist

1984 First DNA based method for genetic fingerprintingdeveloped by Alec Jeffreys

A HISTORY OF BIOTECHNOLOGY146

1985 First field testing of transgenic plants resistant to insects,bacteria and viruses

1985 Recombinant human growth hormone approved by theFDA

1985 Scientists discovered that some patients who hadreceived human growth disorder hormone fromcadavers had died of a rare brain disorder

1986 First recombinant cancer drug approved, interferon

1987 The first field test of a recombinant bacterium, Frostban,engineered to inhibit ice formation

1988 Human Genome Project funded by Congress

1990 Recombinant enzyme for making cheese introduced,becoming the first recombinant product in the U.S.food supply

1990 First human gene therapy performed, in an effort totreat a child with an immune disorder

1990 Insect resistant Bt corn approved

1994 First gene for susceptibility to breast cancer discovered

1994 First recombinant food (FlavrSavr tomatoes) approvedby FDA

1994 Recombinant bovine growth hormone (bovinesomatotropin, BST)

1997 Weed killer resistant soybeans and insect resistant cottoncommercialized

1997 Dolly the sheep, the first animal cloned from an adultcell, is born

1998 Rough draft of human gene map produced, placing30,000 genes

147A HISTORY OF BIOTECHNOLOGY

1999 Jesse Gelsinger, a participant in a gene therapy trial foran inherited enzyme defect, dies as a result of thetreatment

2000 First report of gene therapy “cures” for an inheritedimmune system defect. A few months later, several ofthe treated children developed a blood cancer

2002 Draft of human genome sequence completed

2003 First endangered species cloned (the banteng, a wild oxof Southeast Asia)

2003 Dolly, the cloned sheep, develops a serious chronic lungdisease and is euthanized

2003 Japanese scientists develop a genetically engineeredcoffee plant the produces low caffeine beans

2004 Korean scientists report human embryonic stem cellproduced using a nucleus from an adult cell

2005 Korean scientists improve success rate of human adultnuclear transfer to embryonic cells by 10 fold

A HISTORY OF BIOTECHNOLOGY148

ABO blood groups—Blood types important in transfusions and transplants;blood types of donor and recipient must match to prevent deadlytransfusion reactions.

Adenosine deaminase (ADA)—Protein absent in a type of inherited defect inthe body’s defense system. The absence of this protein results in death of keycells in the defense system.

Adenoviruses—Double-stranded DNA viruses that can efficiently carry largergenes into cells even if they are not dividing, but the genetic informationdoes not become inserted into the cell’s genetic material and the informationmay rapidly be lost.

Adult stem cells—Unspecialized cells in adult tissues that can turn intodifferent kinds of specialized cells.

Adverse events—Illnesses or deaths resulting from a medical procedure or drug.

AIDS—See Human immunodeficiency virus.

Allergic reaction—An abnormal response by the body’s immune system.

Amino acid—One of the 20 building blocks of proteins.

Angiogenesis—Formation of blood vessels.

Antibiotic—Substance that destroys or slows the growth of organisms that arevisible only with a microscope.

Antibodies—Proteins produced by the body’s immune system that bind to aspecific foreign material or invading organism.

Antigen—Material that the body’s immune system sees as foreign.

Antisense—Method other than altering abnormal genes, by which theabnormal genes are simply switched off.

Antitoxin—Protein produced by the body’s immune system that binds to apoisonous molecule and prevents it from harming the body.

Antivenom—Protein produced by the body’s immune system that binds to apoisonous substance from a snake or insect.

Apoptosis—Programmed cell death.

Autoimmune disease—One of a number of illnesses caused by the immunesystem targeting the patient’s own tissues for destruction, such as rheumatoidarthritis or multiple sclerosis.

149GLOSSARY

Bacteria (Singlular is bacterium)—Single-celled organism visible only that has a microscope and with no membrane surrounding its geneticmaterial.

Bacteriophage—Virus that infects single-celled organisms with no membranesurrounding their genetic material.

Base—One of the four substances that form the building blocks of DNA andcode genetic information. DNA molecules are chains of four bases: adenosine(A), cytosine (C), guanine (G), and thymine (T), each slightly differentchemically from the others.

Basophil—Type of white blood cell involved in the defense at a site of injury;plays a role in inflammation.

Biotechnology—Use of a living organism to make a useful product.

Blastocyst—Early stage animal or human embryo made of a hollow ball of cells.

Blood clotting—Process that changes blood from a liquid to a semisolid.

Blood stem cells—Stem cells that can become any type of blood cell. SeeHematopoietic stem cells.

Blood transfusion—Transfer of blood, or blood components, into the body to replace blood lost in an accident, surgery, or childbirth, or tosupplement a lack of blood components. Used routinely and safely due to ABO blood type matching and testing for infections in the blood, such as HIV.

Bone marrow—Soft tissue inside the hollow part of most bones, in which stem cells can be found; important in the production of blood cells.

Bovine spongiform encephalopathy—See Mad cow disease.

BRCA—See breast cancer gene.

Breast cancer gene—BRCA1 and BRCA2 genes, which, if mutated, areassociated with greater risk of breast or ovarian cancer, but only one in tenwomen with breast and ovarian cancer has these genetic changes. Somewomen in whom the mutations are identified choose surgical removal of breasts and ovaries before cancer is detected. Treatment with drugs toreduce cancer risk is not consistently effective in those with BRCA1 andBRCA2 mutations.

GLOSSARY150

Cancer—Loss of normal control of the increase in the number of cells, whichmay result in the invasion into and destruction of surrounding tissue.

Cancer gene—See Oncogene.

Cell cloning—Production of a group of cells that are replicas of the original cell.

Cell fusion—Merging of two cells so that they are contained with a singlemembrane envelope.

Cerebroside—Fatty substance that fills up blood cells in Gaucher disease.

Chemotherapy—Cancer treatment using drugs that are cell poisons, somewhatmore lethal to cancer cells than to normal cells. Because some normal cellsare also damaged, such as those in hair follicles, digestive system lining, andbone marrow, side effects of chemotherapy include nausea, hair loss, and aweakened immune system.

Chloroplast—Structure in green plant cells that captures light energy andconverts it into chemical energy.

Chromosomes—Thread-like structure in cells made of protein and DNA thatcarries genetic information.

Clinical trials—Tests of drugs on human subjects.

Cloning—Production of exact replicas of a gene, cell, plant, or animal.

CODIS (Combined DNA Index System)—A Federal Bureau of Investigation(FBI) national DNA database established in 1994. By 1998, all 50 statesrequired persons convicted of serious sex offenses and other crimes toprovide a blood sample for DNA analysis. Results are entered in CODISso that a sample from one state can be compared with the entire database.CODIS is controversial.

Complementary bases—Subsets of the four building blocks of DNA that easilyform pairs. The bases A and T, as well as C and G, are complementary bases.

Corticosteroids—Chemicals produced in small amounts by a group of cellsthat sits above the kidneys. The chemicals regulate how the body makes andbreaks down sugar, fat, and protein, as well as how the body maintains itswater and salt balance. Can be used as drugs.

Cowpox—Virus related to the smallpox virus, it causes a mild disease in cowsand humans and is used to protect people against smallpox.

