bioinformatica p4-io

30

Upload: wvcrieki

Post on 11-May-2015

1.440 views

Category:

Education


2 download

DESCRIPTION

Bioinformatics

TRANSCRIPT

Page 1: Bioinformatica p4-io
Page 2: Bioinformatica p4-io

FBW23-10-2012

Wim Van Criekinge

Page 3: Bioinformatica p4-io

Programming

• Variables• Flow control (if, regex …)• Loops

• input/output• Subroutines/object

Page 4: Bioinformatica p4-io

Three Basic Data Types

• Scalars - $• Arrays of scalars - @• Associative arrays of

scalers or Hashes - %

Page 5: Bioinformatica p4-io

• [m]/PATTERN/[g][i][o]• s/PATTERN/PATTERN/[g][i][e][o]• tr/PATTERNLIST/PATTERNLIST/[c][d][s]

Page 6: Bioinformatica p4-io

The ‘structure’ of a Hash

• An array looks something like this:

• A hash looks something like this:

@array =Index

Value

0 1 2

'val1' 'val2' 'val3'

Rob Matt Joe_A

353-7236 353-7122 555-1212

Key (name)

Value%phone =

Page 7: Bioinformatica p4-io

• First, create a list of keys. Fortunately, there is a function for that:– keys %hash (returns a list of keys)

• Next, visit each key and print its associated value:foreach (keys %hash){

print “The key $_ has the value $hash{$_}\n”;}

• One complication. Hashes do not maintain any sort of order. In other words, if you put key/value pairs into a hash in a particular order, you will not get them out in that order!!

Printing a hash (continued)

Page 8: Bioinformatica p4-io

my %AA1 = ( 'UUU','F','UUC','F','UUA','L','UUG','L','UCU','S','UCC','S','UCA','S','UCG','S','UAU','Y','UAC','Y','UAA','*','UAG','*','UGU','C','UGC','C','UGA','*','UGG','W',

'CUU','L','CUC','L','CUA','L','CUG','L','CCU','P','CCC','P','CCA','P','CCG','P','CAU','H','CAC','H','CAA','Q','CAG','Q','CGU','R','CGC','R','CGA','R','CGG','R',

'AUU','I','AUC','I','AUA','I',

'AUG','M','ACU','T','ACC','T','ACA','T','ACG','T','AAU','N','AAC','N','AAA','K','AAG','K','AGU','S','AGC','S','AGA','R','AGG','R',

'GUU','V','GUC','V','GUA','V','GUG','V','GCU','A','GCC','A','GCA','A','GCG','A','GAU','D','GAC','D','GAA','E','GAG','E','GGU','G','GGC','G','GGA','G',

'GGG','G' );

Page 9: Bioinformatica p4-io

• There is more than one right way to do it. Unfortunately, there are also many wrong ways. – 1. Always check and make sure the output is correct and logical

• Consider what errors might occur, and take steps to ensure that you are accounting for them.

– 2. Check to make sure you are using every variable you declare.• Use Strict !

– 3. Always go back to a script once it is working and see if you can eliminate unnecessary steps.

• Concise code is good code. • You will learn more if you optimize your code. • Concise does not mean comment free. Please use as many comments as

you think are necessary. • Sometimes you want to leave easy to understand code in, rather than short

but difficult to understand tricks. Use your judgment. • Remember that in the future, you may wish to use or alter the code you

wrote today. If you don’t understand it today, you won’t tomorrow.

Programming in general and Perl in particular

Page 10: Bioinformatica p4-io

Develop your program in stages. Once part of it works, save the working version to another file (or use a source code control system like RCS) before continuing to improve it.

When running interactively, show the user signs of activity. There is no need to dump everything to the screen (unless requested to), but a few words or a number change every few minutes will show that your program is doing something.

Comment your script. Any information on what it is doing or why might be useful to you a few months later.

