biological weapons a counterterrorism perspective university of california lawrence livermore...
TRANSCRIPT
![Page 1: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader](https://reader035.vdocuments.us/reader035/viewer/2022070410/56649f215503460f94c39719/html5/thumbnails/1.jpg)
Biological WeaponsA Counterterrorism Perspective
University of CaliforniaLawrence Livermore National Laboratory
J. Patrick Fitch, Ph.D.Program Leader
Chemical & Biological National Security
October 19, 2005
UCRL-PRES-151152 Version 051019
For additional information contact J.P. Fitch at [email protected]
This work was performed under the auspices of the U.S. Department of Energy by the University of California, Lawrence Livermore National Laboratory under Contract No. W-7405-Eng-48.
![Page 2: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader](https://reader035.vdocuments.us/reader035/viewer/2022070410/56649f215503460f94c39719/html5/thumbnails/2.jpg)
Lawrence Livermore National Laboratory 2
The public is exposed to a lot of information about potential biological attacks
Initiation of BioWatch at the State of the Union on January 28, 2003: “…deploying the nation's first early warning network of sensors to detect biological attack”
What are the key issues around BW and BW defense? What are distractions?
What are the key issues around BW and BW defense? What are distractions?
![Page 3: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader](https://reader035.vdocuments.us/reader035/viewer/2022070410/56649f215503460f94c39719/html5/thumbnails/3.jpg)
Lawrence Livermore National Laboratory 3
Biosecurity is a multifaceted problem that requires integrating many disparate components
Link all of these components into a coherent architecture
Link all of these components into a coherent architecture
Vaccines• Development• Efficacy• Deployment
Pathogen biology• Infectivity• Signatures• Manipulation
Data• Collections• All source• Directed
discovery
Validation• Signatures• Assays• Processes• Chain-of-custody
Threats• Weaponized• GM• Individual• State sponsored
Epidemiology• Early detection• Privacy
Interpretation• Feasibility• Intent
Backgrounds• Natural• Manufacturing
Surveillance• Sensitivity• Specificity• Response
ThreatAssessments
S&T
Knowledge Management
Biosecurity ComponentsAnticipate Prepare Prevent Detect Response Attribute
![Page 4: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader](https://reader035.vdocuments.us/reader035/viewer/2022070410/56649f215503460f94c39719/html5/thumbnails/4.jpg)
Lawrence Livermore National Laboratory 4
We would like to know even more!
BW attacks sound scary Genetically modified threat Bio Terror & Bio Error
“Mother Nature” as terrorist Re-emergent diseases Influenza
Discovery of 5 virulence-associated signatures
Northern Arizona University studenttesting prairie dog colony
![Page 5: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader](https://reader035.vdocuments.us/reader035/viewer/2022070410/56649f215503460f94c39719/html5/thumbnails/5.jpg)
Lawrence Livermore National Laboratory 5
Dif
ficu
lty
Impact
Endemic
CleverUse
Modified• Genetic mods• Weaponized
The human and economic impact of endemic pathogens can be amplified
The systems-level challenge is to counter numerous potential threats
The systems-level challenge is to counter numerous potential threats
![Page 6: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader](https://reader035.vdocuments.us/reader035/viewer/2022070410/56649f215503460f94c39719/html5/thumbnails/6.jpg)
Lawrence Livermore National Laboratory 6
A stratified view of bioterrorist threats
Level II (1000 – 10,000)
Level I (1 – 1000)
Level III (>10,000)
• Scale?
To Prevent
To Protect
To Treat & / or Isolate
• Detect?
Contagious
Non-Contagious
Treatable (Plague)
Non-Treatable (Ebola)
Treatable (Anthrax)
Non-Treatable (EEV)
• Agent?AerosolFood supplyWater supplyCarrier
![Page 7: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader](https://reader035.vdocuments.us/reader035/viewer/2022070410/56649f215503460f94c39719/html5/thumbnails/7.jpg)
Lawrence Livermore National Laboratory 7
Looking for solutions: there are significant benefits to early detection of a biological attack
Treatments and quarantines must be administered early
13 to 4Plague
32 to 5Influenza
1 to 25 to 7Pulmonary
Anthrax
3 to 412 to 14Smallpox
Intervention window (days)
Incubation period (days)
Disease
A combination of complementary strategies are needed for early detection
A combination of complementary strategies are needed for early detection
![Page 8: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader](https://reader035.vdocuments.us/reader035/viewer/2022070410/56649f215503460f94c39719/html5/thumbnails/8.jpg)
Lawrence Livermore National Laboratory 8
Contagious
Exposed
Examples for preventing, detecting, and responding to WMD events
Time
Prevent Environmental detection Response and restoration
![Page 9: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader](https://reader035.vdocuments.us/reader035/viewer/2022070410/56649f215503460f94c39719/html5/thumbnails/9.jpg)
Lawrence Livermore National Laboratory 9
Contagious
Exposed
Examples for preventing, detecting, and responding to WMD events
Signatures
Backgrounds
Forensics andattribution
Prevent Environmental detection Response and restoration
![Page 10: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader](https://reader035.vdocuments.us/reader035/viewer/2022070410/56649f215503460f94c39719/html5/thumbnails/10.jpg)
Lawrence Livermore National Laboratory 10
Contagious
Exposed
Examples for preventing, detecting, and responding to WMD events
Signatures
Backgrounds
Forensics andattribution
Detect to prophylax
Detect to warn
Prevent Environmental detection Response and restoration
![Page 11: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader](https://reader035.vdocuments.us/reader035/viewer/2022070410/56649f215503460f94c39719/html5/thumbnails/11.jpg)
Lawrence Livermore National Laboratory 11
Contagious
Exposed
Examples for preventing, detecting, and responding to WMD events
Signatures
Backgrounds
Forensics andattribution
Detect to prophylax
Detect to warn
Epidemiology to treat
Consequencemanagement
Triage Dx
New strategies?