151GLOSSARY

Creutzfeldt-Jacob disease—Human form of transmissible spongiformencephalopathy (TSE), a brain disease in which nerve cells of the brain aredestroyed. Seen under a microscope, the brain tissue of people with TSEresembles a sponge.

Crohn’s disease—Inflammatory disease that affects the intestines.

Cyclosporine—Drug, produced by a soil fungus, that is very effective inblocking the body’s immune system.

Cystic fibrosis (CF)—A genetic disease affecting the lungs and pancreas causedby a mutation of a gene for chloride transport protein. It was targeted byearly efforts at gene therapy, but without success.

Cytoplasm—The semi-fluid material inside a cell.

Deoxyribonucleic acid—See DNA.

Diabetes—Condition in which the body does not respond correctly to changes in the sugar content of the blood.

Dialysis—Method of separating large and small molecules using amembrane that only lets some molecules pass through it. This process is used to remove waste products from the blood in people whose kidneys are not working properly.

Differentiation—The change by an unspecialized cell to a more complex,specialized cell.

Digitalis—Drug obtained from the foxglove plant and used to stimulate the heart.

DNA (deoxyribonucleic acid)—Carrier of genetic material that determinesinheritance of traits. DNA is in chromosomes in every cell of the bodyexcept red blood cells and is copied when cells divide. DNA molecules areshaped like a double helix, and are composed of sequences of four bases:adenosine (A), cytosine (C), guanine (G), and thymine (T). The sequence ofthe bases directs production of particular proteins by determining the sequenceof amino acids in proteins. The double-helix structure of DNA helps it transmitgenetic information.

DNA ligase—Protein that facilitates the joining of DNA molecules.

DNA microarray—Arrangement on a glass or plastic slide of small amounts ofDNA with different sequences.

GLOSSARY152

DNA polymerase—Protein that copies DNA by linking together bases that arelined up and paired with complementary bases in a piece of DNA.

Dominant—Refers to a gene with two or more forms that has an effect on theorganism even if only one copy is present.

Double-blind test—Test in which neither the subjects nor the researchers knowwho is getting the new drug and who is getting the placebo or control drug.

Double helix—The shape of DNA molecules, discovered by James Watson andFrancis Crick. The double helix is made up of two chains of DNA bound toeach other by weak chemical bonds between pairs of complementary bases.This base pairing allows the DNA to be copied precisely when the strandsseparate as cells divide.

Embryonic stem cells—Unspecialized cells in the early embryo, each of whichcan give rise to every type of cell in the adult.

Enzymes—Proteins that facilitate chemical reactions.

Eosinophil—Type of white blood cell involved in defense against invadingorganisms; also play a role in allergies.

Erythrocytes—Red blood cells; the color comes from the oxygen-carryingprotein hemoglobin inside the cell.

Escherichia coli (E. coli )—Bacteria in human intestine that aids in digestion;it does not cause disease unless the bacteria escape to other organs ortissues. However, some strains of E. coli produce toxins and can cause foodpoisoning. Strains of E. coli are used in biotechnology, modified so thebacteria cannot cause disease.

Eukaryotic cells—Cells with the genetic material surrounded by a membranemade of protein and fat.

Familial adenomatous polyposis—An inherited disease of the colon in whichmany small growths develop in the colon and can turn into cancer. Genetictests are available for this disease.

Fermentation—A biochemical reaction involving enzymes that breaks downcomplex carbohydrates and simple sugar (glucose), usually producing carbondioxide and ethanol or an acid.

Fibrin—Blood protein involved in blood clotting and wound healing.

153GLOSSARY

Food and Drug Administration (FDA)—U.S. government agency responsiblefor approving drugs for sale based on information from laboratory, animal,and human studies. Human studies, called clinical trials, can begin only afterthe FDA reviews the laboratory and animal studies.

Forensic—Related to law and courts of law.

Fungi—Group of organisms that have cell walls like plants, but no greenpigment. May grow as single cells or joined together. Usually grow in dampconditions; some fungi can infect humans and cause disease.

Gaucher disease—Hereditary condition caused by an error in the gene for theenzyme that breaks down a fatty substance called cerebroside; blood cellscalled macrophages fill with cerebroside, and settle in several organs. Peoplewith Gaucher disease experience pain, and their bones break easily. Gaucherdisease has been treated by a biotechnology drug.

Gene—Part of the genetic material that directs production of a particularprotein, and thus determines the presence or absence of a particular trait.Genes may be dominant or recessive.

Gene chip—Arrangement of small amounts of different genes on a small glass,plastic slide, or silicon chip used in genetic tests.

Gene therapy—Inserting genes into cells in an effort to treat inherited diseasesor cancer.

Genetic engineering—Changing an organism by inserting a gene fromanother organism into its genetic information.

Genetic tests—Examinations for inherited conditions detected throughidentification of difference in DNA sequences, so that conditions can beidentified before symptoms appear.

Genome—All the genes of a cell or organism.

Germ cells—Cells that develop into the reproductive sperm and egg cells.

Gland—Group of cells that produces specific substances and delivers themto the blood.

Glucose—Sugar molecule found widely in nature.

Graft versus host disease—Condition caused in a transplant blood cell, whena donor’s immune system cells attack the new organ. The condition canseverely damage the intestines, liver, and other organs, and may be fatal.

GLOSSARY154

Growth hormone—Protein produced by a small collection of cells in the brainthat influences the growth of bones, the production of proteins, and the useof fat for energy.

Hematopoietic stem cells—Immature cells that produce all the types of cellsfound in the blood.

Hemoglobin—Protein that shuttles oxygen from the lungs to the tissues andmoves waste CO2 from the tissues to the lungs.

Hemophilia—Inherited absence of one or more of the proteins required for theblood to change from liquid to semisolid.

HIV/AIDS—See Human immunodeficiency virus.

Human Genome Project—Decades-long international effort by hundreds of laboratories and thousands of scientists to determine the sequence ofhuman DNA.

Human immunodeficiency virus (HIV)—Virus that causes AIDS (acquiredimmunodeficiency syndrome) by destroying a critical cell of the body’simmune system.

Huntington disease—Progressive neurological disease that shortens life spanand causes mental and physical problems. This hereditary disease is passeddown through a dominant mutated gene, so those who inherit one copy ofthe mutated gene will develop Huntington. There is no treatment for thedisease. Genetic testing is possible, but symptoms do not appear until later inlife, often after the childbearing years.

Hybridomas—Fusion of a tumor cell and a specialized cell of the immune system,able to produce a large amount of the same immune system binding protein.

Hyperacute rejection—Very rapid attack of foreign cells or organs caused bybinding protein of the body’s immune system.

Immune system—Series of specialized cells and proteins that provide powerfuldefenses against infectious diseases.

Immunization—Production by artificial means of the capacity of the immunesystem to protect the body.

Immunosuppressive drugs—Medications that block the body’s immune system.

Infectious disease—Illness caused by the invasion of bacteria, mold, viruses,or other microorganisms.

155GLOSSARY

Inflammation—Set of responses triggered by the immune system when whiteblood cells congregate around a wound or other threat of infection. Inflamedtissue is warm, red, swollen, and painful.

Informed consent—Permission to proceed with a medical procedure, test, orexperiment, based on full understanding of the process, its risks, and benefits.There are strict rules requiring informed consent to protect the subjects ofexperiments, including clinical trials.