Decide on a coding convention and stick to it. For example, – for variable names, begin globals with a capital letter and privates

(my) with a lower case letter – indent new control structures with (say) 2 spaces – line up closing braces, as in: if (....) { ... ... } – Add blank lines between sections to improve readibility

Programming in general and Perl in particular

Page 11: Bioinformatica p4-io

>ultimate-sequenceACTCGTTATGATATTTTTTTTGAACGTGAAAATACTTTTCGTGCT

ATGGAAGGACTCGTTATCGTGAAGTTGAACGTTCTGAATGTATGCCTCTTGAAATGGAAAATACTCATTGTTTATCTGAAATTTGAATGGGAATTTTATCTACAATGTTTTATTCTTACAGAACATTAAATTGTGTTATGTTTCATTTCACATTTTAGTAGTTTTTTCAGTGAAAGCTTGAAAACCACCAAGAAGAAAAGCTGGTATGCGTAGCTATGTATATATAAAATTAGATTTTCCACAAAAAATGATCTGATAAACCTTCTCTGTTGGCTCCAAGTATAAGTACGAAAAGAAATACGTTCCCAAGAATTAGCTTCATGAGTAAGAAGAAAAGCTGGTATGCGTAGCTATGTATATATAAAATTAGATTTTCCACAAAAAATGATCTGATAA

Page 12: Bioinformatica p4-io

File input / output

Opening a filehandle• In order to use a filehandle other than STDIN,

STDOUT and STDERR, the filehandle needs to be opened. The open function opens a file or device and associates it with a filehandle.

• It returns 1 upon success and undef otherwise. Examples• # open a filehandle for reading: open

(SOURCE_FILE, "filename"); • # or open (SOURCE_FILE, "<filename"); • # open a filehandle for writing: open (RESULT_FILE,

">filename"); • # open a filehandle for appending: open (LOGFILE,

">>filename";

Page 13: Bioinformatica p4-io

File input / output

Closing a filehandle• When you are finished with a filehandle, you

may close it with the close function. The close function closes the file or device associated with the filehandle.

Example:• close (MY_FILE_HANDLE); Filehandles are

automatically closed when the program exits, or when the filehandle is reopened.

Page 14: Bioinformatica p4-io

File input / output

The die function• Sometimes the open function fails. For example, opening a file

for input might fail because the file does not exist, and opening a file for output might fail because the file does not have a write permission. A perl program will nevertheless use the filehandle, and will not warn you that all input and output activities are actually meaningless.

• Therefore, it is recommended to explicitly check the result of the open command, and if it fails to print an error message and exit the program.

• This is easily done using the die function. Example:• my $k = open (FILEHANDLE, "filename"); unless ($k) { die

("cannot open file filename: $!"); } # in case file "filename" cannot be opened, # the argument of die will be printed on # the screen and the program will exit. # $! is a special variable that contains the respective # error message sent by the operating system.. A short hand:

• open (FILEHANDLE, "filename") || die "cannot open file filename: $!";

Page 15: Bioinformatica p4-io

Using filehandles for writing

Example:#!/usr/local/bin/perl use strict; use warnings; open (OUTF, ">out_file") || die "cannot open out_file:

$!"; open (LOGF, ">>log_file") || die "cannot open log_file: $!";

print OUTF "Here is my program output\n"; print LOGF "First task of my program completed\n"; print "Nice, isn't it?\n"; # will be printed on the screen

close (OUTF); close (LOGF);

Page 16: Bioinformatica p4-io

When <FILEHANDLE> is assigned into an array variable, all lines up to the end of the file are read at once. Each line becomes a separate element of the array.