EmergingThreat
Prevent Environmental detection Response and restoration
![Page 12: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader](https://reader035.vdocuments.us/reader035/viewer/2022070410/56649f215503460f94c39719/html5/thumbnails/12.jpg)
Lawrence Livermore National Laboratory 12
Developing new operational capabilities took several years and integration across multiple disciplines
nn
tt NT
Cepheid
Smiths
GACAAAAGCGACAAAGGTTTTGTTCTTGGTCAATCCTCTCCTTTGCACGCCGTGGGACCATAGCTACAGATCACTTTACCTGCG.TGGGTGAACGCCGTGTGCGG
Tech
Genomics
Validated assays
Enablinginstrumentation
![Page 13: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader](https://reader035.vdocuments.us/reader035/viewer/2022070410/56649f215503460f94c39719/html5/thumbnails/13.jpg)
Lawrence Livermore National Laboratory 13
Early detection combined with models of dispersion are valuable
Bio attacks may not be visible Want to act before symptoms present Identify affected area / people / livestock Prophylax, treat and clean-up
BUT timelines are not short enough!
>15- and >150-g/m3 contours
Staten Island Fire(Feb. 21, 2003)
![Page 14: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader](https://reader035.vdocuments.us/reader035/viewer/2022070410/56649f215503460f94c39719/html5/thumbnails/14.jpg)
Lawrence Livermore National Laboratory 14
What community norms can be established, promoted or enforced?
Biological Weapons Convention is intent-based
US offensive BW program terminated in 1969
- ‘Frozen’ perspective on BW
- Recent investments in biodefense
Are BW the “poor man’s” nuke?
- Role of deterrence?
- What value does attribution provide?
- When would a nation turn to BW?
- When would a terrorist group?
- Latency?
Contrast to other areas
- OPCW, for example
Organization for the Prohibition of
Chemical Weapons
![Page 15: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader](https://reader035.vdocuments.us/reader035/viewer/2022070410/56649f215503460f94c39719/html5/thumbnails/15.jpg)
Lawrence Livermore National Laboratory 15
There are critical shortfalls in the nation’s infrastructure for dealing with bio-terrorism Life science R&D exploding
- Inherent “dual benefit”- Proliferating- 1969 out-of-date reference- BWC
Countermeasures not keeping up- Large cost and time from concept
to regulatory approval- Increasing antibiotic and antiviral
resistance- Few novel antibiotics in the
pipeline- Vaccines not commercially
attractive Similar issues in agriculture and
food
Time
L
Lif
e S
cien
ces
Pro
du
ct
Ad
vers
ary
1
Ad
vers
ary
2
Countermeasure
Ca
pab
ility
Countermeasure developers must adopt more rapidly than adversaries
Countermeasure developers must adopt more rapidly than adversaries
![Page 16: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader](https://reader035.vdocuments.us/reader035/viewer/2022070410/56649f215503460f94c39719/html5/thumbnails/16.jpg)
Lawrence Livermore National Laboratory 16
An example of rapid response2003 Exotic Newcastle Disease Virus outbreak
![Page 17: Biological Weapons A Counterterrorism Perspective University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader](https://reader035.vdocuments.us/reader035/viewer/2022070410/56649f215503460f94c39719/html5/thumbnails/17.jpg)
Lawrence Livermore National Laboratory 17
Disclaimer
This document was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor the University of California nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process disclosed, or represents that its use would not infringe privately owned rights.
Reference herein to any specific commercial product, process, or service by trade name, trademark, manufacturer, or otherwise, does not necessarily constitute or imply its endorsement, recommendation, or favoring by the United States Government or the University of California. The views and opinions of authors expressed herein do not necessarily state or reflect those of the United States Government or the University of California, and shall not be used for advertising or product endorsement purposes.
This work was performed under the auspices of the U.S. Department of Energy by University of California, Lawrence Livermore National Laboratory under Contract W-7405-Eng-48.