Inoculated—Have a small amount of a microorganism introduced into the body.

Inoculation—Introduction into a culture dish or the body of a small amountof a microorganism.

Insulin—Signal protein that controls the cells’ ability to use sugar to makeenergy and new proteins.

Interferons—Family of immune system signal proteins that interfere with theability of viruses to infect cells. Interferons have been genetically engineeredto provide treatments by weakening immune response in autoimmunedisease such as multiple sclerosis, or by strengthening immune response indiseases like hepatitis C.

Irradiation—Exposure to high energy electromagnetic waves (X rays).

Islets of Langerhans—Distinctive cells in the pancreas that produce insulin.

Lymphocytes—Infection-specific white blood cells that are part of the immunesystem response.

Macrophage—Type of blood cell that ingests bacteria or cell debris.

Mad cow disease—Bovine spongiform encephalopathy, or BSE, the form oftransmissible spongiform encephalopathy (TSE) found in cattle. It is thoughtto be spread by consumption of brain tissue and caused by proteins calledprions.

Malaria—Disease caused by a single-celled parasite that infects a humanthrough a mosquito bite.

Medicinal properties—Ability to cure disease or relieve symptoms.

Messenger ribonucleic acid (mRNA)—Messenger RNA copy of a gene usedto make a protein in a cell; it is complementary to and will bind to theDNA gene.

GLOSSARY156

Microbe—Living organism only visible with a microscope.

Microorganism—Living organism only visible with a microscope.

Milliliter—1/1,000 of a liter.

Minibodies—Small pieces of antibodies engineered to be produced in bacteriaor animal cells. Because of their small size, minibodies may be able do thingsto cells that large bulky antibodies cannot do.

Mitochondria—The structures within all eukaryotic cells that break downnutrients to produce energy for the cell.

Mold—Growth of a microorganism that has a hard outer wall like a plant butno green pigment, found in damp surroundings.

Monoclonal antibodies—Defense system proteins that are identical, producedby a culture of identical cells.

Morphine—Drug that makes a person sleepy and relieves pain, but can lead todependence.

Multiple sclerosis—Nervous system disorder in which the body’s immunesystem mistakenly attacks the fatty insulation of cells of the brain and spinalcord.

Multipotent adult progenitor cell (MAPC)—Unspecialized cell found in adult tissue that can turn into several different types of specialized cells.

Mutation—Change in the genetic material of a cell or organism that isinherited.

Myelin—Fat and protein insulation on the nerve fibers of the brain and spinal cord.

Neutrophil—Type of white blood cell involved in defense against bacteria;also plays a role in inflammation.

Nucleus—Membrane-bound body containing the genetic material ineukaryotic cells (yeast, insects, plants, and animals).

Oncogene—Gene that can change a normal cell into a cell that fails to respondto the body’s normal control of growth and cell division.

Ornithine transcarbamylase—Protein that facilitates the breakdown one of thebody’s waste products.

157GLOSSARY

Ovary—Egg-producing organ of female animals.

Pancreas—Organ in the abdomen that produces digestive proteins and insulin,a signal protein that controls cells’ ability to use sugar to make energy andnew proteins.

Parkinson’s disease—Disease of the nervous system caused by failure to makea particular signal molecule; patients have muscle weakness and shaking ofarms and legs.

Penicillin—Antibiotic produced by mold, discovered by Alexander Fleming in 1928.

Peptides—Short chains of amino acids; small proteins.

Pituitary gland—Collection of cells at the base of the brain that produces anumber of signal molecules that circulate in the blood to regulate a largenumber of the body’s processes.

Placebo—Inactive dummy pill or injection.

Placenta—Layer of tissue that attaches to the inside wall of the uterus andnurtures the growing fetus.

Plasma—The clear fluid part of blood.

Plasmid—Piece of DNA inside a bacterium that is separate from thebacterium’s genetic material, but is copied each time the bacterium divides.It is used in biotechnology to introduce new genetic information into abacterial cell.

Platelets—Small cell fragments produced from bone marrow cells that helpblood to clot. If platelet counts are low, leaks in blood vessels that wouldnormally be small can result in the loss of large amounts of blood. Certainchemotherapy drugs diminish production of platelets.

Pluripotent—Able to develop into several different kinds of specialized cells.

Polymerase chain reaction (PCR)—Process of making many copies of astretch of DNA using short pieces able to bind to each end of the DNA, aheat-resistant protein able to drive the production of the new DNA betweenthe short pieces, and multiple rounds of heating and cooling to separate thestrands of DNA and allow the new DNA to be made.

Polypeptides—Synonym for proteins.

Primer—Stretch of nucleotides complementary to one end of a stretch of DNA.

GLOSSARY158

Prion—Abnormal form of a brain protein thought to be responsible for severaldifferent diseases in which brain tissue comes to look like a sponge. Prionsmay be passed from one individual to another by consumption or injectionof infected brain tissue.

Promoter—Beginning of a gene where the DNA code is read to make a protein;may function as an on-off switch for protein production.

Proteins—Large molecules produced by living organisms, composed of one ormore chains of amino acids. These may be modified by the addition of sugarsor other chemical substances.

Proteome—Entire collection of proteins made by any organism.

Protocol—Detailed directions for an experiment and for a study of a medicinein animals or humans.

Quinine—Chemical taken from the bark of the cinchona tree and used totreat fevers and to prevent malaria, an infection of a single-celled organismthrough a mosquito bite.

Receptor—Docking protein for a signal molecule; may sit on the outsidemembrane of a cell or inside the cell.

Recessive—Refers to a form of a gene that is only apparent in thecharacteristics of the organism if two copies are present.

Recombinant DNA—DNA molecule made of genes from different sources.

Red blood cells—Type of blood cell filled with the red protein hemoglobinthat carries oxygen to tissues.

Reproductive cloning—Production of a genetically exact copy of anindividual.

Restriction endonucleases (RE)—Proteins that create breaks within DNAmolecules based upon the sequence.

Retrovirus—Virus whose genetic material is composed of ribonucleic acid(RNA).

Rheumatoid arthritis—Disease in which immune system cells attack tissues inthe joints, triggering inflammation, pain, swelling, and, if left unchecked,crippling damage to the joints of the hands, arms, and legs. RA is treatedwith nonprescription anti-inflammatory drugs, but some recombinantproteins that target inflammation are used to treat RA.

159GLOSSARY

Ribosomes—Structures inside a cell where proteins are manufactured.

Ribozyme—RNA molecule that is able to cut itself.

Serum—Clear fluid part of the blood after the blood has clotted.

Severe combined immunodeficiency—Inherited absence of a functionalimmune system against infections with bacteria and viruses.

Single nucleotide polymorphisms—Inherited differences in a single base of DNA.

Small interfering RNA (siRNA)—Short double-stranded RNA molecules ableto interfere with the reading of a gene to make a protein.

Smallpox—Virus infection that causes fever and skin eruptions,frequently fatal. Smallpox has been eradicated by worldwide campaigns to vaccinate, making the body’s immune system able to resist infection by the introduction beneath the skin of a small amount of a harmless form of the virus.

Somatic cells—All cells in the body, except the germ (reproductive) cells, thatcan divide to produce more cells like itself.