#!/usr/local/bin/perluse strict;use warnings;

my $infile = "CEACAM3.txt";open (FH, $infile) || die "cannot open \"$infile\": $!";my @lines = <FH>;chomp (@lines); # chomp each element of @linesclose (FH);

# to process the lines you might wish to iterate# over the @lines array with a foreach loop:my $line;foreach $line (@lines) { # process $line. here we just print it. print "$line\n";}

Using filehandles for reading (2/3)

Page 17: Bioinformatica p4-io

#!/usr/local/bin/perluse strict;use warnings;

my $infile = "CEACAM3.txt";my ($line1, $line2, $line3);

open (FH, $infile) || die "cannot open \"$infile\": $!";

$line1 = <FH>; # read first lineprint $line1; # proccess line (here we only print it)$line2 = <FH>; # read next lineprint $line2; # proccess line (here we only print it)$line3 = <FH>; # read next lineprint $line3; # proccess line (here we only print it)

close (FH);

Using filehandles for reading (1/3)

Page 18: Bioinformatica p4-io

Using a while loop, read one line at a time and assign it into a scalar variable, as long as the variable is not an empty string (which will happen at end-of-file).

Note that a blank line read from the file will not result in an empty string, since it still contains the terminating \n.

#!/usr/local/bin/perluse strict;use warnings;

my $infile = "CEACAM3.txt";open (FH, $infile) || die "cannot open \"$infile\": $!";

my $line; # or, in one line:while ($line = <FH>) { # while (my $line = <FH>) { chomp ($line); print "$line\n"; # process line. here we just print it. }

close (FH);

Using filehandles for reading (3/3)

Page 19: Bioinformatica p4-io

• Demo: Prosite Parser

Page 20: Bioinformatica p4-io

1. Swiss-Knife.pl

• Database – http://www.ebi.ac.uk/swissprot/FTP/ftp.html

– How many entries are there ?– Average Protein Length (in aa and MW)– Relative frequency of amino acids

• Compare to the ones used to construct the PAM scoring matrixes from 1978 – 1991

Page 21: Bioinformatica p4-io

Amino acid frequencies

1978 1991L 0.085 0.091A 0.087 0.077G 0.089 0.074S 0.070 0.069V 0.065 0.066E 0.050 0.062T 0.058 0.059K 0.081 0.059I 0.037 0.053D 0.047 0.052R 0.041 0.051P 0.051 0.051N 0.040 0.043Q 0.038 0.041F 0.040 0.040Y 0.030 0.032M 0.015 0.024H 0.034 0.023C 0.033 0.020W 0.010 0.014

Second step: Frequencies of Occurence

Page 22: Bioinformatica p4-io

Parser.pl• #! C:\Perl\bin\perl.exe -w• # (Vergeet niet het pad van perl.exe hierboven aan te passen aan de plaats op je eigen computer)

• # Voorbeeld van het gebruik van substrings en files• # in een parser van sequentie-informatie-records

• use strict;• use warnings;

• my ($sp_file,$line,$id,$ac,$de);

• $sp_file= "sp.txt";• open (SP,$sp_file) || die "cannot open \"$sp_file\":$!";

• while ($line=<SP>){• chomp($line);

• my $field = substr ($line,0,2);• my $value = substr ($line,5);

• if ($field eq "ID"){e• $id = $value• }• if ($field eq "AC"){• $ac = $value• }• if ($field eq "DE"){• $de = $value• }• }

• print "Identification: $id\n";• print "Accession No.: $ac\n";• print "Description: $de\n";

Page 23: Bioinformatica p4-io

2. PAM-simulator.pl

– Check transition matrix with and without randomizing the rows of evolutions

– Adapt the program to simulate evolving DNA

– Adapt the program so it generates random proteins taking into account the relative frequences found in step 1

– Write the output to a multi-fasta file>PAM1AHFALKJHFDLKFJHALSKJFH>PAM2AHGALKJHFDLKFJHALSKJFH>PAM3AHGALKJHFDLKFJHALSKJFH…..