Somatic nuclear transfer (SNT)—Mechanical transfer of the nucleus of a bodycell to replace the nucleus of an animal or human egg.

Stem cells—Unspecialized cells able to develop into specialized cells; may havelimited capacity (multipotent or pluripotent) or may be able to turn into anycell of the body (totipotent).

Taxol—One of the most effective modern cancer drugs, came out of a massivegovernment search for new cancer medicines from plants. Taxol is used totreat cancer of the ovary, breast, and certain forms of lung cancer. Taxolcomes from the bark and needles of a yew tree.

T cell—Type of white blood cell important in the immune system.

Therapeutic cloning—Creation, through the transfer of a nucleus of anindividual’s mature cell to an egg, of a source of stem cells able to providecells to repair or replace damaged cells.

Totipotent—Able to turn into any cell in the body, under the appropriate conditions.

Toxins—Poisonous molecules produced by a living organism.

Transfer RNA (tRNA)—RNA that shuttles an amino acid to the site of proteinproduction, the ribosome.

GLOSSARY160

Transgene—A gene transplanted from one organism into another. A gene takenfrom one organism and inserted into the genetic material of another organism.

Transgenic animal—Animal into which a gene from another organism hasbeen introduced by recombinant DNA methods.

Transmissible spongiform encephalopathies (TSEs)—Brain diseasestransmitted from one animal to another. Under a microscope, the braintissue of animals and people with TSEs resembles a sponge. TSEs includevariant Creutzfeldt-Jacob disease (vCJD) in humans, scrapie in sheep andgoats, and bovine spongiform encephalopathy (BSE) in cows (mad cowdisease). These diseases are spread by consumption of brain tissue and arethought to be caused by prions, a kind of protein.

Transplant rejection—Immune system attack on genetically different tissuethat occurs when an organ is transplanted from one person to another. Theimmune system of the recipient recognizes the transplanted tissue as foreign.

Tumor—Masses of cells, often cancer cells, characterized by uncontrolled andusually rapid cell division.

Tumor necrosis factor (TNF)—One of the cell-damaging proteins involved ininflammation, named because it appeared to kill cancer cells in thelaboratory. Drugs for some autoimmune diseases like rheumatoid arthritisand Crohn’s disease are designed to target TNF.

Tumor suppressor gene—Gene that blocks the survival and growth of cancercells.

Uterus—Organ in female mammals where the young develop before birth.

Vaccination—Use of a material to cause the immune system to developresistance to infection by disease-causing organisms.

Vaccines—Killed or weakened disease-causing organisms or materials fromthem that can be used to stimulate the immune system to develop resistance.

Vectors—Structures used to deliver genetic material into a cell.

Viruses—Very small particles able to infect cells and reproduce inside the cell.Viruses are inert outside of a cell.

White blood cells—Blood cells that fight infection; they do not havehemoglobin. There are several types of white blood cells: the lymphocytes.monocytes, neutrophils, eosinophils, and basophils.

161GLOSSARY

GLOSSARY162

Xenotransplantation—Replacement of an organ (kidney, liver, heart, etc.) withone from another species. Used to describe the use of animal organs inhumans.

X-linked severe combined immune deficiency (X-SCID)—Absence of afunctioning immune system inherited with the X chromosome. X-linked refersto inheritance with the X chromosome, one of the chromosomes involved indetermining gender. In humans, women have two X chromosomes, and menhave an X and a Y chromosome. X-linked genes can only be inherited by a boyfrom his mother, since his father would have given him his Y chromosome.

Aguilar, G. “Access to Genetic Resources and Protection of Traditional Knowledgein the Territories of Indigenous Peoples.” Environmental Science & Policy Vol. 4(2001): 241-256.

Alberts, B., A. Johnson; Julian Lewis, Martin Raff, et al. Molecular Biology of the Cell 4th ed. New York, NY: Garland Publishing, 2002.

Anonymous. “DNA’s Detective Story; Case History.” The Economist(March 2004).

Artuso, A. “Bioprospecting, Benefit Sharing, and Biotechnological CapacityBuilding.” World Development 30 no. 8 (2002): 1355-1368.

Baneyx, F. “Recombinant protein expression in Escherichia coli.” Current Opinion in Biotechnology 10 no. 5 (1999): 411-421.

Bastian, L.A., K. Nanda, V. Hasselblad, and D. L. Simel. “Diagnostic Efficiencyof Home Pregnancy Test Kits: A Meta-analysis.” Archives of Family Medicine7 no. 5 (1998): 465-469.

Begley, S., T. Hayden, W. Underhill, and G. Beals. “Decoding the Human Body.”Newsweek (April 10, 2000): 50.

Braham, S., J. Gandhi, S. Beard, and B. Cohen. “Evaluation of the RocheLightCycler Parvovirus B19 Quantification Kit for the Diagnosis ofParvovirus B19 Infections.” Journal of Clinical Virology 31 no. 1(2004): 5-10.

Bruu, A., R. Hjetland, E. Holter, L. Mortensen, et al. “Evaluation of 12 Commercial Tests for Detection of Epstein-Barr Virus-Specific and Heterophile Antibodies.” Clinical and Diagnostic Laboratory Immunology7 no. 3 (2000): 451-456.

Buenz, E., D. J. Schnepple, B. A. Bauer, P. L. Elkin, et al. “Techniques: Bio-prospecting Historical Herbal Texts by Hunting for New Leads in OldTomes.” Trends in Pharmacological Sciences 25 no. 9 (2004): 494-498.

Castelain, S., V. Descamps, V. Thibault, C. Francois, et al. “TaqMan AmplificationSystem with an Internal Positive Control for HCV RNA Quantitation.” Journalof Clinical Virology 31 no. 3 (2004): 227-234.

Chapin, K., and M. Musgnug. “Evaluation of Three Rapid Methods for theDirect Identification of Staphylococcus aureus from Positive Blood Cultures.”Journal of Clinical Microbiology 41 no. 9 (2003): 4324-4327.

163BIBLIOGRAPHY

Chu, Lily, and D. K. Robinson. “Industrial Choices for Protein Production byLarge-scale Cell Culture.” Current Opinion in Biotechnology 12 no. 2 (2001):180-187.

Coleman, B. “Some Observations on the New Method Of Receiving the Small Pox by Ingrafting or Inoculating.” Harvard College 1721 [cited December 10, 2004]. http://www.ncbi.nlm.nih.gov/books/bookres.fcgi/history/pdf_colman.pdf.

Dwyer, K., P. J. Cowan, and A. J. F. d’Apice. “Xenotransplantation:Past Achievements and Future Promise.” Heart, Lung and Circulation11 no. 1 (2002): 32-41.

Egger, G., G. Liang, A. Aparicio, and P. A Jones. “Epigenetics in Human Disease and Prospects for Epigenetic Therapy.” Nature 429 no. 6990 (2004): 457-463.

Emery, D. W. 2004. “Gene Therapy for Genetic Diseases: On the horizon.”Clinical and Applied Immunology Reviews, In Press.

Evans, W., and M. V. Relling. “Moving Towards Individualized Medicine withPharmacogenomics.” Nature 429 no. 6990 (2004): 464-468.

Fenwick, S. “Bioprospecting or Biopiracy?” Drug Discovery Today 3 no. 9(1998): 399-402.

Ferrer, M., H. Thorsteinsdottir, U. Quach, P. A. Singer, et al. “The ScientificMuscle of Brazil’s Health Biotechnology.” Nature Biotechnology 22 (Supplement December 2004): DC8-DC12.

Fire, A., S. Xu, M. K. Montgomery, S. A. Kostas, et al. “Potent and SpecificGenetic Interference by Double-stranded RNA in Caenorhabditis elegans.”Nature 391 no. 6669 (1998): 806-811.

Fitzpatrick, A. “Ethics and Animal Research.” Journal of Laboratory and ClinicalMedicine 141 no. 2 (2003): 89-90.

Fortina, P., S. Surrey, and L. J. Kricka. “Molecular Diagnostics: Hurdles for Clinical Implementation.” Trends in Molecular Medicine 8 no. 6 (2002):264-266.

Gavin, P., and R. B. Thomson, Jr. “Review of Rapid Diagnostic Tests forInfluenza.” Clinical and Applied Immunology Reviews 4 no. 3 (2004):151-172.

BIBLIOGRAPHY164

Geisse, S., H. Gram, B. Kleuser, and H. P. Kocher. “Eukaryotic Expression Systems: A Comparison.” Protein Expression and Purification 8 no. 3 (1996):271-282.

Gerecht-Nir, S., and J. Itskovitz-Eldor. “The Promise of Human EmbryonicStem Cells.” Best Practice & Research Clinical Obstetrics & Gynaecology18 no. 6 (2004): 843-852.

Greenwald, R., Y. H. Choe, J. McGuire, and C. D. Conover. “Effective Drug Delivery by PEGylated Drug Conjugates.” Advanced Drug Delivery Reviews55 no. 2 (2003): 217-250.

Groopman, J. 1998. “Decoding Destiny: Genetic Testing.” The New Yorker(February 9, 1998): 42.

Herzog, E.L., L. Chai, and D. S. Krause. “Plasticity of Marrow-derived StemCells.” Blood 102 no. 10 (2003): 3483-3493.

Hulse, J.H. “Biotechnologies: Past History, Present State and Future Prospects.”Trends in Food Science & Technology 15 no. 1 (2004): 3-18.

Janeway, C.A., P. Travers, M. Walport, and M. Shlomchik. Immunobiology.6th ed. New York, NY: Garland Press, 2004.

Katsoulidou, A., E. Papachristou, M. Petrodaskalaki, V. Sypsa, et al. “Comparisonof Three Current Viral Load Assays for the Quantitation of HumanImmunodeficiency Virus Type 1 RNA in Plasma.” Journal of VirologicalMethods 121 no. 1 (2004): 93-99.

Keku, T. O., T. Rakhra-Burris, and R. Millikan. “Gene Testing: What the Health Professional Needs to Know.” Journal of Nutrition 133 no. 11 (2003):3754S-3757.

Kurreck, J. “Antisense Technologies: Improvement through Novel ChemicalModifications.” European Journal of Biochemistry 270 no. 8 (2003):1628-1644.

Lewin, A. S., and W. W. Hauswirth. “Ribozyme Gene Therapy: Applications forMolecular Medicine.” Trends in Molecular Medicine 7 no. 5 (2001): 221-228.

Lloyd-Evans, M. “Regulating Tissue Engineering.” Materials Today 7 no. 5(2004): 48-55.

Mayhall, E. A., N. Paffett-Lugassy, and L. I. Zon. “The Clinical Potential of StemCells.” Current Opinion in Cell Biology 16 no. 6 (2004): 713-720.

165BIBLIOGRAPHY

Muul, L. M., L. M. Tuschong, S. L. Soenen, G. J. Jagadeesh, et al. “Persistenceand Expression of the Adenosine Deaminase Gene for 12 years and ImmuneReaction to Gene Transfer Components: Long-term Results of the First ClinicalGene Therapy Trial.” Blood 101 no. 7 (2003): 2563-2569.

Ogata, K., and J. L. Platt. “Potential Applications and Prospects for Cardiac Xenotransplantation.” The Journal of Heart and Lung Transplantation23 no. 5 (2004): 515-526.

Perkins, J. 2001. “Genetic Discrimination and Taking Sides Over Privacy.”San Diego Union-Tribune (June 29, 2001): B-7.

Peterson, R. K. D., and C. J. Arntzen. “On Risk and Plant-based Miopharma-ceuticals.” Trends in Biotechnology 22 no. 2 (2004): 64-66.

Ray, Arghya, and B. Norden. “Peptide Nucleic Acid (PNA): Its Medical and Biotechnical Applications and Promise for the Future.” FASEB Journal14 no. 9 (2000): 1041-1060.

Robinson, R. “RNAi Therapeutics: How Likely, How Soon?” PLoS Biology2 no. 1 (2004): e28.

Sachs, L. “The Control of Hematopoiesis and Leukemia: From Basic Biology to the Clinic.” Proceedings of the National Academy of Sciences 93 no. 10(1996): 4742-4749.

Shufaro, Y., and B. E. Reubinoff. “Therapeutic Applications of Embryonic Stem Cells.” Best Practice & Research Clinical Obstetrics & Gynaecology18 no. 6 (2004): 909-927.

Sioud, M. “Therapeutic siRNAs.” Trends in Pharmacological Sciences 25 no. 1(2004): 22-28.

Stender, H., M. Fiandaca, J. J. Hyldig-Nielsen, and J. Coull. 2002. “PNA for Rapid Microbiology.” Journal of Microbiological Methods 48 no. 1 (2002):1-17.

Swartz, J. R. “Advances in Escherichia Coli Production of Therapeutic Proteins.”Current Opinion in Biotechnology Vol. 12 no. 2 (2001): 195-201.

Szilvassy, S. J. “The Biology of Hematopoietic Stem Cells.” Archives of MedicalResearch 34 no. 6 (2003): 446-460.

Tamm, I., B. Dorken, and G. Hartmann. 2001. “Antisense Therapy in Oncology:New Hope for an Old Idea?” The Lancet 358 no. 9280 (2001): 489-497.

BIBLIOGRAPHY166

Verma, I.M. 2002. “Biopiracy: Distrust Widens the Rich-Poor Divide.” MolecularTherapy 5 no. 2 (2002): 95.

Wagers, A.J., R.I. Sherwood, J. L. Christensen, and I. L. Weissman. “Little Evidence for Developmental Plasticity of Adult Hematopoietic Stem Cells.”Science 297 no. 5590 (2002): 2256-2259.

Walsh, G. “Second-generation Biopharmaceuticals.” European Journal ofPharmaceutics and Biopharmaceutics 58 no. 2 (2004): 185-196.

Weissig, V., S-M. Cheng, and G. G. M. D’Souza. “Mitochondrial Pharmaceutics.”Mitochondrion 3 no. 4 (2004): 229-244.

167BIBLIOGRAPHY

Alberts, B. J. Alexander, J. Lewis, M. Raff, et al. Molecular Biology of the Cell4th Edition. New York, NY: Garland Publishing, 2002.

Anonymous “DNA’s Detective Story: Case History.” The Economist (March 2004).

Drlica, K. Double-Edged Sword: The Promises and Risks of the Genetics Revolution.Reading, MA: Addison-Wesley Publishing Company, 1994.