Page 24: Bioinformatica p4-io

• Initialize: – Generate Random protein (1000 aa)

• Simulate evolution (eg 250 for PAM250)– Apply PAM1 Transition matrix to each amino

acid– Use Weighted Random Selection

• Iterate – Measure difference to orginal protein

Experiment: pam-simulator.pl

Page 25: Bioinformatica p4-io

Dayhoff’s PAM1 mutation probability matrix (Transition Matrix)

AAla

RArg

NAsn

DAsp

CCys

QGln

EGlu

GGly

HHis

IIle

A 9867 2 9 10 3 8 17 21 2 6

R 1 9913 1 0 1 10 0 0 10 3

N 4 1 9822 36 0 4 6 6 21 3

D 6 0 42 9859 0 6 53 6 4 1

C 1 1 0 0 9973 0 0 0 1 1

Q 3 9 4 5 0 9876 27 1 23 1

E 10 0 7 56 0 35 9865 4 2 3

G 21 1 12 11 1 3 7 9935 1 0

H 1 8 18 3 1 20 1 0 9912 0

I 2 2 3 1 2 1 2 0 0 9872

Page 26: Bioinformatica p4-io

Weighted Random Selection

• Ala => Xxx (%)A

R

N

D

C

Q

E

G

H

I

L

K

M

F

P

S

T

W

Y

V

Page 27: Bioinformatica p4-io

PAM-Simulator

PAM-simulator

0

20

40

60

80

100

120

0 50 100 150 200 250 300

PAM

%id

enti

ty

Page 28: Bioinformatica p4-io

3. Palindromes

What is the longest palindroom in palin.fasta ?

Why are restriction sites palindromic ? How long is the longest palindroom in the genome ?

Hints: http://www.man.poznan.pl/cmst/papers/5/art_2/vol5art2.htmlPalingram.pl

Page 29: Bioinformatica p4-io

Palin.fasta• >palin.fasta• ATGGCTTATTTATTTGCCCACAAGAACTTAGGTGCATTGAAATCTAAAG

CTAATTGCTTATTTAGCTTTGCTTGGCCTTTTCACTTAAATAAAACATAGCATCAACTTCAGCAGGAATGGGTGCACATGCTGATCGAGGTGGAAGAAGGGCACATATGGCATCGGCATCCTTATGGCTAATTTTAAATGGAGAACTTTCTAAAGTCACGTTTTCACATGCAATATTCTTAACATTTTCAATTTTTTTTGTAACTAATTCTTCCCATCTACTATGTGTTTGCAAGACAATCTCAGTAGCAAACTCCTTATGCTTAGCCTCACCGTTAAAAGCAAACTTATTTGGGGGATCTCCACCAGGCATTTTATATATTTTGAACCACTCTACTGACGCGTTAGCTTCAAGTAAACCAGGCATCACTTCTTTTACGTCATCAATATCATTAAGCTTTGAAGCTAGAGGATCATTTACATCAATTGCTATTACTTAGCTTAGCCCTTCAAGTACTTGAAGGGCTAAGCTTCCAATCTGTTTCACCATTGTCAATCATAGCTAAGACACCCAGCAACTTAACTTGCAAAACAGATCCTCTTTCTGCAACTTTGTAACCTATCTCTATTACATCAACAGGATCACCATCACCAAATGCATTAGTGTGCTCATCAATAAGATTTGGATCCTCCCAAGTCTGTGGCAAAGCTCCATAATTCCAAGGATAACC

Page 30: Bioinformatica p4-io

Palingram.pl#!E:\perl\bin\perl -w$line_input = "edellede parterretrap trap op sirenes en er is popart

test";$line_input =~ s/\s//g;$l = length($line_input);for ($m = 0;$m<=$l-1;$m++){$line = substr($line_input,$m);print "length=$m:$l\t".$line."\n";for $n (8..25) { $re = qr /[a-z]{$n}/; print "pattern ($n) = $re\n"; $regexes[$n-8] = $re; }foreach (@regexes) { while ($line =~ m/$_/g) { $endline = $'; $match = $&; $all = $match.$endline; $revmatch = reverse($match); if ($all =~ /^($revmatch)/)

{ $palindrome = $revmatch . "*" . $1 ; $palhash{$palindrome}++; }

} }}

print "Set van palingram\n";while(($key, $value) = each (%palhash)) { print "$key => $value\n"; }