Drlica, K. Understanding DNA and Gene Cloning. New York, NY: John Wiley &Sons, 1997.

Gonick, L. M. W. The Cartoon Guide to Genetics. New York, NY: Harper Perennial, 1991.

Grace, E. S. Biotechnology Unzipped. Washington, DC: Joseph Henry Press,1997.

Janeway, C. A., P. Travers, Mark Walport, and M. Shlomchik. Immunobiology.New York, NY: Garland Press, 2004.

Kolata, G. Clone, The Road to Dolly, and the Path Ahead. New York, NY:William Morrow and Company, 1998.

Pollack, R. Signs of Life: The Language and Meanings of DNA. Boston, MA:Houghton Mifflin, 1994.

Reichhardt, T., D. Cyranoski, et al. “Religion and Science: Studies of Faith.”Nature 432 no. 7018 (2004): 666-669.

Schacter, Bernice. Issues and Dilemmas of Biotechnology: A Reference Guide.Westport, CT: Greenwood Press, 1998.

FURTHER READING168

American Society of Gene Therapyhttp://www.asgt.org/

BioTeachhttp://www.bioteach.ubc.ca/index.htm

Biotechnology Industry Organizationhttp://www.bio.org/

CancerQuesthttp://www.cancerquest.org/

Clinical Trialshttp://clinicaltrials.gov/ct

Food and Drug Administrationhttp://www.fda.gov/

Lab Tests onlinehttp://www.labtestsonline.org/index.html

National Institutes of Healthhttp://www.nih.gov

U.S. Department of Justice on DNA evidencehttp://www.ojp.usdoj.gov/ovc/publications/bulletins/dna_4_2001/

169WEBSITES

ABO blood groups, 107–8, 123, 149–50incompatibility, 127

ADA. See Adenosine deaminaseAdenosine deaminase (ADA), 89–90, 149Adenoviruses, 87, 89, 99, 149Adverse events, 93, 149Allergic reactions, 39, 149Amino acids, 59, 149

sequence, 3–4, 8, 49–50, 52, 158Anemia

aplastic, 113treatment, 72

Angiogenesis, 99–101, 149Antibiotics, 149, 158

discovery, 22, 28–33, 145Antibodies

monoclonal, 56–57, 74–75, 77–78,80–82, 124, 130–33, 145, 157

production, 37–38, 55–60, 63, 81, 107,123, 128, 149, 157

Antigen, 98, 149Antisense, 149

use of, 101, 104–5Antitoxins, 38, 149Antivenoms, 38, 149Apoptosis, 99, 149Arthritis, 64, 96, 138Aspirin

discovery, 22–23, 29Autoimmune diseases, 149

diseases, 74, 76, 137, 156

Bacillus thuringiensis, 146Bacteria, 37Bacteriophage, 12, 150Bacterium, 28, 150

discovery, 145and disease, 43, 47–48, 78, 80, 91, 105,

153, 155DNA, 48engineering, 8, 12–14, 16–17

and fermentation, 2functions, 47–48, 157–58human gene in, 146prevention of growth, 28–31recombinant, 45, 47–48, 52, 54, 147research, 4, 8, 15treatment of sewage, 145

Banting, Frederick, 40, 52Bases, 21, 101, 150

complementary, 6, 151modified, 6–7pair formation, 8–10, 132, 137, 152–53triplet of, 7

Basophils, 70, 150Best, Charles, 40Biologics Control Act, 38Biopesticide, 145Biotechnology, 46, 150

defined, 1–21, 145development, 22–33ethical issues, 64–65history of, 145–48prices, 64–65testing, 45–46, 48, 52, 54, 61–63, 68, 74,

77, 79, 82, 110, 128, 130, 133, 144,154

Blastocyst, 18–19, 150Blood

cell production, 67–72, 83–85, 108, 110,113, 154

clotting, 66–67, 73, 109, 150disorders, 109transfusions, 84, 106–10, 119, 123, 149–50

Bone marrow, 68, 150–51transplant, 91–92, 109, 116, 127

Bovine somatotropin (BST), 147Bovine spongiform encephalopathy, 43,

150, 156BRCA. See Breast cancer genesBreast cancer genes (BRCA), 135, 150Bush, George W., 111

INDEX170

Cancer, 151cells, 55–56, 74, 80–81, 96–98, 101–2,

105, 131, 141, 143research, 79treatment, 8, 27, 72–73, 76, 79–82, 85,

91, 96–105, 113, 135, 147, 150–51,154, 158

types, 55, 79–80, 99, 101, 134–36, 141,150

Cell fusion, 56, 151Cephalosporin, 28Cerebroside, 62, 151Chain, Ernst, 32Chemotherapy

and cancer treatment, 73, 79, 91, 98,123, 113, 151, 158

Chicken pox, 35, 104vaccination, 84

Chloroplasts, 14, 151Chromosomes, 151–52

discovery of, 3, 19, 145disorders of, 66, 89, 103structures, 3–4

Clinical trials, 27, 151and children, 94and gene therapy, 84–85, 87, 89–90,

92–93, 96, 99, 101, 105, 116, 154protocols, 26, 93, 159

Cloninganimals and plants, 16–20, 147–48cells, 15–16, 56, 151genes, 15, 146human, 111reproductive, 19–20, 159therapeutic, 160

CODIS. See Combined DNA Index System

Collins, Francis, 138Collip, J.B., 40Combined DNA Index System (CODIS),

140, 151

Corticosteroids, 123, 151Cowpox, 35–36, 151Creutzfeldt-Jakob disease (vCJD), 42–43,

152Crick, Francis

research of, 4, 84, 145, 153Crohn’s disease, 77, 151Crown Gall disease, 16–17Cyclosporine, 124, 152Cystic fibrosis, 85

causes, 90, 152Cytomegalovirus, 125

Darwin, Charles, 145Deoxyribonucleic acid (DNA), 158

and common illnesses, 137–38discovery, 4–8forensic testing, 139–40, 146genetic information, 1, 4, 8, 14, 18–21,

81, 145, 149–52, 156ligase, 12–13, 152marker tests, 138–41microarray, 141–44, 152plasmid, 13polymerase, 6, 11, 153recombinant, 48, 52, 45, 159research, 11–12, 18, 20, 84, 100–4sequence, 5–6, 9–10, 15, 20, 49–50, 84,

86–89, 132–34, 137, 139, 145, 152,154–55, 159

structure, 4–8, 84, 145, 152Diabetes, 39, 111, 152

treatment, 39–40, 47, 61, 117, 132Dialysis, 124, 152Differentiation, 71, 111, 152Digitalis

discovery, 23–25, 152Diphtheria, 37–38, 55, 80Dominant, 135, 153–54Double-blind test, 26, 153Double helix, 4, 152–53

171INDEX

DNA. See Deoxyribonucleic acidDwarfism, 85

Embryonic stem cell (ES), 153production, 111, 114, 148research, 18–19, 116–19

Enzyme, 14, 99, 101, 147, 153defects, 147proteins, 49–50, 52, 54, 62, 78replacement, 62–64restrictions, 13

Eosinophil, 70, 153Ereky, Karl, 145Erythrocytes. See Red blood cellsErythropoietin

production, 70, 72–73ES. See Embryonic stemEscherichia coli, 47, 53, 153

and human insulin, 48, 60and infection fighting drugs, 73,

75–76, 79Eukaryotic cells, 14, 53, 153, 157

Familial adenomatous polyposis, 134,136, 153

FDA. See Food and Drug AdministrationFermentation

defined, 1–2, 145, 153Fibrin, 78, 109, 115, 153FlavrSavr, 147Fleming, Alexander

discovery of penicillin, 28, 30–32, 145Fleming, Walther

discovery of chromosomes, 145Florey, Howard, 32Food and Drug Administration (FDA), 154

and drug approval, 26–27, 60, 62, 65,84, 91–94, 104, 146–47

and lab test approval, 132Forensic, 154

testing, 138, 140, 146

Frostban, 147Fungi, 28

and disease, 43, 154

Gaucher disease, 62–64, 151, 154Gelsinger, Jesse, 92–93, 95, 147Gene, 2, 98, 102, 135

chip, 154cloning, 15code, 145defined, 4–5and DNA, 1, 8–10, 18–21, 145, 149–51,

156engineering, 2–3, 8–21, 44, 50, 52–54,

56–57, 62, 68, 75, 99, 148, 150, 152,154, 156, 158–59

gun, 16map, 147mutation, 135–36, 157sequence, 5, 7–9, 73, 128, 137, 144, 148tests, 138–39, 146, 154–55

Gene therapy, 83–105, 134, 147–48, 152,154case study, 83–85problems with, 89–90unintended consequences of, 91–95vectors, 86–89

German measles (rubella), 35Germ cells, 20, 154Getty, Jeff, 127Graft versus host disease, 113, 154Growth hormone, 85, 102, 155

older treatments for, 62use of human, 39–43, 61–63, 147

Harvey, William, 106Heart disease, 117, 138

treatment, 78–79, 111Hematopoietic stem cell, 70–71, 113,

150, 155Hemoglobin, 110, 153, 155, 159

INDEX172

Hemophilia, 155treatment, 65–67, 108

Hepatitis, 125treatment, 75–78types, 108, 156

HIV/AIDS, 65, 84, 125, 149, 155and blood transfusions, 67, 105, 108,

119identification, 146testing, 131–32, 150

Hormones, 14, 16, 39, 41–42, 131Human genome project, 86, 138, 147, 155

sequence, 148Huntington disease, 134–36, 155Hybridomas, 56–57, 155Hyperacute rejection, 123, 155

Immune deficientchildren, 84–85, 89–92

Immune system, 35, 155defects, 84–85, 89–92, 118, 148, 151,

155, 157drugs, 74–78functions, 37–38, 54–56, 62, 70, 73–77,

80, 98, 104–5, 118, 131, 149, 154,156, 159

and gene therapy, 84–85, 91, 96, 98–101research, 74response to transplants, 121, 123–25,

128Immunization, 35, 37, 56, 155Immunosuppressive drugs, 123–25, 152,

155Infectious disease, 155

types, 43Inflammation, 92, 150, 156–57, 159

suppression, 76–77Influenza, 131Informed consent, 27, 156Inoculation, 156

for small pox, 34–35, 145

Insulin, 118, 156animal, 39, 42, 48, 52, 61human, 45, 50, 52, 60–61, 63, 146use of, 39–40, 48–50, 55, 61, 132,

145–46, 158Interferons, 75–76, 79, 147, 156Irradiation, 113, 156Islets of Langerhans, 40, 48, 156

Jeffreys, Alec, 146Jenner, Edward

and cowpox, 35–36, 145

Kohler, Georgesresearch of, 55–56

Leukemia, 80, 85, 91, 95Lymphocytes, 37, 71, 81, 91, 156

killer, 123–24, 128

MacLeod, J.J.R., 40, 145Macrophages, 63, 154, 156Mad cow disease. See Bovine spongiform

encephalopathyMalaria, 25, 131, 156MAPC. See Multipotent adult progenitor

cellMedicinal properties, 23, 156Mendel, Gregor

research of, 3, 145Microbe, 38, 59, 157Microorganisms, 155–57

breakdown of, 1research, 23, 29, 32, 37

Milliliter, 132, 157Milstein, Cesar, 55–56Minbodies, 58, 157Mitochondria, 14, 157Molds, 28, 155, 157Monocytes, 71Mononucleosis, 104

173INDEX

Morphine, 23, 157Mullis, Kary

research of, 10–11, 146Multiple sclerosis, 64, 74, 96, 111, 117,

149, 157Multipotent adult progenitor cell

(MAPC), 115, 157Muromonab, 74Myelin, 75, 157

National Institutes of Health (NIH), 42,94

Natural productscures for ancient diseases, 22–23, 145as drugs, 22–33, 145

Neutrophils, 70, 157NIH. See National Institutes of HealthNucleus, 3, 14, 20, 70, 148, 157

Oncogenes, 96–97, 99, 151, 157Organ transplantation

ethical issues, 126from non-primates, 127–29from primates, 124–25rejection, 124, 161risks, 123successes and failures, 121–25

Ornithine transcarbamylase (OTC), 92,157

OTC. See Ornithine transcarbamylaseOvary, 25, 158

Pancreascells, 39–40, 48, 90, 117, 152, 156, 158

Parkinson’s disease, 111, 116, 158Pasteur, Louis

and microbe theory, 32, 145PCR. See Polymerase chain reactionPenicillin, 158

discovery, 28, 30, 32, 55, 145Peptides, 48, 158

Pertussis. See Whooping coughPituitary gland, 40–41, 158Placebo, 26, 158Placentas, 63, 158Plasma, 67, 132, 158Plasmid, 10, 17, 146, 158

DNA, 12–13, 15–16, 49, 86Platelets, 158

production, 70–71, 73, 108–9Pluriopotent, 114, 116, 158Poliovirus, 35Polymerase chain reaction (PCR), 134, 158

discovery, 146process, 10–11, 15, 132, 141

Polypeptides. See ProteinsPrecursor cells 70, 73Primer, 6–7, 11, 158Prion, 43, 156, 159Promoter, 10, 50, 159Proteins, 141, 149, 152, 158–59

in the blood, 37, 53–54, 86, 113changing, 48–50and disease, 47, 62, 90, 118factories, 45–47, 84, 111, 131factors, 71functions, 3, 38–39, 43–44, 49replacement, 62–64, 66, 68shape, 50–52, 84and sugar production, 52–53, 158–59synthesis, 3–6, 7–8, 12, 14–16,

18, 48–54, 55–61, 69–70, 72–73,75, 77–80, 91, 109, 153, 155–56,159

Proteome, 159Prusiner, Stanley, 43

Quinine, 23, 159

RE. See Restriction endonucleasesReceptor, 50–52, 54, 159

growth-factor, 68–69

INDEX174

Recessive, 135, 154, 159Recombinant components

DNA, 52, 145, 159and lab testing, 47, 130–44

Recombinant drugs, x, 159complications, 62, 147and infection, 73production systems, 54–60, 72–73,

76–82, 84types, 45–60, 84, 146–47uses, 61–82

Recombinant fooddiscovery, 147

Red blood cells, 153, 159production, 68, 70–73, 108–10

Reproductive cloning, 19–20, 159Restriction endonucleases (RE), 8–10,

15, 159Retroviruses, 87, 159Rheumatoid arthritis, 159

treatment, 74, 76–77, 149Ribosomes, 7, 160Ribozymes, 104–5, 160RNA, 5, 101–2, 104–5

messenger, 7–8, 141, 143, 156testing, 132transfer, 7, 160viruses, 128

Rubella. See German measles

Serum, 38, 160Severe combined immunodeficiency, 84,

160Silva, Ashanti de, 83–85, 89–90Single nucleotide polymorphisms, 137,

160siRNA. See Small interfering RNASmall interfering RNA (siRNA), 105, 160Smallpox, 34–35, 151, 160SNT. See Somatic nuclear transferSomatic cells, 20, 118, 160

Somatic nuclear transfer (SNT), 20, 118,160

Spinal cord injuries, 117Starzl, Thomas, 127Stem cells, 110, 160

adult, 114–17, 119, 148–49blood-forming, 113multitalented, 113–16research, 18–19, 111, 113, 120, 149research challenge, 113, 117therapy, 116–17, 150

Taxol®, 25, 160T cells, 160

and disease, 89–90killer, 123–24preventing action of, 74–75, 79

Therapeutic cloning, 118, 160TNF. See Tumor necrosis factorTools and methods, Biotechnology

development, 2–4medelian genetics, 2–4

Totipotent, 114, 160Toxins, 38, 160Traits, 3Transcription, 5Transgene, 18–19, 161Transgenic animal, 161

first, 18–19, 146Transgenic plants

testing of, 146Translation, 5Transmissible spongiform

encephalopathies (TSE), 43, 152, 156,161

TSE. See Transmissible spongiformencephalopathies

Tuberculosis, 32–33Tumor

cells, 25, 56–57, 74, 80–81, 97–99,101–2, 105, 131, 141, 155, 161

175INDEX

Tumor necrosis factor (TNF), 76–77, 161Tumor suppressor genes, 97–99, 102, 161

Vaccination, 161forms, 77–78, 84, 97process of, 35–38

vCJD. See Creutzfeldt-Jakob diseaseVectors, 10, 161

functions, 86–90, 92–93, 99, 101types, 12, 14, 16, 18

Viruses, 12, 146, 161and disease, 43, 91, 99, 104, 125,

128–29, 151, 155–56, 159genetic information, 12, 75–76, 132and treatment of diseases, 8, 14,

83–84, 86–89, 150

Watson, Jamesresearch of, 4, 84, 145, 153

White blood cells, 68, 161production, 72–73, 75, 81, 91, 108,

150, 153, 156–57Whooping cough (pertussis), 37WHO. See World Health OrganizationWilkins, Maurice, 4World Health Organization (WHO),

37

Xenotransplantation, 124, 126–28, 162X-linked severe combined immune

deficiency (X-SCID), 91, 162X-SCID. See X-linked severe combined

immune deficiency

INDEX176

5: © Peter Lamb9: © Peter Lamb

11: © Peter Lamb13: © Peter Lamb17: © Bill Beatty/Visuals Unlimited19: © Peter Lamb24: © Sandi and Bill Langley/

Index Stock Imagery, Inc.30: Library of Congress31: (top) © Peter Lamb31: (bottom) © Mediscan/

Visuals Unlimited36: © Bettmann/CORBIS41: © Peter Lamb46: Associated Press, AP/Paul Sakuma49: © CORBIS51: © Peter Lamb

57: © Peter Lamb59: © Peter Lamb69: © Peter Lamb71: © Peter Lamb88: © Peter Lamb97: © 21st Century Publishing

100: © Peter Lamb103: © Peter Lamb107: © Peter Lamb109: © Dr. Robert Caughey/

VisualsUnlimited112: © Peter Lamb122: © Bettmann/CORBIS142: © Science VU/NCI/

Visuals Unlimited143: Associated Press Graphics

page:

177PICTURE CREDITS

Activase is a registered trademark of Genentech, Inc.; Aranesp is a registered trademark ofAmgen, Inc.; Avastin is a registered trademark of Genentech, Inc.; Avonex is a registeredtrademark of Biogen Idec; Betaseron is a registered trademark of Berlex Laboratories, Inc.;Comvax is a registered trademark of Merck & Co., Inc.; Embrel is a registered trademark ofWyeth Pharmaceutical Products; Enerix-B is a registered trademark of GlaxoSmithKline;Epogen is a registered trademark of Amgen, Inc.; Erbitux is a registered trademark ofImClone Systems Incorporated; Herceptin is a registered trademark of Genentech, Inc.;Humira is a registered trademark of Abbott Laboratories; Intron-A is a registered trademarkof Schering Corporation; Leukine is a registered trademark of Berlex Laboratories, Inc.;Mylotarg is a registered trademark of Wyeth Pharmaceutical Products; Neulasta is a registeredtrademark of Amgen, Inc.; Neumega is a registered trademark of Wyeth PharmaceuticalProducts; Neupogen is a registered trademark of Amgen, Inc.; Ontak is a registered trademarkof Ligand Pharmaceuticals; Orthoclone OKT3 is a registered trademark of Ortho BiotechProducts, L.P.; Pediatrix is a registered trademark of GlaxoSmithKline; Pegasys is a registeredtrademark of Hoffman-La Roche, Inc.; Peg-INTRON is a registered trademark of ScheringCorporation; Procrit is a registered trademark of Ortho Biotech Products, L.P.; Proleukin is aregistered trademark of Chiron Corporation; Rebit is a registered trademark of Serono, Inc.,and Pfizer, Inc.; Recombivax HB is a registered trademark of Merck & Co., Inc.; Remicade isa registered trademark of Centocor, Inc.; ReoPro is a registered trademark of Centocor, Inc.;Rituxin is a registered trademark of Genentech, Inc.; Roferon-A is a registered trademark ofHoffman-La Roche, Inc.; Simulect is a registered trademark of Novartis PharmaceuticalCorporation; Taxol is a registered trademark of Bristol-Myers Squibb Company; Twinrix is aregistered trademark of GlaxoSmithKline; VIOXX is a registered trademark of Merck & Co.,Inc.; Vitravene is a registered trademark of ISIS Pharmaceuticals; Zenepax is a registeredtrademark of Roche Pharmaceuticals.

BERNICE ZELDIN SCHACTER, Ph.D., has over 25 years of biomedicalresearch experience in both academia and industry. She was awarded aPh.D. from Brandeis University and completed postdoctoral training atthe Lawrence Radiation Laboratory at the University of California atBerkeley and the University of Miami. She served on the faculty of theSchool of Medicine at Case Western Reserve University and conductedimmunology research at Bristol-Myers Squibb Company. She also servedas vice president of research at BioTransplant, Inc., a biotechnologystartup company in Boston, Massachusetts. She has published more than50 papers in peer-reviewed journals and is a coinventor on 4 issuedpatents. Since 1994, she has been a biomedical consultant and writer,authoring Issues and Dilemmas in Biotechnology (Greenwood Press, 1999).She is currently working on a general audience book on the developmentof new medicines to be published in 2005. She has taught immunology toundergraduate, graduate, and medical students. She also has developedand offered biotechnology courses for liberal studies students at WesleyanUniversity in Connecticut and at the University of Delaware.

ABOUT THE AUTHOR178

biotechnology and your health

Documents